Starting /dee2/code/volunteer_pipeline.sh SRR12670146 current disk space = 3056956387328 free memory = 1309815676 SRR12670146 SRAfilesize e8b414d7f2bce61651ea720bda912c6f SRR12670146.sra SRR12670146.sra file validated SRR12670146 is paired end SRR12670146 is conventional basespace SRR12670146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5875 37.0 37.0 37.0 37.0 37.0 2 36.45375 37.0 37.0 37.0 37.0 37.0 3 36.6195 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.624 37.0 37.0 37.0 37.0 37.0 7 36.6195 37.0 37.0 37.0 37.0 37.0 8 36.601 37.0 37.0 37.0 37.0 37.0 9 36.652 37.0 37.0 37.0 37.0 37.0 10-14 36.630399999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5843 37.0 37.0 37.0 37.0 37.0 20-24 36.55069999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5231 37.0 37.0 37.0 37.0 37.0 30-34 36.5115 37.0 37.0 37.0 37.0 37.0 35-39 36.503 37.0 37.0 37.0 37.0 37.0 40-44 36.4655 37.0 37.0 37.0 37.0 37.0 45-49 36.456 37.0 37.0 37.0 37.0 37.0 50-54 36.4434 37.0 37.0 37.0 37.0 37.0 55-59 36.4425 37.0 37.0 37.0 37.0 37.0 60-64 36.3789 37.0 37.0 37.0 37.0 37.0 65-69 36.3942 37.0 37.0 37.0 37.0 37.0 70-74 36.3566 37.0 37.0 37.0 37.0 37.0 75-79 36.300700000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.3278 37.0 37.0 37.0 37.0 37.0 85-89 36.28789999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.276199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.232600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2832 37.0 37.0 37.0 37.0 37.0 105-109 36.2495 37.0 37.0 37.0 37.0 37.0 110-114 36.178399999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.209 37.0 37.0 37.0 37.0 37.0 120-124 36.094100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9679 37.0 37.0 37.0 37.0 37.0 130-134 35.9339 37.0 37.0 37.0 37.0 37.0 135-139 35.810900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.640100000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5415 37.0 37.0 37.0 37.0 37.0 150-151 35.203 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 2.0 25 1.0 26 6.0 27 2.0 28 9.0 29 21.0 30 25.0 31 30.0 32 43.0 33 67.0 34 115.0 35 329.0 36 2941.0 37 404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 12.125 6.4 42.375 2 18.798498122653317 13.516896120150188 38.04755944931164 29.637046307884855 3 17.349999999999998 16.075 27.325 39.25 4 22.875 24.625 24.3 28.199999999999996 5 23.825 30.025000000000002 24.5 21.65 6 19.325 34.825 24.85 21.0 7 15.55 24.8 41.949999999999996 17.7 8 17.8 25.224999999999998 32.25 24.725 9 17.8 22.1 35.425000000000004 24.675 10-14 20.205000000000002 29.609999999999996 27.355 22.830000000000002 15-19 19.975 27.82 27.82 24.385 20-24 20.485 27.589999999999996 28.645 23.28 25-29 20.005 27.955000000000002 28.075 23.965 30-34 20.365 28.549999999999997 27.365000000000002 23.72 35-39 20.29 28.485 27.555000000000003 23.669999999999998 40-44 20.52 28.689999999999998 27.474999999999998 23.315 45-49 20.495 28.53 27.805000000000003 23.169999999999998 50-54 20.405 28.275 28.12 23.200000000000003 55-59 19.975 28.335 27.474999999999998 24.215 60-64 19.86 28.24 28.015 23.885 65-69 20.330000000000002 27.955000000000002 28.17 23.544999999999998 70-74 20.169999999999998 28.110000000000003 27.865000000000002 23.855 75-79 20.43 29.285 26.645000000000003 23.64 80-84 20.97 28.16 27.92 22.95 85-89 19.955000000000002 28.625 27.37 24.05 90-94 20.875 28.444999999999997 26.88 23.799999999999997 95-99 20.51 28.92 27.029999999999998 23.54 100-104 21.275 29.235 26.435 23.055 105-109 21.085 29.165000000000003 26.505000000000003 23.244999999999997 110-114 21.92 28.744999999999997 25.85 23.485 115-119 21.375 28.999999999999996 25.89 23.735 120-124 21.355 29.2 25.645 23.799999999999997 125-129 21.584999999999997 28.155 26.075 24.185000000000002 130-134 20.995 28.275 26.22 24.51 135-139 21.41 27.275 26.505000000000003 24.81 140-144 21.759999999999998 26.72 26.815 24.705 145-149 22.009999999999998 27.089999999999996 25.874999999999996 25.025 150-151 22.237499999999997 26.950000000000003 26.137500000000003 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.5 26 5.0 27 8.0 28 9.5 29 10.0 30 17.0 31 30.5 32 35.5 33 39.5 34 48.5 35 69.5 36 93.5 37 102.0 38 127.5 39 157.0 40 186.5 41 222.5 42 229.5 43 249.0 44 236.5 45 244.0 46 276.5 47 256.0 48 237.0 49 212.0 50 171.0 51 149.0 52 129.0 53 96.5 54 83.5 55 66.0 56 50.5 57 42.5 58 30.0 59 18.0 60 13.0 61 11.0 62 9.0 63 7.0 64 6.0 65 4.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.15 #Duplication Level Percentage of deduplicated Percentage of total 1 83.04930006086427 68.22500000000001 2 13.268411442483263 21.8 3 2.8606208155812536 7.049999999999999 4 0.6390748630553865 2.1 5 0.12172854534388314 0.5 6 0.030432136335970784 0.15 7 0.030432136335970784 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 7 0.17500000000000002 No Hit GTCCCAGAGAGGAGCCATAGGGATGCCCTGTTCATAGAGAATATGAAAGG 6 0.15 No Hit GCTTTATAAAAGGGCGAAAGAGGATTAAAGGGAATATCAATTTTTTGGGG 5 0.125 No Hit ATCACGATGAAATTTCAAAGATTACCCGGGCCTGTCGGCCAAGGCTATAG 5 0.125 No Hit GCTTCTTCTAATCCACTGGAGAACTTTATTTAGTATTCTCACATAAATAG 5 0.125 No Hit GCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.037500000000000006 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.11249999999999999 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.3375 0.0 0.0 0.0 0.0 68-69 0.4625 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.6499999999999999 0.0 0.0 0.0 0.0 74-75 0.75 0.0 0.0 0.0 0.0 76-77 0.8500000000000001 0.0 0.0 0.0 0.0 78-79 1.1375000000000002 0.0 0.0 0.0 0.0 80-81 1.5875 0.0 0.0 0.0 0.0 82-83 2.0875 0.0 0.0 0.0 0.0 84-85 2.4875 0.0 0.0 0.0 0.0 86-87 3.0875000000000004 0.0 0.0 0.0 0.0 88-89 3.525 0.0 0.0 0.0 0.0 90-91 4.1625 0.0 0.0 0.0 0.0 92-93 5.0375 0.0 0.0 0.0 0.0 94-95 5.9 0.0 0.0 0.0 0.0 96-97 6.5 0.0 0.0 0.0 0.0 98-99 7.125 0.0 0.0 0.0 0.0 100-101 7.800000000000001 0.0 0.0 0.0 0.0 102-103 8.7375 0.0 0.0 0.0 0.0 104-105 9.600000000000001 0.0 0.0 0.0 0.0 106-107 10.7125 0.0 0.0 0.0 0.0 108-109 11.962499999999999 0.0 0.0 0.0 0.0 110-111 13.2375 0.0 0.0 0.0 0.0 112-113 14.087499999999999 0.0 0.0 0.0 0.0 114-115 15.075 0.0 0.0 0.0 0.0 116-117 15.9375 0.0 0.0 0.0 0.0 118-119 17.1625 0.0 0.0 0.0 0.0 120-121 18.1625 0.0 0.0 0.0 0.0 122-123 19.237499999999997 0.0 0.0 0.0 0.0 124-125 20.6 0.0 0.0 0.0 0.0 126-127 21.4125 0.0 0.0 0.0 0.0 128-129 22.375 0.0 0.0 0.0 0.0 130-131 23.612499999999997 0.0 0.0 0.0 0.0 132-133 24.6125 0.0 0.0 0.0 0.0 134-135 25.875 0.0 0.0 0.0 0.0 136-137 26.875 0.0 0.0 0.0 0.0 138-139 27.862499999999997 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCATG 10 0.006830828 145.0 8 >>END_MODULE SRR12670146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15 37.0 37.0 37.0 37.0 37.0 2 35.8795 37.0 37.0 37.0 37.0 37.0 3 35.9685 37.0 37.0 37.0 37.0 37.0 4 36.069 37.0 37.0 37.0 37.0 37.0 5 36.0645 37.0 37.0 37.0 37.0 37.0 6 35.954 37.0 37.0 37.0 37.0 37.0 7 36.0635 37.0 37.0 37.0 37.0 37.0 8 36.2625 37.0 37.0 37.0 37.0 37.0 9 36.087 37.0 37.0 37.0 37.0 37.0 10-14 36.16630000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.150600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1105 37.0 37.0 37.0 37.0 37.0 25-29 36.10190000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.02589999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.992200000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.955499999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9673 37.0 37.0 37.0 37.0 37.0 50-54 35.9166 37.0 37.0 37.0 37.0 37.0 55-59 35.85809999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.8749 37.0 37.0 37.0 37.0 37.0 65-69 35.86919999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.825 37.0 37.0 37.0 37.0 37.0 75-79 35.8033 37.0 37.0 37.0 37.0 37.0 80-84 35.7871 37.0 37.0 37.0 37.0 37.0 85-89 35.7241 37.0 37.0 37.0 37.0 37.0 90-94 35.7278 37.0 37.0 37.0 37.0 37.0 95-99 35.6719 37.0 37.0 37.0 37.0 37.0 100-104 35.5686 37.0 37.0 37.0 37.0 37.0 105-109 35.518 37.0 37.0 37.0 37.0 37.0 110-114 35.483999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.523199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.35809999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.1577 37.0 37.0 37.0 29.8 37.0 130-134 34.9183 37.0 37.0 37.0 25.0 37.0 135-139 34.898700000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.658199999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.375699999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.793 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 6.0 15 3.0 16 3.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 3.0 23 3.0 24 5.0 25 4.0 26 11.0 27 15.0 28 19.0 29 25.0 30 32.0 31 46.0 32 88.0 33 144.0 34 284.0 35 737.0 36 2352.0 37 210.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.125 22.475 9.5 28.9 2 25.7 26.424999999999997 33.225 14.649999999999999 3 19.725 28.95 32.2 19.125 4 21.65 36.325 23.474999999999998 18.55 5 24.6 37.2 21.5 16.7 6 21.75 37.9 21.95 18.4 7 19.6 22.625 39.275 18.5 8 22.7 24.224999999999998 29.7 23.375 9 21.875 24.075 30.675 23.375 10-14 23.185 29.134999999999998 27.095000000000002 20.585 15-19 22.905 27.725 28.345 21.025 20-24 22.564999999999998 28.065 28.58 20.79 25-29 22.73 28.705000000000002 28.17 20.395 30-34 22.35 28.28 28.244999999999997 21.125 35-39 22.835 28.384999999999998 28.384999999999998 20.395 40-44 23.89 27.785 26.985 21.34 45-49 22.84 27.725 28.225 21.21 50-54 23.375 27.785 28.255000000000003 20.585 55-59 23.669999999999998 27.544999999999998 28.16 20.625 60-64 23.46 27.865000000000002 27.725 20.95 65-69 23.3 27.800000000000004 27.775 21.125 70-74 23.810000000000002 27.779999999999998 27.825 20.585 75-79 23.87 26.900000000000002 27.744999999999997 21.485000000000003 80-84 23.34 27.605 27.785 21.27 85-89 24.12 28.375 26.845000000000002 20.66 90-94 24.6 27.415 27.575 20.41 95-99 24.485 27.29 27.465 20.76 100-104 25.155 28.07 26.55 20.225 105-109 25.785000000000004 28.000000000000004 26.595000000000002 19.62 110-114 26.314999999999998 28.005000000000003 25.790000000000003 19.89 115-119 27.0 28.315 25.240000000000002 19.445 120-124 27.400000000000002 27.275 26.43 18.895 125-129 27.35 27.05 26.700000000000003 18.9 130-134 28.54 27.315 26.055 18.09 135-139 28.76 27.255000000000003 25.919999999999998 18.065 140-144 29.049999999999997 26.150000000000002 26.729999999999997 18.07 145-149 29.67 25.724999999999998 26.135 18.47 150-151 30.612499999999997 25.4625 26.150000000000002 17.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 4.0 26 6.0 27 8.0 28 7.5 29 11.5 30 20.5 31 29.0 32 36.5 33 46.0 34 60.0 35 73.0 36 90.0 37 106.0 38 127.5 39 159.5 40 187.0 41 206.5 42 234.0 43 258.5 44 278.0 45 277.5 46 250.0 47 242.5 48 227.0 49 206.0 50 173.0 51 117.5 52 101.5 53 94.0 54 88.0 55 73.0 56 45.5 57 38.0 58 25.5 59 16.0 60 15.0 61 15.5 62 10.0 63 5.0 64 4.0 65 1.0 66 2.0 67 3.0 68 1.5 69 0.0 70 1.5 71 2.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.95 #Duplication Level Percentage of deduplicated Percentage of total 1 83.93610608800482 69.625 2 12.658227848101266 21.0 3 2.6220614828209765 6.525 4 0.5726341169379143 1.9 5 0.18083182640144665 0.75 6 0.0 0.0 7 0.0 0.0 8 0.03013863773357444 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit TGTAAAATGATCAGAACTATTTATGTGAGAATACTAAATAAAGTTCTCCA 5 0.125 No Hit GTCACGATCGCTGCCATTGTCAGCGTTTCTTTCTCTCAAGAGGGAGCTTC 5 0.125 No Hit GGACAATGGCGGGTTGATGAGCAGCTATCTTTTGTTGATGGGCCTTATGG 5 0.125 No Hit GTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAG 5 0.125 No Hit AACTTGTTGAGTGGCAAGTCAACCCTCCAACTGGTTTCAAACATAAAGTC 5 0.125 No Hit AGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.3125 0.0 0.0 0.0 0.0 68-69 0.4375 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.625 0.0 0.0 0.0 0.0 74-75 0.725 0.0 0.0 0.0 0.0 76-77 0.8375 0.0 0.0 0.0 0.0 78-79 1.1375000000000002 0.0 0.0 0.0 0.0 80-81 1.5875 0.0 0.0 0.0 0.0 82-83 2.1125 0.0 0.0 0.0 0.0 84-85 2.5375 0.0 0.0 0.0 0.0 86-87 3.0875000000000004 0.0 0.0 0.0 0.0 88-89 3.525 0.0 0.0 0.0 0.0 90-91 4.1625 0.0 0.0 0.0 0.0 92-93 5.0625 0.0 0.0 0.0 0.0 94-95 5.925000000000001 0.0 0.0 0.0 0.0 96-97 6.5375 0.0 0.0 0.0 0.0 98-99 7.15 0.0 0.0 0.0 0.0 100-101 7.8375 0.0 0.0 0.0 0.0 102-103 8.7875 0.0 0.0 0.0 0.0 104-105 9.649999999999999 0.0 0.0 0.0 0.0 106-107 10.725000000000001 0.0 0.0 0.0 0.0 108-109 11.9875 0.0 0.0 0.0 0.0 110-111 13.2625 0.0 0.0 0.0 0.0 112-113 14.0625 0.0 0.0 0.0 0.0 114-115 15.05 0.0 0.0 0.0 0.0 116-117 15.912500000000001 0.0 0.0 0.0 0.0 118-119 17.15 0.0 0.0 0.0 0.0 120-121 18.1375 0.0 0.0 0.0 0.0 122-123 19.1875 0.0 0.0 0.0 0.0 124-125 20.55 0.0 0.0 0.0 0.0 126-127 21.362499999999997 0.0 0.0 0.0 0.0 128-129 22.3125 0.0 0.0 0.0 0.0 130-131 23.5375 0.0 0.0 0.0 0.0 132-133 24.512500000000003 0.0 0.0 0.0 0.0 134-135 25.775 0.0 0.0 0.0 0.0 136-137 26.7625 0.0 0.0 0.0 0.0 138-139 27.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATGAC 10 0.006830828 145.0 7 >>END_MODULE Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553423 spots for SRR12670146.sra Written 553423 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra Read 553409 spots for SRR12670146.sra Written 553409 spots for SRR12670146.sra SRR ids: ['SRR12670146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ni8dwmse SRR12670146.sra spots: 11068194 blocks: [[1, 553409], [553410, 1106818], [1106819, 1660227], [1660228, 2213636], [2213637, 2767045], [2767046, 3320454], [3320455, 3873863], [3873864, 4427272], [4427273, 4980681], [4980682, 5534090], [5534091, 6087499], [6087500, 6640908], [6640909, 7194317], [7194318, 7747726], [7747727, 8301135], [8301136, 8854544], [8854545, 9407953], [9407954, 9961362], [9961363, 10514771], [10514772, 11068194]] SRR12670146 file size 3739756 SRR12670146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670146 SRR12670146_1.fastq SRR12670146_2.fastq Input file: SRR12670146_1.fastq Paired file: SRR12670146_2.fastq trimmed: SRR12670146-trimmed-pair1.fastq, SRR12670146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 02:25:14 2025 >> started Tue Feb 11 02:33:03 2025 >> done (468.773s) 11068194 read pairs processed; of these: 68 ( 0.00%) short read pairs filtered out after trimming by size control 4063 ( 0.04%) empty read pairs filtered out after trimming by size control 11064063 (99.96%) read pairs available; of these: 3357460 (30.35%) trimmed read pairs available after processing 7706603 (69.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 18 0.00% 21 9 0.00% 22 15 0.00% 23 4 0.00% 24 18 0.00% 25 24 0.00% 26 28 0.00% 27 34 0.00% 28 35 0.00% 29 49 0.00% 30 51 0.00% 31 57 0.00% 32 61 0.00% 33 68 0.00% 34 72 0.00% 35 81 0.00% 36 99 0.00% 37 105 0.00% 38 127 0.00% 39 156 0.00% 40 176 0.00% 41 190 0.00% 42 237 0.00% 43 200 0.00% 44 234 0.00% 45 252 0.00% 46 270 0.00% 47 342 0.00% 48 435 0.00% 49 470 0.00% 50 574 0.01% 51 664 0.01% 52 744 0.01% 53 759 0.01% 54 822 0.01% 55 910 0.01% 56 997 0.01% 57 1187 0.01% 58 1321 0.01% 59 1632 0.01% 60 1873 0.02% 61 2096 0.02% 62 2413 0.02% 63 2673 0.02% 64 2647 0.02% 65 3033 0.03% 66 3443 0.03% 67 3769 0.03% 68 4217 0.04% 69 4728 0.04% 70 5368 0.05% 71 6064 0.05% 72 6960 0.06% 73 7939 0.07% 74 8615 0.08% 75 9433 0.09% 76 10089 0.09% 77 10717 0.10% 78 11872 0.11% 79 13080 0.12% 80 13892 0.13% 81 15968 0.14% 82 17625 0.16% 83 18821 0.17% 84 20656 0.19% 85 22240 0.20% 86 23211 0.21% 87 24279 0.22% 88 25582 0.23% 89 26372 0.24% 90 27978 0.25% 91 29576 0.27% 92 31721 0.29% 93 34173 0.31% 94 35913 0.32% 95 37569 0.34% 96 38350 0.35% 97 39173 0.35% 98 39860 0.36% 99 40783 0.37% 100 41374 0.37% 101 42393 0.38% 102 44345 0.40% 103 45917 0.42% 104 46770 0.42% 105 47892 0.43% 106 48512 0.44% 107 49166 0.44% 108 48944 0.44% 109 49531 0.45% 110 49359 0.45% 111 50188 0.45% 112 51028 0.46% 113 51468 0.47% 114 52683 0.48% 115 53916 0.49% 116 54136 0.49% 117 54562 0.49% 118 54170 0.49% 119 53792 0.49% 120 54106 0.49% 121 54047 0.49% 122 54581 0.49% 123 55064 0.50% 124 54965 0.50% 125 54873 0.50% 126 55683 0.50% 127 56242 0.51% 128 54619 0.49% 129 54473 0.49% 130 54437 0.49% 131 53941 0.49% 132 53937 0.49% 133 54171 0.49% 134 53806 0.49% 135 54452 0.49% 136 54510 0.49% 137 54216 0.49% 138 54105 0.49% 139 54387 0.49% 140 53514 0.48% 141 52410 0.47% 142 53140 0.48% 143 52510 0.47% 144 52998 0.48% 145 52825 0.48% 146 52562 0.48% 147 51687 0.47% 148 52714 0.48% 149 52003 0.47% 150 52030 0.47% 151 7706603 69.65% 11064063 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.48 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=144.25 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.87 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=20.75 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCAC SRR12670146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:15:37 Started mapping on | Feb 11 03:15:41 Finished on | Feb 11 05:05:08 Mapping speed, Million of reads per hour | 6.07 Number of input reads | 11064063 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 10095802 Uniquely mapped reads % | 91.25% Average mapped length | 280.14 Number of splices: Total | 9456636 Number of splices: Annotated (sjdb) | 9223975 Number of splices: GT/AG | 9257444 Number of splices: GC/AG | 153180 Number of splices: AT/AC | 6178 Number of splices: Non-canonical | 39834 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299696 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 207839 % of reads mapped to too many loci | 1.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 668565 668565 668565 N_multimapping 299696 299696 299696 N_noFeature 526603 9938902 593299 N_ambiguous 156857 693 66257 UnstrandedReadsAssigned:9412342 PositiveStrandReadsAssigned:156207 NegativeStrandReadsAssigned:9436246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=129 echo kmer=125 SRR12670146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670146-trimmed-pair1.fastq SRR12670146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,064,063 reads, 9,618,956 reads pseudoaligned [quant] estimated average fragment length: 202.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR12670146.ke.tsv 34699 SRR12670146.se.tsv 87100 total ==> SRR12670146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.49 505 28.9224 Potri.005G024800.1.v4.1 1035 833.487 131 16.3511 Potri.004G059700.1.v4.1 961 759.521 3 0.410919 Potri.007G009000.2.v4.1 1416 1214.49 0 0 Potri.003G141000.2.v4.1 2943 2741.49 545.418 20.6975 Potri.016G087400.1.v4.1 270 114.037 457 416.914 Potri.015G069301.1.v4.1 564 371.654 0 0 Potri.010G195200.1.v4.1 1773 1571.49 70 4.63406 Potri.012G127500.1.v4.1 977 775.51 76 10.1953 ==> SRR12670146.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12670146 completed mapping pipeline successfully