Starting /dee2/code/volunteer_pipeline.sh SRR12670140 current disk space = 3057049870336 free memory = 1152981076 SRR12670140 SRAfilesize 77442f6f4ed89cf1ff80f2c1066ccaff SRR12670140.sra SRR12670140.sra file validated SRR12670140 is paired end SRR12670140 is conventional basespace SRR12670140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.583 37.0 37.0 37.0 37.0 37.0 2 36.55875 37.0 37.0 37.0 37.0 37.0 3 36.637 37.0 37.0 37.0 37.0 37.0 4 36.623 37.0 37.0 37.0 37.0 37.0 5 36.6785 37.0 37.0 37.0 37.0 37.0 6 36.7025 37.0 37.0 37.0 37.0 37.0 7 36.6045 37.0 37.0 37.0 37.0 37.0 8 36.6695 37.0 37.0 37.0 37.0 37.0 9 36.556 37.0 37.0 37.0 37.0 37.0 10-14 36.6031 37.0 37.0 37.0 37.0 37.0 15-19 36.6167 37.0 37.0 37.0 37.0 37.0 20-24 36.5697 37.0 37.0 37.0 37.0 37.0 25-29 36.5033 37.0 37.0 37.0 37.0 37.0 30-34 36.4969 37.0 37.0 37.0 37.0 37.0 35-39 36.4766 37.0 37.0 37.0 37.0 37.0 40-44 36.451299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.447199999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3885 37.0 37.0 37.0 37.0 37.0 55-59 36.3916 37.0 37.0 37.0 37.0 37.0 60-64 36.355599999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3629 37.0 37.0 37.0 37.0 37.0 70-74 36.3428 37.0 37.0 37.0 37.0 37.0 75-79 36.2825 37.0 37.0 37.0 37.0 37.0 80-84 36.2695 37.0 37.0 37.0 37.0 37.0 85-89 36.2261 37.0 37.0 37.0 37.0 37.0 90-94 36.2427 37.0 37.0 37.0 37.0 37.0 95-99 36.222300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2519 37.0 37.0 37.0 37.0 37.0 105-109 36.2215 37.0 37.0 37.0 37.0 37.0 110-114 36.1375 37.0 37.0 37.0 37.0 37.0 115-119 36.164 37.0 37.0 37.0 37.0 37.0 120-124 36.0103 37.0 37.0 37.0 37.0 37.0 125-129 36.0094 37.0 37.0 37.0 37.0 37.0 130-134 35.9375 37.0 37.0 37.0 37.0 37.0 135-139 35.789 37.0 37.0 37.0 37.0 37.0 140-144 35.5793 37.0 37.0 37.0 37.0 37.0 145-149 35.532 37.0 37.0 37.0 37.0 37.0 150-151 35.388000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 4.0 25 2.0 26 6.0 27 7.0 28 9.0 29 14.0 30 24.0 31 29.0 32 40.0 33 74.0 34 143.0 35 318.0 36 2971.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.85 10.075000000000001 6.800000000000001 44.275 2 20.550688360450565 12.841051314142678 36.871088861076345 29.737171464330416 3 18.45 16.650000000000002 27.6 37.3 4 22.325 23.225 23.974999999999998 30.475 5 22.075 30.349999999999998 25.6 21.975 6 21.425 33.15 24.85 20.575 7 17.1 23.7 41.325 17.875 8 17.9 25.4 33.0 23.7 9 17.675 23.525 36.725 22.075 10-14 19.99 27.839999999999996 28.139999999999997 24.03 15-19 20.005 27.38 28.139999999999997 24.474999999999998 20-24 21.154999999999998 27.200000000000003 27.925 23.72 25-29 20.575 27.1 27.97 24.355 30-34 20.68 27.465 28.060000000000002 23.794999999999998 35-39 20.849999999999998 27.67 27.589999999999996 23.89 40-44 20.535 27.18 28.09 24.195 45-49 20.9 27.22 28.499999999999996 23.380000000000003 50-54 21.425 27.52 27.644999999999996 23.41 55-59 20.97 27.24 28.29 23.5 60-64 20.785 28.215 27.365000000000002 23.635 65-69 21.029999999999998 27.925 27.575 23.47 70-74 20.474999999999998 27.36 28.084999999999997 24.08 75-79 21.58 27.534999999999997 27.905 22.98 80-84 21.255 27.985 27.29 23.47 85-89 21.33 28.144999999999996 27.145000000000003 23.380000000000003 90-94 21.285 27.689999999999998 27.495000000000005 23.53 95-99 21.105 27.445000000000004 27.939999999999998 23.51 100-104 21.915000000000003 28.115000000000002 26.595000000000002 23.375 105-109 21.18 28.389999999999997 26.805 23.625 110-114 21.135 27.93 26.185000000000002 24.75 115-119 21.89 27.439999999999998 26.085 24.585 120-124 21.715 27.994999999999997 26.11 24.18 125-129 22.045 28.000000000000004 25.929999999999996 24.025 130-134 21.94 28.565 24.77 24.725 135-139 22.285 28.185 24.905 24.625 140-144 21.855 28.37 25.869999999999997 23.905 145-149 22.055 27.045 25.11 25.790000000000003 150-151 23.1375 25.775 26.075 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 3.0 28 5.5 29 6.5 30 9.0 31 13.5 32 17.0 33 25.5 34 35.0 35 47.0 36 65.0 37 96.5 38 115.5 39 151.0 40 211.0 41 222.5 42 237.5 43 261.0 44 253.5 45 266.0 46 273.5 47 263.5 48 244.0 49 226.0 50 198.0 51 145.5 52 117.5 53 95.0 54 81.0 55 68.0 56 55.0 57 49.5 58 39.0 59 29.0 60 23.5 61 17.5 62 7.5 63 4.5 64 4.5 65 4.0 66 4.0 67 2.0 68 0.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.875 #Duplication Level Percentage of deduplicated Percentage of total 1 82.74809160305342 67.75 2 13.282442748091603 21.75 3 3.267175572519084 8.025 4 0.549618320610687 1.7999999999999998 5 0.12213740458015268 0.5 6 0.0 0.0 7 0.03053435114503817 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTTGTTCAGGTTCCACAATCATCAAATGCACATCCAGAGGAAGATCT 7 0.17500000000000002 No Hit TATGTATTACTAGTAAATTGAGCTGGTTTGAATGGTAGTGTCAGGCTAGA 5 0.125 No Hit AGAGAAACTTGTCTCTCCATTCAGGTAATGTTTCTTCAATCTGGTTGCTT 5 0.125 No Hit CCTTGTACTCACGACCGCTTGTTGTTTTCTCTACAAGCAAAGCCATTGTA 5 0.125 No Hit GTCACCTTTCACCCCATAAGCCCATGTCTGAGACTACTCTCTTTCTTTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.625 0.0 0.0 0.025 0.0 72-73 0.825 0.0 0.0 0.025 0.0 74-75 0.925 0.0 0.0 0.025 0.0 76-77 1.0625 0.0 0.0 0.025 0.0 78-79 1.325 0.0 0.0 0.025 0.0 80-81 1.5375 0.0 0.0 0.025 0.0 82-83 1.7374999999999998 0.0 0.0 0.025 0.0 84-85 1.9875 0.0 0.0 0.025 0.0 86-87 2.4125 0.0 0.0 0.025 0.0 88-89 2.8375 0.0 0.0 0.025 0.0 90-91 3.4000000000000004 0.0 0.0 0.025 0.0 92-93 4.1625 0.0 0.0 0.025 0.0 94-95 4.699999999999999 0.0 0.0 0.025 0.0 96-97 5.637499999999999 0.0 0.0 0.025 0.0 98-99 6.45 0.0 0.0 0.025 0.0 100-101 7.300000000000001 0.0 0.0 0.025 0.0 102-103 8.2625 0.0 0.0 0.025 0.0 104-105 9.2125 0.0 0.0 0.025 0.0 106-107 9.962499999999999 0.0 0.0 0.025 0.0 108-109 10.649999999999999 0.0 0.0 0.025 0.0 110-111 11.45 0.0 0.0 0.025 0.0 112-113 12.2875 0.0 0.0 0.025 0.0 114-115 13.25 0.0 0.0 0.025 0.0 116-117 14.2 0.0 0.0 0.025 0.0 118-119 15.212499999999999 0.0 0.0 0.025 0.0 120-121 16.55 0.0 0.0 0.025 0.0 122-123 17.737499999999997 0.0 0.0 0.025 0.0 124-125 18.625 0.0 0.0 0.025 0.0 126-127 19.75 0.0 0.0 0.025 0.0 128-129 20.762500000000003 0.0 0.0 0.025 0.0 130-131 22.262500000000003 0.0 0.0 0.025 0.0 132-133 23.375 0.0 0.0 0.025 0.0 134-135 24.512500000000003 0.0 0.0 0.025 0.0 136-137 25.3625 0.0 0.0 0.025 0.0 138-139 26.2125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 140-144 GCCGTCT 40 0.0076550315 18.125 140-144 >>END_MODULE SRR12670140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.469 37.0 37.0 37.0 37.0 37.0 2 36.3505 37.0 37.0 37.0 37.0 37.0 3 36.3575 37.0 37.0 37.0 37.0 37.0 4 36.399 37.0 37.0 37.0 37.0 37.0 5 36.3925 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.434 37.0 37.0 37.0 37.0 37.0 8 36.512 37.0 37.0 37.0 37.0 37.0 9 36.434 37.0 37.0 37.0 37.0 37.0 10-14 36.445100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4062 37.0 37.0 37.0 37.0 37.0 20-24 36.419900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.360400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3077 37.0 37.0 37.0 37.0 37.0 35-39 36.29260000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2649 37.0 37.0 37.0 37.0 37.0 45-49 36.2953 37.0 37.0 37.0 37.0 37.0 50-54 36.2713 37.0 37.0 37.0 37.0 37.0 55-59 36.1729 37.0 37.0 37.0 37.0 37.0 60-64 36.2226 37.0 37.0 37.0 37.0 37.0 65-69 36.1693 37.0 37.0 37.0 37.0 37.0 70-74 36.1586 37.0 37.0 37.0 37.0 37.0 75-79 36.193 37.0 37.0 37.0 37.0 37.0 80-84 36.07469999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.1626 37.0 37.0 37.0 37.0 37.0 90-94 36.1196 37.0 37.0 37.0 37.0 37.0 95-99 36.02589999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.99159999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.9711 37.0 37.0 37.0 37.0 37.0 110-114 35.8739 37.0 37.0 37.0 37.0 37.0 115-119 35.8232 37.0 37.0 37.0 37.0 37.0 120-124 35.715799999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.629099999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.4704 37.0 37.0 37.0 34.6 37.0 135-139 35.346799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.177 37.0 37.0 37.0 32.2 37.0 145-149 34.882000000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.64325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 1.0 21 4.0 22 3.0 23 2.0 24 8.0 25 4.0 26 1.0 27 4.0 28 10.0 29 9.0 30 30.0 31 34.0 32 46.0 33 94.0 34 177.0 35 561.0 36 2662.0 37 339.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.35 23.25 10.775 29.625 2 26.900000000000002 26.75 31.1 15.25 3 19.8 28.549999999999997 30.325000000000003 21.325 4 22.725 35.35 22.75 19.175 5 25.374999999999996 36.25 20.525 17.849999999999998 6 19.6 39.825 22.25 18.325 7 19.875 22.775000000000002 37.475 19.875 8 20.75 26.875 28.000000000000004 24.375 9 20.9 25.474999999999998 30.049999999999997 23.575 10-14 22.615 28.599999999999998 26.615 22.17 15-19 22.57 29.049999999999997 26.46 21.92 20-24 22.67 28.985 27.46 20.885 25-29 23.055 28.854999999999997 27.11 20.979999999999997 30-34 22.884999999999998 28.62 27.534999999999997 20.96 35-39 22.97 28.389999999999997 26.775 21.865000000000002 40-44 23.25 28.585 26.810000000000002 21.355 45-49 22.845 28.65 27.544999999999998 20.96 50-54 23.59 27.544999999999998 27.534999999999997 21.33 55-59 23.28 27.71 27.665 21.345 60-64 23.025000000000002 28.255000000000003 27.065 21.654999999999998 65-69 23.325000000000003 28.34 27.705000000000002 20.630000000000003 70-74 24.07 28.1 26.97 20.86 75-79 23.794999999999998 28.360000000000003 26.72 21.125 80-84 23.549999999999997 28.88 26.605 20.965 85-89 23.71 29.32 26.165 20.805 90-94 24.065 29.294999999999998 25.66 20.979999999999997 95-99 25.195 28.51 26.005 20.29 100-104 25.525 28.175 26.155 20.145 105-109 25.685000000000002 28.02 25.729999999999997 20.565 110-114 26.655 28.285 25.180000000000003 19.88 115-119 26.305 28.389999999999997 25.805 19.5 120-124 27.465 28.4 25.035 19.1 125-129 28.1 28.365000000000002 24.27 19.265 130-134 28.860000000000003 27.36 24.725 19.055 135-139 30.214999999999996 27.279999999999998 24.035 18.47 140-144 31.64 26.900000000000002 23.875 17.585 145-149 33.68 26.185000000000002 23.325000000000003 16.81 150-151 33.2375 25.95 22.6875 18.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.0 26 1.5 27 4.0 28 7.0 29 5.0 30 4.5 31 12.5 32 17.0 33 29.5 34 46.5 35 62.0 36 82.5 37 106.0 38 133.5 39 162.0 40 209.5 41 240.5 42 259.0 43 277.0 44 266.5 45 248.5 46 259.0 47 261.5 48 227.5 49 203.0 50 182.0 51 146.5 52 106.0 53 86.5 54 73.0 55 49.0 56 46.0 57 45.0 58 37.0 59 27.0 60 13.5 61 9.5 62 7.5 63 7.0 64 5.5 65 4.0 66 2.0 67 0.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 82.62465585806056 67.525 2 13.429183236463752 21.95 3 3.150810645457326 7.725 4 0.611807892321811 2.0 5 0.15295197308045275 0.625 6 0.0 0.0 7 0.03059039461609055 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTTAGATTTCTTCCTTTGAAGACTCGGAGTTGAGAAATGTCAACAGCA 7 0.17500000000000002 No Hit GTGATATTATTTTGCTTCCCAGGCAATTGTGGTGTTCACTAAAGGGAAAC 5 0.125 No Hit CAGCAACCAAACACCCCCTCTCGAAATGAAATTCGGCAAAAGCTTAAGCA 5 0.125 No Hit CTCTTCTCAGCCGCATCTTTTTCCCTTTTCTAAGAGAGTGAAAGCAAGAA 5 0.125 No Hit CAACAACTTCCATAAACAATCTCAAAACACAGAGAAGTTTCTTTGGTTTT 5 0.125 No Hit AATGGAAGTGGAATATCTATGTAGTTTTAATGCTTATTTGGGTCTCCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.625 0.0 0.0 0.0 0.0 72-73 0.825 0.0 0.0 0.0 0.0 74-75 0.95 0.0 0.0 0.0 0.0 76-77 1.1 0.0 0.0 0.0 0.0 78-79 1.375 0.0 0.0 0.0 0.0 80-81 1.6 0.0 0.0 0.0 0.0 82-83 1.8125 0.0 0.0 0.0 0.0 84-85 2.0625 0.0 0.0 0.0 0.0 86-87 2.4875 0.0 0.0 0.0 0.0 88-89 2.95 0.0 0.0 0.0 0.0 90-91 3.5250000000000004 0.0 0.0 0.0 0.0 92-93 4.262499999999999 0.0 0.0 0.0 0.0 94-95 4.7875 0.0 0.0 0.0 0.0 96-97 5.737500000000001 0.0 0.0 0.0 0.0 98-99 6.525 0.0 0.0 0.0 0.0 100-101 7.375 0.0 0.0 0.0 0.0 102-103 8.35 0.0 0.0 0.0 0.0 104-105 9.3625 0.0 0.0 0.0 0.0 106-107 10.1375 0.0 0.0 0.0 0.0 108-109 10.825 0.0 0.0 0.0 0.0 110-111 11.675 0.0 0.0 0.0 0.0 112-113 12.5375 0.0 0.0 0.0 0.0 114-115 13.5 0.0 0.0 0.0 0.0 116-117 14.425 0.0 0.0 0.0 0.0 118-119 15.462499999999999 0.0 0.0 0.0 0.0 120-121 16.8125 0.0 0.0 0.0 0.0 122-123 18.012500000000003 0.0 0.0 0.0 0.0 124-125 18.9 0.0 0.0 0.0 0.0 126-127 20.025 0.0 0.0 0.0 0.0 128-129 21.0 0.0 0.0 0.0 0.0 130-131 22.487499999999997 0.0 0.0 0.0 0.0 132-133 23.5625 0.0 0.0 0.0 0.0 134-135 24.6625 0.0 0.0 0.0 0.0 136-137 25.525 0.0 0.0 0.0 0.0 138-139 26.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTCACA 10 0.006830828 145.0 6 GGGGGGG 635 0.0 10.27559 140-144 >>END_MODULE Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486521 spots for SRR12670140.sra Written 486521 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra Read 486513 spots for SRR12670140.sra Written 486513 spots for SRR12670140.sra SRR ids: ['SRR12670140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_fu_7vt SRR12670140.sra spots: 9730268 blocks: [[1, 486513], [486514, 973026], [973027, 1459539], [1459540, 1946052], [1946053, 2432565], [2432566, 2919078], [2919079, 3405591], [3405592, 3892104], [3892105, 4378617], [4378618, 4865130], [4865131, 5351643], [5351644, 5838156], [5838157, 6324669], [6324670, 6811182], [6811183, 7297695], [7297696, 7784208], [7784209, 8270721], [8270722, 8757234], [8757235, 9243747], [9243748, 9730268]] SRR12670140 file size 3285597 SRR12670140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670140 SRR12670140_1.fastq SRR12670140_2.fastq Input file: SRR12670140_1.fastq Paired file: SRR12670140_2.fastq trimmed: SRR12670140-trimmed-pair1.fastq, SRR12670140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:22:02 2025 >> started Tue Feb 11 01:22:13 2025 >> done (10.476s) 9730268 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 6284 ( 0.06%) empty read pairs filtered out after trimming by size control 9723949 (99.94%) read pairs available; of these: 2884236 (29.66%) trimmed read pairs available after processing 6839713 (70.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 2 0.00% 22 6 0.00% 23 9 0.00% 24 12 0.00% 25 8 0.00% 26 21 0.00% 27 15 0.00% 28 29 0.00% 29 32 0.00% 30 44 0.00% 31 33 0.00% 32 39 0.00% 33 55 0.00% 34 55 0.00% 35 61 0.00% 36 91 0.00% 37 82 0.00% 38 92 0.00% 39 86 0.00% 40 112 0.00% 41 137 0.00% 42 143 0.00% 43 128 0.00% 44 130 0.00% 45 169 0.00% 46 189 0.00% 47 263 0.00% 48 298 0.00% 49 374 0.00% 50 402 0.00% 51 556 0.01% 52 557 0.01% 53 567 0.01% 54 588 0.01% 55 664 0.01% 56 717 0.01% 57 892 0.01% 58 1030 0.01% 59 1143 0.01% 60 1525 0.02% 61 1709 0.02% 62 1961 0.02% 63 2071 0.02% 64 2380 0.02% 65 2475 0.03% 66 2681 0.03% 67 3104 0.03% 68 3582 0.04% 69 4107 0.04% 70 4696 0.05% 71 5204 0.05% 72 6141 0.06% 73 6760 0.07% 74 7408 0.08% 75 8026 0.08% 76 8766 0.09% 77 9363 0.10% 78 10027 0.10% 79 10869 0.11% 80 11880 0.12% 81 13423 0.14% 82 15165 0.16% 83 16115 0.17% 84 17946 0.18% 85 19414 0.20% 86 20007 0.21% 87 21158 0.22% 88 22211 0.23% 89 22297 0.23% 90 24227 0.25% 91 25856 0.27% 92 27294 0.28% 93 29315 0.30% 94 30892 0.32% 95 31950 0.33% 96 33308 0.34% 97 34479 0.35% 98 34406 0.35% 99 34799 0.36% 100 36090 0.37% 101 36114 0.37% 102 37836 0.39% 103 38845 0.40% 104 40184 0.41% 105 41384 0.43% 106 42569 0.44% 107 42470 0.44% 108 42181 0.43% 109 42543 0.44% 110 42172 0.43% 111 42475 0.44% 112 43750 0.45% 113 43982 0.45% 114 44786 0.46% 115 46169 0.47% 116 46666 0.48% 117 46645 0.48% 118 46618 0.48% 119 45960 0.47% 120 46335 0.48% 121 46446 0.48% 122 46512 0.48% 123 46611 0.48% 124 47047 0.48% 125 46575 0.48% 126 47754 0.49% 127 48115 0.49% 128 47238 0.49% 129 47169 0.49% 130 47163 0.49% 131 46300 0.48% 132 46111 0.47% 133 46388 0.48% 134 45956 0.47% 135 46421 0.48% 136 46511 0.48% 137 46640 0.48% 138 46319 0.48% 139 46692 0.48% 140 45791 0.47% 141 45848 0.47% 142 45731 0.47% 143 45135 0.46% 144 45836 0.47% 145 45932 0.47% 146 45904 0.47% 147 45634 0.47% 148 46060 0.47% 149 44574 0.46% 150 45209 0.46% 151 6839713 70.34% 9723949 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=32.07 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.91 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=40.50 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=13.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12670140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:22:54 Started mapping on | Feb 11 01:22:54 Finished on | Feb 11 01:24:02 Mapping speed, Million of reads per hour | 514.80 Number of input reads | 9723949 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 9131001 Uniquely mapped reads % | 93.90% Average mapped length | 281.05 Number of splices: Total | 8611512 Number of splices: Annotated (sjdb) | 8419712 Number of splices: GT/AG | 8438140 Number of splices: GC/AG | 139133 Number of splices: AT/AC | 5475 Number of splices: Non-canonical | 28764 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223574 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 65007 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369374 369374 369374 N_multimapping 223574 223574 223574 N_noFeature 295747 8990968 356314 N_ambiguous 135860 483 56132 UnstrandedReadsAssigned:8699394 PositiveStrandReadsAssigned:139550 NegativeStrandReadsAssigned:8718555 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=130 echo kmer=125 SRR12670140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670140-trimmed-pair1.fastq SRR12670140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,723,949 reads, 8,753,971 reads pseudoaligned [quant] estimated average fragment length: 205.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 946 rounds 52401 SRR12670140.ke.tsv 34699 SRR12670140.se.tsv 87100 total ==> SRR12670140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.84 306 18.57 Potri.005G024800.1.v4.1 1035 830.839 167 22.1253 Potri.004G059700.1.v4.1 961 756.911 0 0 Potri.007G009000.2.v4.1 1416 1211.84 0 0 Potri.003G141000.2.v4.1 2943 2738.84 305 12.2581 Potri.016G087400.1.v4.1 270 112.436 477 466.985 Potri.015G069301.1.v4.1 564 367.84 0 0 Potri.010G195200.1.v4.1 1773 1568.84 70 4.91144 Potri.012G127500.1.v4.1 977 772.87 118 16.806 ==> SRR12670140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 242 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670140 completed mapping pipeline successfully