Starting /dee2/code/volunteer_pipeline.sh SRR12670142 current disk space = 3057116680192 free memory = 1305335344 SRR12670142 SRAfilesize d86ccba65a48f93695cbd644025c28fe SRR12670142.sra SRR12670142.sra file validated SRR12670142 is paired end SRR12670142 is conventional basespace SRR12670142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5755 37.0 37.0 37.0 37.0 37.0 2 36.44975 37.0 37.0 37.0 37.0 37.0 3 36.668 37.0 37.0 37.0 37.0 37.0 4 36.688 37.0 37.0 37.0 37.0 37.0 5 36.6955 37.0 37.0 37.0 37.0 37.0 6 36.631 37.0 37.0 37.0 37.0 37.0 7 36.503 37.0 37.0 37.0 37.0 37.0 8 36.618 37.0 37.0 37.0 37.0 37.0 9 36.498 37.0 37.0 37.0 37.0 37.0 10-14 36.62670000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6008 37.0 37.0 37.0 37.0 37.0 20-24 36.5343 37.0 37.0 37.0 37.0 37.0 25-29 36.544 37.0 37.0 37.0 37.0 37.0 30-34 36.5049 37.0 37.0 37.0 37.0 37.0 35-39 36.4886 37.0 37.0 37.0 37.0 37.0 40-44 36.4503 37.0 37.0 37.0 37.0 37.0 45-49 36.3941 37.0 37.0 37.0 37.0 37.0 50-54 36.4205 37.0 37.0 37.0 37.0 37.0 55-59 36.4052 37.0 37.0 37.0 37.0 37.0 60-64 36.341699999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3176 37.0 37.0 37.0 37.0 37.0 70-74 36.32430000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3624 37.0 37.0 37.0 37.0 37.0 80-84 36.339999999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.317699999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.261300000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.24589999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.21229999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.164699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.066100000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.0832 37.0 37.0 37.0 37.0 37.0 120-124 35.9668 37.0 37.0 37.0 37.0 37.0 125-129 35.8506 37.0 37.0 37.0 37.0 37.0 130-134 35.7692 37.0 37.0 37.0 37.0 37.0 135-139 35.585300000000004 37.0 37.0 37.0 34.6 37.0 140-144 35.3521 37.0 37.0 37.0 37.0 37.0 145-149 35.056200000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.83675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 2.0 26 4.0 27 4.0 28 12.0 29 17.0 30 30.0 31 30.0 32 47.0 33 116.0 34 170.0 35 337.0 36 2813.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 12.3 4.324999999999999 43.0 2 18.657650889055848 13.373403456048083 37.49060856498873 30.47833708990734 3 17.325 16.25 28.625 37.8 4 22.975 23.849999999999998 23.724999999999998 29.45 5 23.825 31.075000000000003 24.125 20.974999999999998 6 20.424999999999997 35.125 24.575 19.875 7 15.024999999999999 27.35 40.35 17.275 8 17.2 25.1 32.300000000000004 25.4 9 17.175 24.15 36.4 22.275 10-14 19.64 30.165 27.400000000000002 22.795 15-19 19.61 28.155 27.805000000000003 24.43 20-24 19.555 29.085 27.41 23.95 25-29 19.515 28.945 27.58 23.96 30-34 19.68 28.499999999999996 28.105000000000004 23.715 35-39 19.794999999999998 27.955000000000002 28.384999999999998 23.865 40-44 20.294999999999998 28.110000000000003 27.860000000000003 23.735 45-49 20.48 28.025 27.815 23.68 50-54 20.549999999999997 28.315 27.46 23.674999999999997 55-59 20.39 28.939999999999998 27.305 23.365 60-64 20.395 28.63 27.435 23.54 65-69 20.724999999999998 28.49 27.85 22.935 70-74 20.655 28.544999999999998 27.79 23.01 75-79 20.72 28.410000000000004 27.26 23.61 80-84 20.005 28.28 27.98 23.735 85-89 20.445 28.505000000000003 27.245 23.805 90-94 20.835 28.744999999999997 27.169999999999998 23.25 95-99 21.485000000000003 28.244999999999997 26.85 23.419999999999998 100-104 20.995 29.625 26.325 23.055 105-109 20.305 29.805 26.545 23.345 110-114 21.07 29.255 25.805 23.87 115-119 21.115000000000002 28.89 26.484999999999996 23.51 120-124 21.22 28.660000000000004 25.825 24.295 125-129 21.165 28.804999999999996 25.650000000000002 24.38 130-134 21.705 28.645 25.509999999999998 24.14 135-139 21.545 28.455000000000002 25.985000000000003 24.015 140-144 22.189999999999998 27.025 26.245 24.54 145-149 22.29 27.3 25.674999999999997 24.735 150-151 21.337500000000002 27.35 25.687500000000004 25.624999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 2.5 27 2.5 28 8.0 29 11.5 30 14.5 31 21.5 32 29.5 33 43.5 34 48.0 35 63.0 36 89.0 37 104.0 38 138.5 39 178.5 40 194.0 41 205.5 42 236.5 43 245.0 44 253.0 45 292.0 46 288.0 47 253.0 48 237.5 49 204.0 50 167.0 51 146.0 52 119.5 53 93.0 54 67.5 55 56.0 56 48.5 57 33.5 58 25.0 59 20.0 60 13.5 61 9.5 62 7.5 63 5.5 64 2.5 65 3.0 66 3.0 67 3.0 68 3.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.62913315460231 71.025 2 12.272862675007447 20.599999999999998 3 2.5320226392612453 6.375 4 0.47661602621388144 1.6 5 0.05957700327673518 0.25 6 0.02978850163836759 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAAGATTGGTAATTCTTTCTTTCCTTACCATCAGCCATTAGTGTAAGAA 6 0.15 No Hit GCGGTTGTTTTCTAATTTTCCAGTAGCCCACGAAAATGCCTGAGCTCCAA 5 0.125 No Hit GCACGATAAGGCCCAGTCTTGTCAAATCCAGAGGAAGATTTCCCATAGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4125 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.575 0.0 0.0 0.0 0.0 70-71 0.625 0.0 0.0 0.0 0.0 72-73 0.675 0.0 0.0 0.0 0.0 74-75 0.825 0.0 0.0 0.0 0.0 76-77 0.9125 0.0 0.0 0.0 0.0 78-79 1.125 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.675 0.0 0.0 0.0 0.0 84-85 2.0 0.0 0.0 0.0 0.0 86-87 2.4375 0.0 0.0 0.0 0.0 88-89 2.975 0.0 0.0 0.0 0.0 90-91 3.5875 0.0 0.0 0.0 0.0 92-93 4.2625 0.0 0.0 0.0 0.0 94-95 5.15 0.0 0.0 0.0 0.0 96-97 5.7875 0.0 0.0 0.0 0.0 98-99 6.5625 0.0 0.0 0.0 0.0 100-101 7.375 0.0 0.0 0.0 0.0 102-103 8.4125 0.0 0.0 0.0 0.0 104-105 9.2 0.0 0.0 0.0 0.0 106-107 10.2125 0.0 0.0 0.0 0.0 108-109 11.15 0.0 0.0 0.0 0.0 110-111 12.5125 0.0 0.0 0.0 0.0 112-113 13.325 0.0 0.0 0.0 0.0 114-115 14.412500000000001 0.0 0.0 0.0 0.0 116-117 15.462499999999999 0.0 0.0 0.0 0.0 118-119 16.737499999999997 0.0 0.0 0.0 0.0 120-121 17.55 0.0 0.0 0.0 0.0 122-123 18.675 0.0 0.0 0.0 0.0 124-125 20.2 0.0 0.0 0.0 0.0 126-127 21.2375 0.0 0.0 0.0 0.0 128-129 22.3125 0.0 0.0 0.0 0.0 130-131 23.3875 0.0 0.0 0.0 0.0 132-133 24.450000000000003 0.0 0.0 0.0 0.0 134-135 25.525 0.0 0.0 0.0 0.0 136-137 26.85 0.0 0.0 0.0 0.0 138-139 27.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGATT 10 0.006830828 145.0 8 AAAAAAA 30 0.0014437955 24.166668 115-119 >>END_MODULE SRR12670142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.326 37.0 37.0 37.0 37.0 37.0 2 36.2045 37.0 37.0 37.0 37.0 37.0 3 36.1875 37.0 37.0 37.0 37.0 37.0 4 36.2375 37.0 37.0 37.0 37.0 37.0 5 36.386 37.0 37.0 37.0 37.0 37.0 6 36.31 37.0 37.0 37.0 37.0 37.0 7 36.1065 37.0 37.0 37.0 37.0 37.0 8 36.392 37.0 37.0 37.0 37.0 37.0 9 36.355 37.0 37.0 37.0 37.0 37.0 10-14 36.377599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3585 37.0 37.0 37.0 37.0 37.0 20-24 36.3195 37.0 37.0 37.0 37.0 37.0 25-29 36.2986 37.0 37.0 37.0 37.0 37.0 30-34 36.263400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1913 37.0 37.0 37.0 37.0 37.0 40-44 36.234899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2471 37.0 37.0 37.0 37.0 37.0 50-54 36.13530000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1186 37.0 37.0 37.0 37.0 37.0 60-64 36.1198 37.0 37.0 37.0 37.0 37.0 65-69 36.0952 37.0 37.0 37.0 37.0 37.0 70-74 36.1004 37.0 37.0 37.0 37.0 37.0 75-79 36.0814 37.0 37.0 37.0 37.0 37.0 80-84 35.9565 37.0 37.0 37.0 37.0 37.0 85-89 35.954699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9694 37.0 37.0 37.0 37.0 37.0 95-99 35.8738 37.0 37.0 37.0 37.0 37.0 100-104 35.794399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.745400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6157 37.0 37.0 37.0 37.0 37.0 115-119 35.659 37.0 37.0 37.0 37.0 37.0 120-124 35.522000000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.288599999999995 37.0 37.0 37.0 32.2 37.0 130-134 35.0732 37.0 37.0 37.0 29.8 37.0 135-139 34.93050000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.643800000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.3498 37.0 37.0 37.0 25.0 37.0 150-151 33.89875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 3.0 20 2.0 21 1.0 22 5.0 23 3.0 24 6.0 25 2.0 26 3.0 27 11.0 28 15.0 29 20.0 30 27.0 31 38.0 32 81.0 33 153.0 34 272.0 35 617.0 36 2508.0 37 230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.050000000000004 23.125 9.225 27.6 2 25.224999999999998 25.424999999999997 33.375 15.975 3 20.599999999999998 27.750000000000004 32.225 19.425 4 24.45 33.525 24.175 17.849999999999998 5 25.974999999999998 37.65 20.424999999999997 15.950000000000001 6 19.325 39.375 23.025000000000002 18.275 7 19.85 21.6 39.675 18.875 8 20.674999999999997 25.35 29.175 24.8 9 21.95 23.225 30.049999999999997 24.775 10-14 22.634999999999998 29.409999999999997 27.67 20.285 15-19 23.43 28.494999999999997 27.575 20.5 20-24 23.34 28.494999999999997 27.265 20.9 25-29 22.795 28.33 28.360000000000003 20.515 30-34 22.63 28.54 28.084999999999997 20.745 35-39 22.805 28.335 28.63 20.23 40-44 22.98 27.655 28.92 20.445 45-49 22.465 28.065 28.335 21.135 50-54 22.855 28.265 27.500000000000004 21.38 55-59 23.375 27.694999999999997 28.144999999999996 20.785 60-64 22.56 28.849999999999998 28.54 20.05 65-69 24.11 27.925 27.060000000000002 20.905 70-74 23.305 27.794999999999998 27.935 20.965 75-79 23.66 27.900000000000002 27.865000000000002 20.575 80-84 23.72 28.34 27.245 20.695 85-89 24.005000000000003 27.825 28.03 20.14 90-94 24.23 27.865000000000002 27.515 20.39 95-99 24.4 28.194999999999997 27.145000000000003 20.26 100-104 25.86 27.91 26.419999999999998 19.81 105-109 25.650000000000002 28.744999999999997 26.450000000000003 19.155 110-114 26.55 27.965 26.345000000000002 19.139999999999997 115-119 26.650000000000002 28.68 25.790000000000003 18.88 120-124 27.07 27.88 26.290000000000003 18.759999999999998 125-129 28.12 28.28 25.900000000000002 17.7 130-134 28.88 27.325 25.96 17.835 135-139 29.365000000000002 27.694999999999997 25.619999999999997 17.32 140-144 30.81 26.36 25.865 16.965 145-149 32.265 26.11 25.36 16.265 150-151 32.75 25.35 25.837500000000002 16.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.5 23 2.5 24 2.0 25 2.5 26 3.0 27 6.5 28 11.5 29 13.5 30 18.0 31 18.0 32 25.0 33 41.0 34 53.0 35 74.5 36 89.5 37 105.5 38 158.0 39 188.0 40 203.0 41 236.5 42 255.5 43 269.5 44 264.0 45 263.5 46 265.0 47 237.5 48 214.5 49 183.0 50 146.5 51 132.5 52 111.0 53 84.0 54 70.0 55 59.5 56 43.0 57 36.5 58 28.5 59 18.5 60 14.0 61 6.5 62 6.5 63 6.5 64 4.0 65 1.0 66 0.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.95 #Duplication Level Percentage of deduplicated Percentage of total 1 84.8719475878499 71.25 2 11.822513400833829 19.85 3 2.73972602739726 6.9 4 0.4764740917212627 1.6 5 0.05955926146515784 0.25 6 0.02977963073257892 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAAAATCCAAAATCCCATTCTCTTCTTCTCCTGGAAGATGTCTACTATT 6 0.15 No Hit CTCAACTCTGCCAACAATGACTCTATGTCTGTTTTGCCTGTTTATTGTTT 5 0.125 No Hit CCTTACAATTTATTGCAATTGTTGGCCTCGGTCAGACTATTTATCGGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4125 0.0 0.0 0.0 0.0 66-67 0.5 0.0 0.0 0.0 0.0 68-69 0.5875 0.0 0.0 0.0 0.0 70-71 0.65 0.0 0.0 0.0 0.0 72-73 0.7 0.0 0.0 0.0 0.0 74-75 0.85 0.0 0.0 0.0 0.0 76-77 0.9375 0.0 0.0 0.0 0.0 78-79 1.15 0.0 0.0 0.0 0.0 80-81 1.4 0.0 0.0 0.0 0.0 82-83 1.7125 0.0 0.0 0.0 0.0 84-85 2.025 0.0 0.0 0.0 0.0 86-87 2.4625 0.0 0.0 0.0 0.0 88-89 3.025 0.0 0.0 0.0 0.0 90-91 3.7 0.0 0.0 0.0 0.0 92-93 4.3875 0.0 0.0 0.0 0.0 94-95 5.275 0.0 0.0 0.0 0.0 96-97 5.9 0.0 0.0 0.0 0.0 98-99 6.7125 0.0 0.0 0.0 0.0 100-101 7.525 0.0 0.0 0.0 0.0 102-103 8.5625 0.0 0.0 0.0 0.0 104-105 9.375 0.0 0.0 0.0 0.0 106-107 10.4125 0.0 0.0 0.0 0.0 108-109 11.35 0.0 0.0 0.0 0.0 110-111 12.6875 0.0 0.0 0.0 0.0 112-113 13.5 0.0 0.0 0.0 0.0 114-115 14.587499999999999 0.0 0.0 0.0 0.0 116-117 15.6375 0.0 0.0 0.0 0.0 118-119 16.95 0.0 0.0 0.0 0.0 120-121 17.825 0.0 0.0 0.0 0.0 122-123 18.975 0.0 0.0 0.0 0.0 124-125 20.549999999999997 0.0 0.0 0.0 0.0 126-127 21.637500000000003 0.0 0.0 0.0 0.0 128-129 22.75 0.0 0.0 0.0 0.0 130-131 23.8375 0.0 0.0 0.0 0.0 132-133 24.924999999999997 0.0 0.0 0.0 0.0 134-135 26.049999999999997 0.0 0.0 0.0 0.0 136-137 27.450000000000003 0.0 0.0 0.0 0.0 138-139 28.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTGTC 10 0.006830828 145.0 3 AAATGGT 10 0.006830828 145.0 4 TTTTTTT 30 0.0014437955 24.166668 75-79 >>END_MODULE Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485757 spots for SRR12670142.sra Written 485757 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra Read 485750 spots for SRR12670142.sra Written 485750 spots for SRR12670142.sra SRR ids: ['SRR12670142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0929jmjt SRR12670142.sra spots: 9715007 blocks: [[1, 485750], [485751, 971500], [971501, 1457250], [1457251, 1943000], [1943001, 2428750], [2428751, 2914500], [2914501, 3400250], [3400251, 3886000], [3886001, 4371750], [4371751, 4857500], [4857501, 5343250], [5343251, 5829000], [5829001, 6314750], [6314751, 6800500], [6800501, 7286250], [7286251, 7772000], [7772001, 8257750], [8257751, 8743500], [8743501, 9229250], [9229251, 9715007]] SRR12670142 file size 3280440 SRR12670142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670142 SRR12670142_1.fastq SRR12670142_2.fastq Input file: SRR12670142_1.fastq Paired file: SRR12670142_2.fastq trimmed: SRR12670142-trimmed-pair1.fastq, SRR12670142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:11:49 2025 >> started Tue Feb 11 01:12:05 2025 >> done (15.968s) 9715007 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 1912 ( 0.02%) empty read pairs filtered out after trimming by size control 9713021 (99.98%) read pairs available; of these: 3372116 (34.72%) trimmed read pairs available after processing 6340905 (65.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 9 0.00% 21 7 0.00% 22 13 0.00% 23 13 0.00% 24 18 0.00% 25 12 0.00% 26 28 0.00% 27 33 0.00% 28 40 0.00% 29 39 0.00% 30 46 0.00% 31 43 0.00% 32 51 0.00% 33 58 0.00% 34 67 0.00% 35 71 0.00% 36 77 0.00% 37 104 0.00% 38 133 0.00% 39 149 0.00% 40 179 0.00% 41 201 0.00% 42 190 0.00% 43 225 0.00% 44 250 0.00% 45 221 0.00% 46 292 0.00% 47 342 0.00% 48 405 0.00% 49 445 0.00% 50 566 0.01% 51 650 0.01% 52 705 0.01% 53 771 0.01% 54 802 0.01% 55 898 0.01% 56 931 0.01% 57 1086 0.01% 58 1256 0.01% 59 1595 0.02% 60 1814 0.02% 61 2030 0.02% 62 2270 0.02% 63 2412 0.02% 64 2667 0.03% 65 2992 0.03% 66 3210 0.03% 67 3681 0.04% 68 4102 0.04% 69 4565 0.05% 70 5188 0.05% 71 5794 0.06% 72 6755 0.07% 73 7502 0.08% 74 8347 0.09% 75 8783 0.09% 76 9623 0.10% 77 10399 0.11% 78 11227 0.12% 79 12660 0.13% 80 13715 0.14% 81 15143 0.16% 82 17039 0.18% 83 18466 0.19% 84 20347 0.21% 85 21760 0.22% 86 22875 0.24% 87 24061 0.25% 88 25594 0.26% 89 26426 0.27% 90 28420 0.29% 91 30636 0.32% 92 31906 0.33% 93 33937 0.35% 94 36145 0.37% 95 38004 0.39% 96 39021 0.40% 97 40403 0.42% 98 40855 0.42% 99 41716 0.43% 100 43161 0.44% 101 43599 0.45% 102 45299 0.47% 103 46927 0.48% 104 47967 0.49% 105 49463 0.51% 106 50172 0.52% 107 50543 0.52% 108 50774 0.52% 109 51459 0.53% 110 50514 0.52% 111 51547 0.53% 112 52239 0.54% 113 52421 0.54% 114 53247 0.55% 115 55238 0.57% 116 54891 0.57% 117 54738 0.56% 118 55490 0.57% 119 54800 0.56% 120 55066 0.57% 121 55068 0.57% 122 54943 0.57% 123 55724 0.57% 124 56196 0.58% 125 55311 0.57% 126 55778 0.57% 127 55682 0.57% 128 55426 0.57% 129 55265 0.57% 130 54688 0.56% 131 54231 0.56% 132 53556 0.55% 133 54058 0.56% 134 54037 0.56% 135 53611 0.55% 136 54103 0.56% 137 53921 0.56% 138 53103 0.55% 139 53648 0.55% 140 52778 0.54% 141 52308 0.54% 142 52509 0.54% 143 51522 0.53% 144 51850 0.53% 145 51906 0.53% 146 51676 0.53% 147 51128 0.53% 148 51375 0.53% 149 50609 0.52% 150 51031 0.53% 151 6340905 65.28% 9713021 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=155.99 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTAG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.3 sequence=TTCTCTTAGCTACCATCGTCTTCTCTCCCCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=36.87 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.2 sequence=AAAGAAAAGAAAA SRR12670142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:12:53 Started mapping on | Feb 11 01:12:53 Finished on | Feb 11 01:14:01 Mapping speed, Million of reads per hour | 514.22 Number of input reads | 9713021 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 9011150 Uniquely mapped reads % | 92.77% Average mapped length | 277.16 Number of splices: Total | 8332295 Number of splices: Annotated (sjdb) | 8117527 Number of splices: GT/AG | 8163478 Number of splices: GC/AG | 129243 Number of splices: AT/AC | 6029 Number of splices: Non-canonical | 33545 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236563 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 120308 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465308 465308 465308 N_multimapping 236563 236563 236563 N_noFeature 417464 8875286 483253 N_ambiguous 128728 559 58306 UnstrandedReadsAssigned:8464958 PositiveStrandReadsAssigned:135305 NegativeStrandReadsAssigned:8469591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=123 echo kmer=119 SRR12670142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670142-trimmed-pair1.fastq SRR12670142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,713,021 reads, 8,542,964 reads pseudoaligned [quant] estimated average fragment length: 189.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR12670142.ke.tsv 34699 SRR12670142.se.tsv 87100 total ==> SRR12670142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1829.05 408 27.1305 Potri.005G024800.1.v4.1 1035 846.05 114 16.3882 Potri.004G059700.1.v4.1 961 772.139 6 0.945102 Potri.007G009000.2.v4.1 1416 1227.05 0 0 Potri.003G141000.2.v4.1 2943 2754.05 451 19.9172 Potri.016G087400.1.v4.1 270 115.7 353 371.077 Potri.015G069301.1.v4.1 564 381.097 0 0 Potri.010G195200.1.v4.1 1773 1584.05 119 9.13694 Potri.012G127500.1.v4.1 977 788.12 110 16.9755 ==> SRR12670142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 226 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670142 completed mapping pipeline successfully