Starting /dee2/code/volunteer_pipeline.sh SRR12670136 current disk space = 3057038352384 free memory = 1514643260 SRR12670136 SRAfilesize 4f28da2f3cf089b2ff6faaaf02633321 SRR12670136.sra SRR12670136.sra file validated SRR12670136 is paired end SRR12670136 is conventional basespace SRR12670136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6515 37.0 37.0 37.0 37.0 37.0 2 36.4875 37.0 37.0 37.0 37.0 37.0 3 36.5835 37.0 37.0 37.0 37.0 37.0 4 36.5775 37.0 37.0 37.0 37.0 37.0 5 36.6445 37.0 37.0 37.0 37.0 37.0 6 36.6365 37.0 37.0 37.0 37.0 37.0 7 36.548 37.0 37.0 37.0 37.0 37.0 8 36.65 37.0 37.0 37.0 37.0 37.0 9 36.5985 37.0 37.0 37.0 37.0 37.0 10-14 36.62949999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5807 37.0 37.0 37.0 37.0 37.0 20-24 36.542 37.0 37.0 37.0 37.0 37.0 25-29 36.530899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.510799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.473299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5127 37.0 37.0 37.0 37.0 37.0 45-49 36.464099999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.421200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.4105 37.0 37.0 37.0 37.0 37.0 60-64 36.35510000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.351 37.0 37.0 37.0 37.0 37.0 70-74 36.3623 37.0 37.0 37.0 37.0 37.0 75-79 36.311 37.0 37.0 37.0 37.0 37.0 80-84 36.318799999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3368 37.0 37.0 37.0 37.0 37.0 90-94 36.330799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.25359999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2702 37.0 37.0 37.0 37.0 37.0 105-109 36.241 37.0 37.0 37.0 37.0 37.0 110-114 36.170399999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.193200000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.1374 37.0 37.0 37.0 37.0 37.0 125-129 36.000299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.915 37.0 37.0 37.0 37.0 37.0 135-139 35.7883 37.0 37.0 37.0 37.0 37.0 140-144 35.4981 37.0 37.0 37.0 37.0 37.0 145-149 35.41609999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.19175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 2.0 26 3.0 27 5.0 28 11.0 29 14.0 30 14.0 31 37.0 32 53.0 33 89.0 34 146.0 35 321.0 36 2913.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.675 10.475 5.050000000000001 45.800000000000004 2 17.04204204204204 13.013013013013014 39.78978978978979 30.155155155155157 3 17.974999999999998 16.425 27.800000000000004 37.8 4 23.925 23.150000000000002 24.05 28.875 5 22.675 31.75 24.075 21.5 6 20.8 33.324999999999996 25.25 20.625 7 15.2 26.674999999999997 41.9 16.225 8 17.65 26.224999999999998 31.624999999999996 24.5 9 17.599999999999998 23.825 34.425 24.15 10-14 19.63 29.415000000000003 27.400000000000002 23.555 15-19 20.125 27.689999999999998 28.050000000000004 24.135 20-24 20.465 27.735 27.96 23.84 25-29 20.630000000000003 28.389999999999997 27.235 23.745 30-34 20.89 28.499999999999996 27.045 23.565 35-39 20.61 28.24 27.67 23.48 40-44 20.330000000000002 27.83 27.675 24.165 45-49 20.755000000000003 28.125 27.029999999999998 24.09 50-54 21.17 28.365000000000002 27.439999999999998 23.025000000000002 55-59 20.48 28.315 27.405 23.799999999999997 60-64 20.03 28.37 28.055000000000003 23.544999999999998 65-69 20.275000000000002 28.365000000000002 28.13 23.23 70-74 20.724999999999998 27.655 28.02 23.599999999999998 75-79 20.97 28.015 27.79 23.225 80-84 20.68 28.175 28.025 23.119999999999997 85-89 20.39 28.43 27.35 23.830000000000002 90-94 20.32 28.549999999999997 27.839999999999996 23.29 95-99 21.205 28.76 26.86 23.175 100-104 21.295 28.76 26.974999999999998 22.97 105-109 21.425 28.115000000000002 26.584999999999997 23.875 110-114 21.05 28.1 26.779999999999998 24.07 115-119 21.23 28.485 26.685 23.599999999999998 120-124 21.575 28.78 26.265 23.380000000000003 125-129 21.825 28.694999999999997 25.745 23.735 130-134 21.365000000000002 28.46 25.845000000000002 24.33 135-139 21.83 28.275 25.715 24.18 140-144 21.565 27.22 26.3 24.915000000000003 145-149 21.625 27.975 25.94 24.46 150-151 21.1375 28.499999999999996 25.937500000000004 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 5.5 28 6.5 29 15.5 30 24.0 31 20.5 32 24.5 33 31.5 34 50.5 35 66.5 36 78.5 37 111.0 38 126.5 39 155.5 40 184.5 41 197.5 42 236.0 43 269.0 44 276.0 45 272.5 46 255.0 47 247.0 48 226.5 49 182.5 50 173.5 51 161.5 52 131.5 53 105.5 54 80.0 55 64.5 56 54.0 57 40.5 58 34.5 59 27.5 60 17.0 61 11.0 62 9.0 63 7.5 64 4.0 65 2.5 66 1.0 67 1.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.71642704190883 67.60000000000001 2 13.551544814928112 22.15 3 2.569593147751606 6.3 4 1.009483022330988 3.3000000000000003 5 0.1223615784643622 0.5 6 0.03059039461609055 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGACCATGTCAATTCCATTCTCTTTAGTGAACTTCCAAGCAGCTTCTTCT 6 0.15 No Hit TCTGCTTCTTATTTTATATATACCACCAACCTAATCTAAACGGAGATAAG 5 0.125 No Hit GTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTTGCAGCCAG 5 0.125 No Hit CCATCCAATATCCCGTTCTGCTCCGGGGAGAACCCGCCGTCATCGCTCAC 5 0.125 No Hit GTAACTTTTGCTTGGCGATGGCCTCGTACTCCATGACATTGGTTATCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 1.125 0.0 0.0 0.0 0.0 84-85 1.3875 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 2.075 0.0 0.0 0.0 0.0 90-91 2.375 0.0 0.0 0.0 0.0 92-93 2.75 0.0 0.0 0.0 0.0 94-95 3.2249999999999996 0.0 0.0 0.0 0.0 96-97 3.825 0.0 0.0 0.0 0.0 98-99 4.375 0.0 0.0 0.0 0.0 100-101 4.862500000000001 0.0 0.0 0.0 0.0 102-103 5.3875 0.0 0.0 0.0 0.0 104-105 5.9875 0.0 0.0 0.0 0.0 106-107 6.862500000000001 0.0 0.0 0.0 0.0 108-109 7.5875 0.0 0.0 0.0 0.0 110-111 8.1625 0.0 0.0 0.0 0.0 112-113 8.8125 0.0 0.0 0.0 0.0 114-115 9.675 0.0 0.0 0.0 0.0 116-117 10.3625 0.0 0.0 0.0 0.0 118-119 11.225 0.0 0.0 0.0 0.0 120-121 12.075 0.0 0.0 0.0 0.0 122-123 12.8375 0.0 0.0 0.0 0.0 124-125 13.725 0.0 0.0 0.0 0.0 126-127 14.9375 0.0 0.0 0.0 0.0 128-129 15.9375 0.0 0.0 0.0 0.0 130-131 17.012500000000003 0.0 0.0 0.0 0.0 132-133 17.950000000000003 0.0 0.0 0.0 0.0 134-135 18.9125 0.0 0.0 0.0 0.0 136-137 19.5 0.0 0.0 0.0 0.0 138-139 20.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAAC 10 0.006830828 145.0 1 >>END_MODULE SRR12670136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.443 37.0 37.0 37.0 37.0 37.0 2 36.162 37.0 37.0 37.0 37.0 37.0 3 36.3585 37.0 37.0 37.0 37.0 37.0 4 36.4095 37.0 37.0 37.0 37.0 37.0 5 36.364 37.0 37.0 37.0 37.0 37.0 6 36.369 37.0 37.0 37.0 37.0 37.0 7 36.3175 37.0 37.0 37.0 37.0 37.0 8 36.4525 37.0 37.0 37.0 37.0 37.0 9 36.412 37.0 37.0 37.0 37.0 37.0 10-14 36.39059999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4481 37.0 37.0 37.0 37.0 37.0 20-24 36.4112 37.0 37.0 37.0 37.0 37.0 25-29 36.3568 37.0 37.0 37.0 37.0 37.0 30-34 36.3386 37.0 37.0 37.0 37.0 37.0 35-39 36.338100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.348 37.0 37.0 37.0 37.0 37.0 45-49 36.2955 37.0 37.0 37.0 37.0 37.0 50-54 36.277499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2085 37.0 37.0 37.0 37.0 37.0 60-64 36.200900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1478 37.0 37.0 37.0 37.0 37.0 70-74 36.145900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.1588 37.0 37.0 37.0 37.0 37.0 80-84 36.1252 37.0 37.0 37.0 37.0 37.0 85-89 36.0379 37.0 37.0 37.0 37.0 37.0 90-94 36.107000000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.0033 37.0 37.0 37.0 37.0 37.0 100-104 35.9584 37.0 37.0 37.0 37.0 37.0 105-109 35.89309999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8464 37.0 37.0 37.0 37.0 37.0 115-119 35.867000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.720000000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.544200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.3797 37.0 37.0 37.0 34.6 37.0 135-139 35.272999999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.063100000000006 37.0 37.0 37.0 27.4 37.0 145-149 34.6949 37.0 37.0 37.0 25.0 37.0 150-151 34.391625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 2.0 20 0.0 21 1.0 22 0.0 23 4.0 24 5.0 25 6.0 26 6.0 27 9.0 28 12.0 29 15.0 30 16.0 31 46.0 32 68.0 33 108.0 34 225.0 35 507.0 36 2666.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 22.2 9.225 30.125 2 24.725 25.374999999999996 34.725 15.174999999999999 3 20.1 29.5 32.225 18.175 4 23.549999999999997 33.175 23.549999999999997 19.725 5 25.3 35.775 22.15 16.775000000000002 6 19.15 40.9 22.225 17.724999999999998 7 20.474999999999998 21.575 38.125 19.825 8 21.625 26.075 29.125 23.175 9 22.8 24.05 31.45 21.7 10-14 23.985 28.694999999999997 26.705000000000002 20.615 15-19 22.99 28.050000000000004 27.529999999999998 21.43 20-24 23.02 28.884999999999998 26.97 21.125 25-29 22.915 27.775 28.560000000000002 20.75 30-34 22.505 28.225 28.54 20.73 35-39 23.47 27.47 27.705000000000002 21.355 40-44 22.715 28.775000000000002 27.575 20.935000000000002 45-49 22.335 29.304999999999996 27.589999999999996 20.77 50-54 23.635 28.59 27.305 20.47 55-59 22.855 27.735 27.935 21.475 60-64 22.845 28.225 27.939999999999998 20.990000000000002 65-69 23.580000000000002 27.905 27.584999999999997 20.93 70-74 23.355 27.794999999999998 27.975 20.875 75-79 23.265 27.200000000000003 27.61 21.925 80-84 23.65 28.405 26.935 21.01 85-89 23.915 27.250000000000004 27.145000000000003 21.69 90-94 24.349999999999998 27.544999999999998 27.115000000000002 20.990000000000002 95-99 24.02 28.599999999999998 27.185 20.195 100-104 24.845 28.65 26.200000000000003 20.305 105-109 24.535 28.325 26.605 20.535 110-114 25.669999999999998 27.87 26.51 19.950000000000003 115-119 25.64 28.134999999999998 25.835 20.39 120-124 25.705 27.939999999999998 26.965 19.39 125-129 26.52 28.42 25.685000000000002 19.375 130-134 26.625 28.189999999999998 25.89 19.295 135-139 27.915 27.395000000000003 25.46 19.23 140-144 28.15 27.49 25.525 18.834999999999997 145-149 29.21792179217922 26.932693269326936 25.327532753275328 18.52185218521852 150-151 29.666208276034506 28.2410301287661 24.315539442430303 17.777222152769095 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.0 25 1.5 26 2.0 27 8.0 28 10.0 29 12.0 30 14.0 31 21.0 32 28.5 33 39.5 34 58.0 35 69.5 36 88.0 37 101.0 38 105.0 39 142.5 40 190.0 41 234.0 42 272.0 43 286.0 44 282.5 45 267.5 46 256.5 47 229.0 48 201.0 49 197.0 50 179.5 51 145.0 52 121.5 53 97.0 54 79.5 55 66.5 56 46.5 57 37.5 58 32.0 59 23.5 60 17.0 61 11.0 62 6.0 63 3.5 64 2.5 65 1.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.45 #Duplication Level Percentage of deduplicated Percentage of total 1 82.50460405156538 67.2 2 13.505217925107427 22.0 3 3.0079803560466543 7.35 4 0.8287292817679558 2.7 5 0.06138735420503376 0.25 6 0.06138735420503376 0.3 7 0.0 0.0 8 0.03069367710251688 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 8 0.2 No Hit GGAACTGTGGAATTGGTCCTTTCAAAACCTGGAAATCTGCGGTACAATGC 6 0.15 No Hit CATGGTTTTCAGATTCAGATTTTTGTGAGAAATCAAAGCTATGGTACCAT 6 0.15 No Hit AATTAACGCCTGAAAGAGGAAAGAGAGGATCATGTCATCGTTCACCGACG 5 0.125 No Hit CTCGTCTCCACTCCTCTCCTTGCATGCACTACGACTCTAGTGCACACTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 1.125 0.0 0.0 0.0 0.0 84-85 1.4125 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 2.1125 0.0 0.0 0.0 0.0 90-91 2.4000000000000004 0.0 0.0 0.0 0.0 92-93 2.825 0.0 0.0 0.0 0.0 94-95 3.3 0.0 0.0 0.0 0.0 96-97 3.875 0.0 0.0 0.0 0.0 98-99 4.425 0.0 0.0 0.0 0.0 100-101 4.9125 0.0 0.0 0.0 0.0 102-103 5.449999999999999 0.0 0.0 0.0 0.0 104-105 6.0625 0.0 0.0 0.0 0.0 106-107 6.949999999999999 0.0 0.0 0.0 0.0 108-109 7.6875 0.0 0.0 0.0 0.0 110-111 8.274999999999999 0.0 0.0 0.0 0.0 112-113 8.9625 0.0 0.0 0.0 0.0 114-115 9.8 0.0 0.0 0.0 0.0 116-117 10.4875 0.0 0.0 0.0 0.0 118-119 11.35 0.0 0.0 0.0 0.0 120-121 12.162500000000001 0.0 0.0 0.0 0.0 122-123 12.9125 0.0 0.0 0.0 0.0 124-125 13.8125 0.0 0.0 0.0 0.0 126-127 15.037500000000001 0.0 0.0 0.0 0.0 128-129 16.025 0.0 0.0 0.0 0.0 130-131 17.0875 0.0 0.0 0.0 0.0 132-133 18.0375 0.0 0.0 0.0 0.0 134-135 19.0375 0.0 0.0 0.0 0.0 136-137 19.6375 0.0 0.0 0.0 0.0 138-139 20.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGCGG 10 0.006830828 145.0 4 GCGGAAG 10 0.006830828 145.0 7 AATGGCG 10 0.006830828 145.0 3 TGGCGGA 10 0.006830828 145.0 5 GGCGGAA 10 0.006830828 145.0 6 >>END_MODULE Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512511 spots for SRR12670136.sra Written 512511 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra Read 512509 spots for SRR12670136.sra Written 512509 spots for SRR12670136.sra SRR ids: ['SRR12670136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ujht09_t SRR12670136.sra spots: 10250182 blocks: [[1, 512509], [512510, 1025018], [1025019, 1537527], [1537528, 2050036], [2050037, 2562545], [2562546, 3075054], [3075055, 3587563], [3587564, 4100072], [4100073, 4612581], [4612582, 5125090], [5125091, 5637599], [5637600, 6150108], [6150109, 6662617], [6662618, 7175126], [7175127, 7687635], [7687636, 8200144], [8200145, 8712653], [8712654, 9225162], [9225163, 9737671], [9737672, 10250182]] SRR12670136 file size 3461759 SRR12670136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670136 SRR12670136_1.fastq SRR12670136_2.fastq Input file: SRR12670136_1.fastq Paired file: SRR12670136_2.fastq trimmed: SRR12670136-trimmed-pair1.fastq, SRR12670136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:35:47 2025 >> started Tue Feb 11 02:06:31 2025 >> done (1843.909s) 10250182 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 1535 ( 0.01%) empty read pairs filtered out after trimming by size control 10248570 (99.98%) read pairs available; of these: 2664822 (26.00%) trimmed read pairs available after processing 7583748 (74.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 7 0.00% 21 13 0.00% 22 18 0.00% 23 11 0.00% 24 29 0.00% 25 23 0.00% 26 36 0.00% 27 32 0.00% 28 29 0.00% 29 35 0.00% 30 46 0.00% 31 59 0.00% 32 61 0.00% 33 82 0.00% 34 63 0.00% 35 71 0.00% 36 80 0.00% 37 94 0.00% 38 77 0.00% 39 133 0.00% 40 136 0.00% 41 119 0.00% 42 161 0.00% 43 148 0.00% 44 116 0.00% 45 160 0.00% 46 183 0.00% 47 256 0.00% 48 271 0.00% 49 303 0.00% 50 322 0.00% 51 399 0.00% 52 467 0.00% 53 448 0.00% 54 477 0.00% 55 492 0.00% 56 576 0.01% 57 678 0.01% 58 820 0.01% 59 882 0.01% 60 1077 0.01% 61 1293 0.01% 62 1401 0.01% 63 1518 0.01% 64 1693 0.02% 65 1739 0.02% 66 1977 0.02% 67 2324 0.02% 68 2477 0.02% 69 2896 0.03% 70 3296 0.03% 71 3775 0.04% 72 4373 0.04% 73 4942 0.05% 74 5436 0.05% 75 5698 0.06% 76 6330 0.06% 77 6610 0.06% 78 7255 0.07% 79 8151 0.08% 80 8777 0.09% 81 10000 0.10% 82 10985 0.11% 83 11771 0.11% 84 13029 0.13% 85 14187 0.14% 86 14771 0.14% 87 15229 0.15% 88 16587 0.16% 89 16788 0.16% 90 17696 0.17% 91 19479 0.19% 92 20373 0.20% 93 22085 0.22% 94 23768 0.23% 95 24749 0.24% 96 25345 0.25% 97 26189 0.26% 98 26531 0.26% 99 26943 0.26% 100 28159 0.27% 101 28374 0.28% 102 29857 0.29% 103 31392 0.31% 104 32588 0.32% 105 33556 0.33% 106 34458 0.34% 107 34879 0.34% 108 35298 0.34% 109 35567 0.35% 110 35702 0.35% 111 36174 0.35% 112 37902 0.37% 113 38081 0.37% 114 39565 0.39% 115 40791 0.40% 116 41070 0.40% 117 42004 0.41% 118 42389 0.41% 119 42370 0.41% 120 42452 0.41% 121 43067 0.42% 122 44453 0.43% 123 44205 0.43% 124 45209 0.44% 125 45655 0.45% 126 46778 0.46% 127 47002 0.46% 128 47304 0.46% 129 46773 0.46% 130 47114 0.46% 131 46436 0.45% 132 46783 0.46% 133 47447 0.46% 134 48220 0.47% 135 48634 0.47% 136 49477 0.48% 137 49684 0.48% 138 49871 0.49% 139 50550 0.49% 140 50037 0.49% 141 49667 0.48% 142 50094 0.49% 143 50393 0.49% 144 50937 0.50% 145 51369 0.50% 146 51363 0.50% 147 51309 0.50% 148 51991 0.51% 149 50891 0.50% 150 51516 0.50% 151 7583748 74.00% 10248570 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=24 prefix-density=0.38 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=213.69 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=40.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.0 sequence=TAAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCAC SRR12670136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 02:47:57 Started mapping on | Feb 11 02:48:10 Finished on | Feb 11 04:26:33 Mapping speed, Million of reads per hour | 6.25 Number of input reads | 10248570 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 9613697 Uniquely mapped reads % | 93.81% Average mapped length | 284.77 Number of splices: Total | 9018061 Number of splices: Annotated (sjdb) | 8807895 Number of splices: GT/AG | 8825791 Number of splices: GC/AG | 149271 Number of splices: AT/AC | 5362 Number of splices: Non-canonical | 37637 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263538 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 46302 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 371335 371335 371335 N_multimapping 263538 263538 263538 N_noFeature 389537 9474802 454324 N_ambiguous 136358 529 61913 UnstrandedReadsAssigned:9087802 PositiveStrandReadsAssigned:138366 NegativeStrandReadsAssigned:9097460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR12670136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670136-trimmed-pair1.fastq SRR12670136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,248,570 reads, 9,134,344 reads pseudoaligned [quant] estimated average fragment length: 202.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR12670136.ke.tsv 34699 SRR12670136.se.tsv 87100 total ==> SRR12670136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.33 267 16.2747 Potri.005G024800.1.v4.1 1035 833.328 164 21.7883 Potri.004G059700.1.v4.1 961 759.339 1 0.145801 Potri.007G009000.2.v4.1 1416 1214.33 0 0 Potri.003G141000.2.v4.1 2943 2741.33 467 18.8604 Potri.016G087400.1.v4.1 270 105.325 506 531.883 Potri.015G069301.1.v4.1 564 367.277 0 0 Potri.010G195200.1.v4.1 1773 1571.33 35.8469 2.5257 Potri.012G127500.1.v4.1 977 775.328 75 10.7096 ==> SRR12670136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 268 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670136 completed mapping pipeline successfully