Starting /dee2/code/volunteer_pipeline.sh SRR12670149 current disk space = 3056978206720 free memory = 1579982580 SRR12670149 SRAfilesize f303bf2f64ac26fcf7b2a6b997799db6 SRR12670149.sra SRR12670149.sra file validated SRR12670149 is paired end SRR12670149 is conventional basespace SRR12670149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5505 37.0 37.0 37.0 37.0 37.0 2 36.4 37.0 37.0 37.0 37.0 37.0 3 36.539 37.0 37.0 37.0 37.0 37.0 4 36.5885 37.0 37.0 37.0 37.0 37.0 5 36.651 37.0 37.0 37.0 37.0 37.0 6 36.6855 37.0 37.0 37.0 37.0 37.0 7 36.572 37.0 37.0 37.0 37.0 37.0 8 36.61 37.0 37.0 37.0 37.0 37.0 9 36.6035 37.0 37.0 37.0 37.0 37.0 10-14 36.6065 37.0 37.0 37.0 37.0 37.0 15-19 36.5711 37.0 37.0 37.0 37.0 37.0 20-24 36.488 37.0 37.0 37.0 37.0 37.0 25-29 36.5107 37.0 37.0 37.0 37.0 37.0 30-34 36.481700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4776 37.0 37.0 37.0 37.0 37.0 40-44 36.472699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4075 37.0 37.0 37.0 37.0 37.0 50-54 36.4009 37.0 37.0 37.0 37.0 37.0 55-59 36.428999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.383599999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.288199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.288700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2898 37.0 37.0 37.0 37.0 37.0 80-84 36.2731 37.0 37.0 37.0 37.0 37.0 85-89 36.2406 37.0 37.0 37.0 37.0 37.0 90-94 36.2774 37.0 37.0 37.0 37.0 37.0 95-99 36.2281 37.0 37.0 37.0 37.0 37.0 100-104 36.2248 37.0 37.0 37.0 37.0 37.0 105-109 36.2393 37.0 37.0 37.0 37.0 37.0 110-114 36.1447 37.0 37.0 37.0 37.0 37.0 115-119 36.1846 37.0 37.0 37.0 37.0 37.0 120-124 35.999 37.0 37.0 37.0 37.0 37.0 125-129 35.862300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.738699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.4718 37.0 37.0 37.0 37.0 37.0 140-144 35.16709999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.0467 37.0 37.0 37.0 25.0 37.0 150-151 34.62525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 2.0 26 2.0 27 13.0 28 14.0 29 21.0 30 33.0 31 41.0 32 46.0 33 98.0 34 149.0 35 337.0 36 2833.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5 11.0 5.7250000000000005 44.775 2 17.85177766649975 12.593890836254381 38.28242363545318 31.27190786179269 3 17.925 14.7 26.3 41.075 4 21.425 24.65 23.075000000000003 30.85 5 24.349999999999998 29.875 24.95 20.825 6 21.325 33.4 23.674999999999997 21.6 7 15.6 26.825 40.425 17.150000000000002 8 16.975 25.650000000000002 32.775 24.6 9 18.275 24.65 36.225 20.849999999999998 10-14 19.615 29.709999999999997 27.889999999999997 22.785 15-19 19.89 27.675 28.625 23.810000000000002 20-24 20.305 28.22 27.82 23.655 25-29 19.695 28.48 28.22 23.605 30-34 20.29 27.095000000000002 28.685 23.93 35-39 20.155 28.249999999999996 27.98 23.615 40-44 20.125 28.515 27.925 23.435 45-49 20.27 28.000000000000004 28.000000000000004 23.73 50-54 20.615 27.474999999999998 27.655 24.255 55-59 20.32 27.615000000000002 27.83 24.235 60-64 19.564999999999998 27.975 28.555000000000003 23.905 65-69 20.14 28.505000000000003 27.694999999999997 23.66 70-74 21.275 28.345 27.205000000000002 23.175 75-79 20.380000000000003 28.205000000000002 27.800000000000004 23.615 80-84 20.72 28.305000000000003 27.215 23.76 85-89 21.04 28.165000000000003 27.025 23.77 90-94 20.695 28.025 27.834999999999997 23.445 95-99 20.995 28.17 27.21 23.625 100-104 21.025 28.82 26.655 23.5 105-109 22.225 28.660000000000004 26.055 23.06 110-114 21.36 28.93 26.029999999999998 23.68 115-119 22.009999999999998 28.93 25.27 23.79 120-124 21.42 28.744999999999997 25.335 24.5 125-129 21.875 28.275 25.624999999999996 24.224999999999998 130-134 21.29 28.515 25.0 25.195 135-139 21.29 27.76 25.85 25.1 140-144 21.7 27.450000000000003 25.605 25.245 145-149 21.385 26.979999999999997 26.275 25.36 150-151 21.9625 26.987499999999997 25.900000000000002 25.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 3.5 26 8.0 27 8.5 28 7.0 29 9.5 30 17.5 31 20.5 32 25.5 33 33.0 34 42.0 35 65.5 36 78.5 37 96.0 38 139.5 39 173.0 40 199.0 41 216.0 42 227.0 43 245.0 44 254.5 45 254.0 46 257.5 47 261.5 48 237.0 49 213.5 50 176.5 51 139.5 52 123.0 53 105.0 54 84.0 55 67.5 56 58.0 57 42.0 58 30.5 59 24.0 60 22.5 61 13.0 62 3.5 63 2.5 64 2.0 65 2.5 66 2.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.025 #Duplication Level Percentage of deduplicated Percentage of total 1 81.61061400802222 66.125 2 14.594261030546127 23.65 3 2.8077753779697625 6.825 4 0.8330762110459735 2.7 5 0.061709348966368406 0.25 6 0.09256402344955261 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCCCACCTCCTGCTATCCTCATTCAACATATCTTCTTGTGCTTCTCTC 6 0.15 No Hit GTCTTGTTAGTATCTGCCTGAAAGTTGGTCGCTTAGCTGGATTTTCATGC 6 0.15 No Hit ACCAGCTCAATCCCATCCTTGAGAAGCAGAACTGCCTCTTCTATAAATGG 6 0.15 No Hit AGCTGCTTCAACTTCTTCAATAGTTGACATAGTCACAAAACCAAATCCTC 5 0.125 No Hit ATGTAATGTAGATTTATCATTTCTACAAGCCTTCTTCCCCTTCTTGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.5125 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.75 0.0 0.0 0.0 0.0 78-79 0.95 0.0 0.0 0.0 0.0 80-81 1.3125 0.0 0.0 0.0 0.0 82-83 1.5 0.0 0.0 0.0 0.0 84-85 1.8875 0.0 0.0 0.0 0.0 86-87 2.4124999999999996 0.0 0.0 0.0 0.0 88-89 3.05 0.0 0.0 0.0 0.0 90-91 3.7875 0.0 0.0 0.0 0.0 92-93 4.4625 0.0 0.0 0.0 0.0 94-95 5.175000000000001 0.0 0.0 0.0 0.0 96-97 5.7125 0.0 0.0 0.0 0.0 98-99 6.2875 0.0 0.0 0.0 0.0 100-101 7.237500000000001 0.0 0.0 0.0 0.0 102-103 8.15 0.0 0.0 0.0 0.0 104-105 9.025 0.0 0.0 0.0 0.0 106-107 10.05 0.0 0.0 0.0 0.0 108-109 11.35 0.0 0.0 0.0 0.0 110-111 12.275 0.0 0.0 0.0 0.0 112-113 13.1 0.0 0.0 0.0 0.0 114-115 14.1125 0.0 0.0 0.0 0.0 116-117 15.2 0.0 0.0 0.0 0.0 118-119 16.325 0.0 0.0 0.0 0.0 120-121 17.475 0.0 0.0 0.0 0.0 122-123 18.55 0.0 0.0 0.0 0.0 124-125 19.549999999999997 0.0 0.0 0.0 0.0 126-127 20.725 0.0 0.0 0.0 0.0 128-129 21.8 0.0 0.0 0.0 0.0 130-131 22.625 0.0 0.0 0.0 0.0 132-133 23.425 0.0 0.0 0.0 0.0 134-135 24.174999999999997 0.0 0.0 0.0 0.0 136-137 25.2125 0.0 0.0 0.0 0.0 138-139 26.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTTC 10 0.006830828 145.0 3 TCGATCT 10 0.006830828 145.0 8 TTCGATC 10 0.006830828 145.0 7 AAAAGGG 10 0.006830828 145.0 145 CGATCTT 10 0.006830828 145.0 9 >>END_MODULE SRR12670149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4105 37.0 37.0 37.0 37.0 37.0 2 36.267 37.0 37.0 37.0 37.0 37.0 3 36.2325 37.0 37.0 37.0 37.0 37.0 4 36.3495 37.0 37.0 37.0 37.0 37.0 5 36.2965 37.0 37.0 37.0 37.0 37.0 6 36.32 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.3545 37.0 37.0 37.0 37.0 37.0 9 36.4085 37.0 37.0 37.0 37.0 37.0 10-14 36.4167 37.0 37.0 37.0 37.0 37.0 15-19 36.392399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3831 37.0 37.0 37.0 37.0 37.0 25-29 36.3221 37.0 37.0 37.0 37.0 37.0 30-34 36.328700000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2485 37.0 37.0 37.0 37.0 37.0 40-44 36.222699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2543 37.0 37.0 37.0 37.0 37.0 50-54 36.250299999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1827 37.0 37.0 37.0 37.0 37.0 60-64 36.1837 37.0 37.0 37.0 37.0 37.0 65-69 36.208000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0865 37.0 37.0 37.0 37.0 37.0 75-79 36.0993 37.0 37.0 37.0 37.0 37.0 80-84 36.052800000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.05050000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.0606 37.0 37.0 37.0 37.0 37.0 95-99 36.0447 37.0 37.0 37.0 37.0 37.0 100-104 35.8891 37.0 37.0 37.0 37.0 37.0 105-109 35.8264 37.0 37.0 37.0 37.0 37.0 110-114 35.8021 37.0 37.0 37.0 37.0 37.0 115-119 35.806599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.680099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.473699999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.2278 37.0 37.0 37.0 32.2 37.0 135-139 35.0987 37.0 37.0 37.0 27.4 37.0 140-144 34.8775 37.0 37.0 37.0 25.0 37.0 145-149 34.639300000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.377750000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 4.0 22 3.0 23 5.0 24 3.0 25 5.0 26 5.0 27 14.0 28 11.0 29 20.0 30 21.0 31 39.0 32 73.0 33 113.0 34 212.0 35 606.0 36 2567.0 37 295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.65 21.875 10.4 30.075000000000003 2 24.775 26.375 32.45 16.400000000000002 3 19.975 26.724999999999998 33.2 20.1 4 24.075 34.125 23.35 18.45 5 23.599999999999998 37.15 23.150000000000002 16.1 6 20.0 39.324999999999996 23.200000000000003 17.474999999999998 7 20.9 22.8 37.55 18.75 8 20.8 24.825 29.95 24.425 9 21.3 26.05 31.95 20.7 10-14 23.785 29.145 25.825 21.245 15-19 22.285 28.555000000000003 27.884999999999998 21.275 20-24 23.395 29.07 27.12 20.415 25-29 23.26 28.810000000000002 27.189999999999998 20.74 30-34 23.105 28.475 27.845 20.575 35-39 23.04 28.4 27.6 20.96 40-44 23.335 27.339999999999996 28.255000000000003 21.07 45-49 22.98 27.415 28.720000000000002 20.885 50-54 23.955000000000002 28.03 27.49 20.525 55-59 23.435 27.839999999999996 27.975 20.75 60-64 23.075000000000003 26.815 28.549999999999997 21.560000000000002 65-69 23.330000000000002 27.46 28.084999999999997 21.125 70-74 24.08 27.54 27.575 20.805 75-79 23.515 27.544999999999998 27.88 21.060000000000002 80-84 24.104999999999997 28.155 26.715 21.025 85-89 23.73 28.310000000000002 27.575 20.385 90-94 24.16 28.28 27.37 20.19 95-99 25.215 27.665 26.729999999999997 20.39 100-104 25.15 28.075 26.490000000000002 20.285 105-109 25.445 28.42 26.415 19.72 110-114 26.419999999999998 27.79 25.95 19.84 115-119 26.135 28.549999999999997 26.19 19.125 120-124 27.315 27.544999999999998 25.47 19.67 125-129 28.475 27.985 24.97 18.57 130-134 29.54 27.26 24.93 18.27 135-139 30.15 27.015 25.369999999999997 17.465 140-144 31.064999999999998 26.490000000000002 24.865000000000002 17.580000000000002 145-149 32.684999999999995 26.1 24.22 16.994999999999997 150-151 33.7 25.974999999999998 23.8125 16.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 0.5 23 0.0 24 0.0 25 2.5 26 6.0 27 7.0 28 7.0 29 12.5 30 21.5 31 22.0 32 29.5 33 38.5 34 42.0 35 60.5 36 76.5 37 98.0 38 130.5 39 165.0 40 202.0 41 226.5 42 239.5 43 262.5 44 271.5 45 272.0 46 272.5 47 251.5 48 226.0 49 195.0 50 166.5 51 143.0 52 116.0 53 100.0 54 84.0 55 61.0 56 46.5 57 34.0 58 25.0 59 19.0 60 16.5 61 14.0 62 6.5 63 3.0 64 2.0 65 2.5 66 3.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.0 #Duplication Level Percentage of deduplicated Percentage of total 1 82.1604938271605 66.55 2 13.82716049382716 22.400000000000002 3 2.9012345679012346 7.049999999999999 4 0.8333333333333334 2.7 5 0.15432098765432098 0.625 6 0.0925925925925926 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.030864197530864196 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 9 0.22499999999999998 No Hit CCTACAGGAGGTAAAGACTTCTCAGTCGTATCATTACAGGTCTTCTTGTA 6 0.15 No Hit TGTTTTTTGTTTGATAAGAAGAGGTTTGATTGTTTCATGATTACAGCGAT 6 0.15 No Hit CTTTTGTGTCACTGTTGATGATGCTACCATGGCTATCTCACATGTTATCA 6 0.15 No Hit CTTGAGAAAAGCTCTCCTCGGAAGTGTGAGTGAACATTGTGCCAAGCGTG 5 0.125 No Hit GCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CGGGCAAGAAGAGGATGTCTTTGGTGATGGAGACGAGCCCAGTTTCTCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.4875 0.0 0.0 0.0 0.0 74-75 0.625 0.0 0.0 0.0 0.0 76-77 0.7250000000000001 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.2875 0.0 0.0 0.0 0.0 82-83 1.475 0.0 0.0 0.0 0.0 84-85 1.8624999999999998 0.0 0.0 0.0 0.0 86-87 2.3875 0.0 0.0 0.0 0.0 88-89 3.0250000000000004 0.0 0.0 0.0 0.0 90-91 3.7875 0.0 0.0 0.0 0.0 92-93 4.4625 0.0 0.0 0.0 0.0 94-95 5.175000000000001 0.0 0.0 0.0 0.0 96-97 5.725 0.0 0.0 0.0 0.0 98-99 6.362500000000001 0.0 0.0 0.0 0.0 100-101 7.3125 0.0 0.0 0.0 0.0 102-103 8.175 0.0 0.0 0.0 0.0 104-105 9.05 0.0 0.0 0.0 0.0 106-107 10.100000000000001 0.0 0.0 0.0 0.0 108-109 11.462499999999999 0.0 0.0 0.0 0.0 110-111 12.4 0.0 0.0 0.0 0.0 112-113 13.225 0.0 0.0 0.0 0.0 114-115 14.2625 0.0 0.0 0.0 0.0 116-117 15.375 0.0 0.0 0.0 0.0 118-119 16.4875 0.0 0.0 0.0 0.0 120-121 17.65 0.0 0.0 0.0 0.0 122-123 18.725 0.0 0.0 0.0 0.0 124-125 19.7125 0.0 0.0 0.0 0.0 126-127 20.9125 0.0 0.0 0.0 0.0 128-129 22.0 0.0 0.0 0.0 0.0 130-131 22.825000000000003 0.0 0.0 0.0 0.0 132-133 23.6875 0.0 0.0 0.0 0.0 134-135 24.4625 0.0 0.0 0.0 0.0 136-137 25.525 0.0 0.0 0.0 0.0 138-139 26.700000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCT 10 0.006830828 145.0 1 GGGCAAG 10 0.006830828 145.0 2 CGGGCAA 10 0.006830828 145.0 1 TGAGGTA 10 0.006830828 145.0 145 >>END_MODULE Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548624 spots for SRR12670149.sra Written 548624 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra Read 548608 spots for SRR12670149.sra Written 548608 spots for SRR12670149.sra SRR ids: ['SRR12670149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_80caonmg SRR12670149.sra spots: 10972176 blocks: [[1, 548608], [548609, 1097216], [1097217, 1645824], [1645825, 2194432], [2194433, 2743040], [2743041, 3291648], [3291649, 3840256], [3840257, 4388864], [4388865, 4937472], [4937473, 5486080], [5486081, 6034688], [6034689, 6583296], [6583297, 7131904], [7131905, 7680512], [7680513, 8229120], [8229121, 8777728], [8777729, 9326336], [9326337, 9874944], [9874945, 10423552], [10423553, 10972176]] SRR12670149 file size 3707125 SRR12670149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670149 SRR12670149_1.fastq SRR12670149_2.fastq Input file: SRR12670149_1.fastq Paired file: SRR12670149_2.fastq trimmed: SRR12670149-trimmed-pair1.fastq, SRR12670149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 02:48:11 2025 >> started Tue Feb 11 02:58:00 2025 >> done (589.651s) 10972176 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 5606 ( 0.05%) empty read pairs filtered out after trimming by size control 10966498 (99.95%) read pairs available; of these: 3679451 (33.55%) trimmed read pairs available after processing 7287047 (66.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 2 0.00% 21 5 0.00% 22 5 0.00% 23 9 0.00% 24 6 0.00% 25 6 0.00% 26 11 0.00% 27 18 0.00% 28 30 0.00% 29 20 0.00% 30 29 0.00% 31 38 0.00% 32 45 0.00% 33 45 0.00% 34 57 0.00% 35 77 0.00% 36 67 0.00% 37 78 0.00% 38 132 0.00% 39 129 0.00% 40 169 0.00% 41 187 0.00% 42 204 0.00% 43 233 0.00% 44 203 0.00% 45 263 0.00% 46 266 0.00% 47 336 0.00% 48 404 0.00% 49 507 0.00% 50 626 0.01% 51 665 0.01% 52 790 0.01% 53 833 0.01% 54 927 0.01% 55 983 0.01% 56 1180 0.01% 57 1317 0.01% 58 1611 0.01% 59 1837 0.02% 60 2237 0.02% 61 2645 0.02% 62 2829 0.03% 63 3206 0.03% 64 3506 0.03% 65 3910 0.04% 66 4062 0.04% 67 4652 0.04% 68 5358 0.05% 69 6138 0.06% 70 7255 0.07% 71 7711 0.07% 72 8881 0.08% 73 10004 0.09% 74 10991 0.10% 75 12105 0.11% 76 12875 0.12% 77 13681 0.12% 78 14486 0.13% 79 16559 0.15% 80 17509 0.16% 81 19803 0.18% 82 21731 0.20% 83 23434 0.21% 84 25595 0.23% 85 27331 0.25% 86 28732 0.26% 87 29871 0.27% 88 31327 0.29% 89 32024 0.29% 90 34462 0.31% 91 36641 0.33% 92 37782 0.34% 93 39768 0.36% 94 42322 0.39% 95 43700 0.40% 96 44963 0.41% 97 46623 0.43% 98 46734 0.43% 99 46801 0.43% 100 48349 0.44% 101 48243 0.44% 102 49860 0.45% 103 51154 0.47% 104 52425 0.48% 105 53654 0.49% 106 54586 0.50% 107 54714 0.50% 108 54727 0.50% 109 55110 0.50% 110 54281 0.49% 111 54729 0.50% 112 55792 0.51% 113 55645 0.51% 114 56771 0.52% 115 58011 0.53% 116 58285 0.53% 117 58624 0.53% 118 59301 0.54% 119 57942 0.53% 120 58404 0.53% 121 58112 0.53% 122 57618 0.53% 123 58243 0.53% 124 58296 0.53% 125 57296 0.52% 126 58709 0.54% 127 58497 0.53% 128 57696 0.53% 129 57519 0.52% 130 57863 0.53% 131 56475 0.51% 132 56169 0.51% 133 56544 0.52% 134 55617 0.51% 135 55912 0.51% 136 56104 0.51% 137 55690 0.51% 138 55785 0.51% 139 56875 0.52% 140 55245 0.50% 141 55455 0.51% 142 55527 0.51% 143 54574 0.50% 144 54374 0.50% 145 54442 0.50% 146 54484 0.50% 147 53595 0.49% 148 54423 0.50% 149 53071 0.48% 150 54029 0.49% 151 7287047 66.45% 10966498 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=24 prefix-density=0.74 prefix-fanout=1.9 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=18.10 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.6 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.30 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=1.29 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=34.92 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=12.0 sequence=AAAGAAAAGAAAA SRR12670149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:49:39 Started mapping on | Feb 11 03:49:45 Finished on | Feb 11 05:44:30 Mapping speed, Million of reads per hour | 5.73 Number of input reads | 10966498 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 10358114 Uniquely mapped reads % | 94.45% Average mapped length | 277.59 Number of splices: Total | 9748722 Number of splices: Annotated (sjdb) | 9519389 Number of splices: GT/AG | 9545162 Number of splices: GC/AG | 156477 Number of splices: AT/AC | 6220 Number of splices: Non-canonical | 40863 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235089 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 69879 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373295 373295 373295 N_multimapping 235089 235089 235089 N_noFeature 438027 10170464 522085 N_ambiguous 159278 631 55382 UnstrandedReadsAssigned:9760809 PositiveStrandReadsAssigned:187019 NegativeStrandReadsAssigned:9780647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=124 echo kmer=119 SRR12670149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670149-trimmed-pair1.fastq SRR12670149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,966,498 reads, 9,803,469 reads pseudoaligned [quant] estimated average fragment length: 193.198 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR12670149.ke.tsv 34699 SRR12670149.se.tsv 87100 total ==> SRR12670149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1825.8 361 18.6764 Potri.005G024800.1.v4.1 1035 842.802 107 11.9922 Potri.004G059700.1.v4.1 961 768.84 3 0.368574 Potri.007G009000.2.v4.1 1416 1223.8 0 0 Potri.003G141000.2.v4.1 2943 2750.8 666.646 22.8916 Potri.016G087400.1.v4.1 270 116.369 486 394.491 Potri.015G069301.1.v4.1 564 378.775 0 0 Potri.010G195200.1.v4.1 1773 1580.8 27 1.61334 Potri.012G127500.1.v4.1 977 784.835 109 13.1186 ==> SRR12670149.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 178 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12670149 completed mapping pipeline successfully