Starting /dee2/code/volunteer_pipeline.sh SRR12670134 current disk space = 3057293799424 free memory = 1465932360 SRR12670134 SRAfilesize a1623b11ab6f5d4756d248ce29da6dbf SRR12670134.sra SRR12670134.sra file validated SRR12670134 is paired end SRR12670134 is conventional basespace SRR12670134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6185 37.0 37.0 37.0 37.0 37.0 2 36.49325 37.0 37.0 37.0 37.0 37.0 3 36.573 37.0 37.0 37.0 37.0 37.0 4 36.671 37.0 37.0 37.0 37.0 37.0 5 36.6315 37.0 37.0 37.0 37.0 37.0 6 36.629 37.0 37.0 37.0 37.0 37.0 7 36.563 37.0 37.0 37.0 37.0 37.0 8 36.575 37.0 37.0 37.0 37.0 37.0 9 36.6205 37.0 37.0 37.0 37.0 37.0 10-14 36.581 37.0 37.0 37.0 37.0 37.0 15-19 36.5778 37.0 37.0 37.0 37.0 37.0 20-24 36.5201 37.0 37.0 37.0 37.0 37.0 25-29 36.4457 37.0 37.0 37.0 37.0 37.0 30-34 36.4793 37.0 37.0 37.0 37.0 37.0 35-39 36.4523 37.0 37.0 37.0 37.0 37.0 40-44 36.4621 37.0 37.0 37.0 37.0 37.0 45-49 36.4202 37.0 37.0 37.0 37.0 37.0 50-54 36.4051 37.0 37.0 37.0 37.0 37.0 55-59 36.354 37.0 37.0 37.0 37.0 37.0 60-64 36.368300000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2661 37.0 37.0 37.0 37.0 37.0 70-74 36.3275 37.0 37.0 37.0 37.0 37.0 75-79 36.332499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3315 37.0 37.0 37.0 37.0 37.0 85-89 36.3091 37.0 37.0 37.0 37.0 37.0 90-94 36.297399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2401 37.0 37.0 37.0 37.0 37.0 100-104 36.2653 37.0 37.0 37.0 37.0 37.0 105-109 36.1954 37.0 37.0 37.0 37.0 37.0 110-114 36.1357 37.0 37.0 37.0 37.0 37.0 115-119 36.13869999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0045 37.0 37.0 37.0 37.0 37.0 125-129 35.8774 37.0 37.0 37.0 37.0 37.0 130-134 35.67059999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.4068 37.0 37.0 37.0 37.0 37.0 140-144 35.0953 37.0 37.0 37.0 34.6 37.0 145-149 34.815999999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.33525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 3.0 26 2.0 27 15.0 28 7.0 29 15.0 30 35.0 31 36.0 32 89.0 33 102.0 34 141.0 35 302.0 36 2841.0 37 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.975 10.8 7.95 42.275 2 19.914936202151615 14.335751813860394 35.2514385789342 30.497873405053788 3 18.25 16.925 27.400000000000002 37.425000000000004 4 22.275 25.825 22.05 29.849999999999998 5 22.35 28.825 24.675 24.15 6 20.724999999999998 35.575 23.825 19.875 7 14.825 26.35 41.175 17.65 8 17.150000000000002 25.85 32.7 24.3 9 17.299999999999997 22.35 36.075 24.275 10-14 20.155 29.87 27.694999999999997 22.28 15-19 20.165 27.694999999999997 28.33 23.810000000000002 20-24 20.385 28.499999999999996 27.875 23.24 25-29 20.080000000000002 27.944999999999997 27.72 24.255 30-34 20.41 28.93 27.275 23.385 35-39 20.28 27.944999999999997 27.855 23.919999999999998 40-44 20.455000000000002 28.24 27.345000000000002 23.96 45-49 20.23 28.275 27.644999999999996 23.849999999999998 50-54 20.794999999999998 27.49 27.665 24.05 55-59 20.46 27.675 28.249999999999996 23.615 60-64 20.26 28.275 27.810000000000002 23.655 65-69 20.345 27.389999999999997 28.665000000000003 23.599999999999998 70-74 21.15 27.605 27.384999999999998 23.86 75-79 21.65 27.32 28.265 22.765 80-84 20.505000000000003 28.544999999999998 27.565 23.385 85-89 21.529999999999998 27.965 27.165 23.34 90-94 21.23 28.455000000000002 26.96 23.355 95-99 21.065 28.854999999999997 26.58 23.5 100-104 21.16 28.804999999999996 26.46 23.575 105-109 21.255 28.265 26.240000000000002 24.240000000000002 110-114 21.09 28.595 26.61 23.705000000000002 115-119 22.075 27.884999999999998 26.424999999999997 23.615 120-124 21.55 27.644999999999996 26.41 24.395 125-129 22.134999999999998 28.03 26.265 23.57 130-134 21.715 27.83 25.465 24.990000000000002 135-139 22.24 27.395000000000003 25.85 24.515 140-144 22.375 26.97 26.525 24.13 145-149 23.14 27.150000000000002 25.745 23.965 150-151 23.474999999999998 26.9125 25.7625 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.5 26 3.5 27 5.5 28 11.5 29 12.0 30 13.5 31 19.0 32 25.0 33 41.0 34 49.0 35 58.0 36 82.5 37 105.5 38 130.5 39 159.0 40 182.5 41 196.0 42 232.5 43 273.0 44 270.0 45 263.5 46 256.0 47 239.5 48 233.5 49 217.0 50 173.0 51 141.0 52 126.0 53 103.0 54 81.5 55 57.5 56 43.0 57 45.5 58 37.0 59 31.0 60 29.0 61 18.5 62 10.5 63 3.0 64 1.0 65 1.0 66 1.0 67 3.0 68 3.0 69 1.0 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.325 #Duplication Level Percentage of deduplicated Percentage of total 1 83.97839783978398 69.975 2 12.811281128112812 21.349999999999998 3 2.6402640264026402 6.6000000000000005 4 0.42004200420042004 1.4000000000000001 5 0.09000900090009001 0.375 6 0.06000600060006001 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACCCAATTGTTTGTTTAATCGTATTTAATGTCAAAGTAGCACTCAGAGG 6 0.15 No Hit GGTGGAGGGACCGATGAGGAAGTTGAGAAATTGAGGCGATACGCGAGGAG 6 0.15 No Hit CCGGAGATTTCACAAACCCTGAGCTAAGGCAGATTTTCTTGGGTGAAGAA 5 0.125 No Hit GATATATATTCACCCTAAGATTAATCAAATCAAACTTTTCCTTCATATTG 5 0.125 No Hit GTCCAGTATAGGTTCAACTTCAACTGCCTCGCGGCCATTTATGTCATAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.11249999999999999 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.36250000000000004 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.7749999999999999 0.0 0.0 0.0 0.0 80-81 1.1125 0.0 0.0 0.0 0.0 82-83 1.4 0.0 0.0 0.0 0.0 84-85 1.7374999999999998 0.0 0.0 0.0 0.0 86-87 2.1 0.0 0.0 0.0 0.0 88-89 2.5625 0.0 0.0 0.0 0.0 90-91 3.1125 0.0 0.0 0.0 0.0 92-93 3.45 0.0 0.0 0.0 0.0 94-95 3.9125 0.0 0.0 0.0 0.0 96-97 4.45 0.0 0.0 0.0 0.0 98-99 5.2875 0.0 0.0 0.0 0.0 100-101 6.025 0.0 0.0 0.0 0.0 102-103 6.725 0.0 0.0 0.0 0.0 104-105 7.7625 0.0 0.0 0.0 0.0 106-107 8.4 0.0 0.0 0.0 0.0 108-109 9.125 0.0 0.0 0.0 0.0 110-111 9.9875 0.0 0.0 0.0 0.0 112-113 10.8 0.0 0.0 0.0 0.0 114-115 11.649999999999999 0.0 0.0 0.0 0.0 116-117 12.55 0.0 0.0 0.0 0.0 118-119 13.625 0.0 0.0 0.0 0.0 120-121 14.55 0.0 0.0 0.0 0.0 122-123 15.55 0.0 0.0 0.0 0.0 124-125 16.625 0.0 0.0 0.0 0.0 126-127 17.65 0.0 0.0 0.0 0.0 128-129 18.5625 0.0 0.0 0.0 0.0 130-131 19.45 0.0 0.0 0.0 0.0 132-133 20.4125 0.0 0.0 0.0 0.0 134-135 20.95 0.0 0.0 0.0 0.0 136-137 21.7625 0.0 0.0 0.0 0.0 138-139 22.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE SRR12670134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4485 37.0 37.0 37.0 37.0 37.0 2 36.3285 37.0 37.0 37.0 37.0 37.0 3 36.341 37.0 37.0 37.0 37.0 37.0 4 36.3635 37.0 37.0 37.0 37.0 37.0 5 36.413 37.0 37.0 37.0 37.0 37.0 6 36.354 37.0 37.0 37.0 37.0 37.0 7 36.342 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.3995 37.0 37.0 37.0 37.0 37.0 10-14 36.337900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.302800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3151 37.0 37.0 37.0 37.0 37.0 25-29 36.2206 37.0 37.0 37.0 37.0 37.0 30-34 36.1984 37.0 37.0 37.0 37.0 37.0 35-39 36.1708 37.0 37.0 37.0 37.0 37.0 40-44 36.147000000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.1884 37.0 37.0 37.0 37.0 37.0 50-54 36.1244 37.0 37.0 37.0 37.0 37.0 55-59 36.1021 37.0 37.0 37.0 37.0 37.0 60-64 36.113 37.0 37.0 37.0 37.0 37.0 65-69 36.080200000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9995 37.0 37.0 37.0 37.0 37.0 75-79 36.0539 37.0 37.0 37.0 37.0 37.0 80-84 35.979499999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.009100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.019600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.9446 37.0 37.0 37.0 37.0 37.0 100-104 35.8979 37.0 37.0 37.0 37.0 37.0 105-109 35.8083 37.0 37.0 37.0 37.0 37.0 110-114 35.7737 37.0 37.0 37.0 37.0 37.0 115-119 35.8283 37.0 37.0 37.0 37.0 37.0 120-124 35.6181 37.0 37.0 37.0 37.0 37.0 125-129 35.5491 37.0 37.0 37.0 37.0 37.0 130-134 35.320800000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.2193 37.0 37.0 37.0 29.8 37.0 140-144 35.007999999999996 37.0 37.0 37.0 27.4 37.0 145-149 34.6205 37.0 37.0 37.0 25.0 37.0 150-151 34.321749999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 4.0 15 4.0 16 0.0 17 1.0 18 1.0 19 3.0 20 2.0 21 3.0 22 1.0 23 3.0 24 9.0 25 5.0 26 7.0 27 9.0 28 17.0 29 20.0 30 25.0 31 42.0 32 52.0 33 100.0 34 192.0 35 528.0 36 2639.0 37 326.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75 22.725 11.025 30.5 2 25.25 25.874999999999996 32.324999999999996 16.55 3 20.575 27.975 32.275 19.175 4 25.924999999999997 32.625 22.925 18.525 5 25.775 35.3 22.825 16.1 6 21.4 37.175000000000004 23.474999999999998 17.95 7 20.05 21.875 38.6 19.475 8 22.25 24.4 28.175 25.174999999999997 9 21.2 25.7 29.599999999999998 23.5 10-14 23.225 28.389999999999997 27.134999999999998 21.25 15-19 23.150000000000002 28.105000000000004 27.295 21.45 20-24 23.189999999999998 29.025000000000002 26.815 20.97 25-29 23.015 28.955 27.200000000000003 20.830000000000002 30-34 23.36 28.410000000000004 28.22 20.01 35-39 23.035 28.46 27.700000000000003 20.805 40-44 22.79 28.1 27.605 21.505 45-49 23.485 28.365000000000002 27.485 20.665 50-54 23.06 28.634999999999998 27.35 20.955 55-59 22.82 27.744999999999997 28.15 21.285 60-64 23.544999999999998 27.715 27.485 21.255 65-69 23.285 28.055000000000003 27.634999999999998 21.025 70-74 23.419999999999998 28.310000000000002 27.625 20.645 75-79 23.45 28.410000000000004 26.6 21.54 80-84 23.105 28.37 27.205000000000002 21.32 85-89 24.834999999999997 27.525 26.105 21.535 90-94 24.115000000000002 28.07 27.08 20.735 95-99 24.285 28.64 26.135 20.94 100-104 24.865000000000002 28.605000000000004 26.045 20.485 105-109 25.44 28.715000000000003 26.295 19.55 110-114 25.585 28.52 26.02 19.875 115-119 26.155 27.529999999999998 27.07 19.245 120-124 26.305 27.925 26.229999999999997 19.54 125-129 26.965 28.415000000000003 25.16 19.46 130-134 27.36 26.884999999999998 26.57 19.185 135-139 28.09 27.26 25.624999999999996 19.025 140-144 29.13 26.700000000000003 26.085 18.085 145-149 28.93 27.544999999999998 25.5 18.025 150-151 29.975 27.6125 25.3125 17.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.5 21 1.5 22 0.0 23 0.5 24 0.5 25 2.0 26 3.5 27 3.5 28 6.5 29 11.5 30 12.5 31 15.0 32 20.5 33 29.0 34 44.0 35 59.5 36 77.0 37 105.5 38 132.0 39 157.5 40 192.0 41 220.0 42 255.5 43 284.5 44 298.0 45 275.5 46 247.5 47 247.5 48 217.5 49 191.5 50 171.0 51 136.5 52 116.5 53 105.5 54 83.0 55 66.5 56 54.0 57 29.0 58 24.0 59 27.5 60 19.0 61 12.5 62 10.0 63 4.5 64 1.5 65 1.5 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 1.0 97 1.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.46369883477742 70.675 2 12.488795936659695 20.9 3 2.449955183746639 6.15 4 0.3884075291305647 1.3 5 0.11951000896325066 0.5 6 0.05975500448162533 0.3 7 0.029877502240812665 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit ATTCCTTCTGTTTCTGCACGAGCAGGAGGGATATTTTTGCCGCTAGTGAA 6 0.15 No Hit CCCAATTCTTGTGAAGATTTGGTAACATCAAGAATATCATCCACTACTTG 6 0.15 No Hit CAGTCTTTACATATACCAGCGGCACTTTTTCAAGATTTTGATCAACTGAG 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit CGTGAGGCGGCTGATATAATCAAGAAGAAGGGAAAGATGTGCTGCCTCTT 5 0.125 No Hit GTGTGTTCTTGTCTAGACTTCTTGTCAAAGAGGGTCATCAGGTGACCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0125 0.0 0.0 54-55 0.05 0.0 0.025 0.0 0.0 56-57 0.05 0.0 0.025 0.0 0.0 58-59 0.05 0.0 0.025 0.0 0.0 60-61 0.05 0.0 0.025 0.0 0.0 62-63 0.05 0.0 0.025 0.0 0.0 64-65 0.075 0.0 0.025 0.0 0.0 66-67 0.11249999999999999 0.0 0.025 0.0 0.0 68-69 0.175 0.0 0.025 0.0 0.0 70-71 0.2875 0.0 0.025 0.0 0.0 72-73 0.36250000000000004 0.0 0.025 0.0 0.0 74-75 0.5 0.0 0.025 0.0 0.0 76-77 0.625 0.0 0.025 0.0 0.0 78-79 0.7749999999999999 0.0 0.025 0.0 0.0 80-81 1.1375 0.0 0.025 0.0 0.0 82-83 1.4249999999999998 0.0 0.025 0.0 0.0 84-85 1.7625000000000002 0.0 0.025 0.0 0.0 86-87 2.125 0.0 0.025 0.0 0.0 88-89 2.5875000000000004 0.0 0.025 0.0 0.0 90-91 3.1375 0.0 0.025 0.0 0.0 92-93 3.45 0.0 0.025 0.0 0.0 94-95 3.9375 0.0 0.025 0.0 0.0 96-97 4.475 0.0 0.025 0.0 0.0 98-99 5.3375 0.0 0.025 0.0 0.0 100-101 6.075 0.0 0.025 0.0 0.0 102-103 6.7625 0.0 0.025 0.0 0.0 104-105 7.8125 0.0 0.025 0.0 0.0 106-107 8.4875 0.0 0.025 0.0 0.0 108-109 9.2125 0.0 0.025 0.0 0.0 110-111 10.075 0.0 0.025 0.0 0.0 112-113 10.925 0.0 0.025 0.0 0.0 114-115 11.8 0.0 0.025 0.0 0.0 116-117 12.7 0.0 0.025 0.0 0.0 118-119 13.775 0.0 0.025 0.0 0.0 120-121 14.712499999999999 0.0 0.025 0.0 0.0 122-123 15.712499999999999 0.0 0.025 0.0 0.0 124-125 16.8 0.0 0.025 0.0 0.0 126-127 17.825 0.0 0.025 0.0 0.0 128-129 18.7625 0.0 0.025 0.0 0.0 130-131 19.65 0.0 0.025 0.0 0.0 132-133 20.612499999999997 0.0 0.025 0.0 0.0 134-135 21.15 0.0 0.025 0.0 0.0 136-137 21.9625 0.0 0.025 0.0 0.0 138-139 22.825 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGAA 10 0.006830828 145.0 9 CAGTATG 10 0.006830828 145.0 7 TTTTCAG 10 0.006830828 145.0 3 TTTCAGT 10 0.006830828 145.0 4 AGTATGA 10 0.006830828 145.0 8 TTTTTCA 30 0.0017973486 72.5 2 AGTGTAG 40 0.005621335 54.375 145 >>END_MODULE Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530555 spots for SRR12670134.sra Written 530555 spots for SRR12670134.sra Read 530570 spots for SRR12670134.sra Written 530570 spots for SRR12670134.sra SRR ids: ['SRR12670134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uk5mbsp4 SRR12670134.sra spots: 10611115 blocks: [[1, 530555], [530556, 1061110], [1061111, 1591665], [1591666, 2122220], [2122221, 2652775], [2652776, 3183330], [3183331, 3713885], [3713886, 4244440], [4244441, 4774995], [4774996, 5305550], [5305551, 5836105], [5836106, 6366660], [6366661, 6897215], [6897216, 7427770], [7427771, 7958325], [7958326, 8488880], [8488881, 9019435], [9019436, 9549990], [9549991, 10080545], [10080546, 10611115]] SRR12670134 file size 3584420 SRR12670134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670134 SRR12670134_1.fastq SRR12670134_2.fastq Input file: SRR12670134_1.fastq Paired file: SRR12670134_2.fastq trimmed: SRR12670134-trimmed-pair1.fastq, SRR12670134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:01:38 2025 >> started Tue Feb 11 01:01:50 2025 >> done (11.985s) 10611115 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 6832 ( 0.06%) empty read pairs filtered out after trimming by size control 10604229 (99.94%) read pairs available; of these: 2729829 (25.74%) trimmed read pairs available after processing 7874400 (74.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 7 0.00% 21 5 0.00% 22 5 0.00% 23 15 0.00% 24 12 0.00% 25 18 0.00% 26 22 0.00% 27 27 0.00% 28 28 0.00% 29 27 0.00% 30 30 0.00% 31 44 0.00% 32 37 0.00% 33 54 0.00% 34 71 0.00% 35 55 0.00% 36 74 0.00% 37 92 0.00% 38 89 0.00% 39 118 0.00% 40 118 0.00% 41 153 0.00% 42 162 0.00% 43 151 0.00% 44 175 0.00% 45 162 0.00% 46 199 0.00% 47 235 0.00% 48 287 0.00% 49 275 0.00% 50 387 0.00% 51 446 0.00% 52 449 0.00% 53 549 0.01% 54 480 0.00% 55 619 0.01% 56 676 0.01% 57 823 0.01% 58 995 0.01% 59 1148 0.01% 60 1317 0.01% 61 1526 0.01% 62 1681 0.02% 63 1904 0.02% 64 2001 0.02% 65 2140 0.02% 66 2373 0.02% 67 2596 0.02% 68 2986 0.03% 69 3281 0.03% 70 3877 0.04% 71 4474 0.04% 72 5072 0.05% 73 5682 0.05% 74 6250 0.06% 75 6796 0.06% 76 7505 0.07% 77 7767 0.07% 78 8423 0.08% 79 9422 0.09% 80 10337 0.10% 81 11829 0.11% 82 13103 0.12% 83 14009 0.13% 84 15642 0.15% 85 16309 0.15% 86 17675 0.17% 87 17894 0.17% 88 18880 0.18% 89 19813 0.19% 90 21553 0.20% 91 22666 0.21% 92 24043 0.23% 93 26269 0.25% 94 27330 0.26% 95 29097 0.27% 96 29706 0.28% 97 30148 0.28% 98 30531 0.29% 99 31543 0.30% 100 32384 0.31% 101 32741 0.31% 102 34799 0.33% 103 36019 0.34% 104 37146 0.35% 105 37648 0.36% 106 38608 0.36% 107 38382 0.36% 108 38777 0.37% 109 39024 0.37% 110 38937 0.37% 111 39733 0.37% 112 40913 0.39% 113 41424 0.39% 114 42584 0.40% 115 43273 0.41% 116 44094 0.42% 117 44086 0.42% 118 43498 0.41% 119 43085 0.41% 120 43792 0.41% 121 43609 0.41% 122 44891 0.42% 123 45206 0.43% 124 45771 0.43% 125 46001 0.43% 126 46527 0.44% 127 46343 0.44% 128 45890 0.43% 129 45282 0.43% 130 45139 0.43% 131 44609 0.42% 132 45111 0.43% 133 46237 0.44% 134 45769 0.43% 135 46447 0.44% 136 46279 0.44% 137 46591 0.44% 138 46480 0.44% 139 46016 0.43% 140 45845 0.43% 141 45076 0.43% 142 45373 0.43% 143 45616 0.43% 144 46296 0.44% 145 45915 0.43% 146 46359 0.44% 147 46299 0.44% 148 46772 0.44% 149 46109 0.43% 150 46252 0.44% 151 7874400 74.26% 10604229 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=122.64 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.2 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.79 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=68.37 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.2 sequence=AAGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:02:43 Started mapping on | Feb 11 01:02:44 Finished on | Feb 11 01:03:58 Mapping speed, Million of reads per hour | 515.88 Number of input reads | 10604229 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 8231629 Uniquely mapped reads % | 77.63% Average mapped length | 286.18 Number of splices: Total | 8407324 Number of splices: Annotated (sjdb) | 8233086 Number of splices: GT/AG | 8229283 Number of splices: GC/AG | 140920 Number of splices: AT/AC | 4964 Number of splices: Non-canonical | 32157 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224347 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 91599 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.23% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2148253 2148253 2148253 N_multimapping 224347 224347 224347 N_noFeature 270525 8108334 305963 N_ambiguous 198685 1358 110033 UnstrandedReadsAssigned:7762419 PositiveStrandReadsAssigned:121937 NegativeStrandReadsAssigned:7815633 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=133 echo kmer=129 SRR12670134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670134-trimmed-pair1.fastq SRR12670134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,604,229 reads, 9,479,086 reads pseudoaligned [quant] estimated average fragment length: 209.485 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR12670134.ke.tsv 34699 SRR12670134.se.tsv 87100 total ==> SRR12670134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.51 434 23.6442 Potri.005G024800.1.v4.1 1035 826.515 159 18.9646 Potri.004G059700.1.v4.1 961 752.56 0 0 Potri.007G009000.2.v4.1 1416 1207.51 0 0 Potri.003G141000.2.v4.1 2943 2734.51 431.503 15.5561 Potri.016G087400.1.v4.1 270 110.917 450.634 400.518 Potri.015G069301.1.v4.1 564 363.167 0 0 Potri.010G195200.1.v4.1 1773 1564.51 41 2.58346 Potri.012G127500.1.v4.1 977 768.525 29 3.71995 ==> SRR12670134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 185 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670134 completed mapping pipeline successfully