Starting /dee2/code/volunteer_pipeline.sh SRR12670152 current disk space = 3055331229696 free memory = 1448920844 SRR12670152 SRAfilesize 91de45357944587c8023d5dfcea8928a SRR12670152.sra SRR12670152.sra file validated SRR12670152 is paired end SRR12670152 is conventional basespace SRR12670152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6805 37.0 37.0 37.0 37.0 37.0 2 36.5275 37.0 37.0 37.0 37.0 37.0 3 36.6835 37.0 37.0 37.0 37.0 37.0 4 36.687 37.0 37.0 37.0 37.0 37.0 5 36.7015 37.0 37.0 37.0 37.0 37.0 6 36.727 37.0 37.0 37.0 37.0 37.0 7 36.638 37.0 37.0 37.0 37.0 37.0 8 36.7665 37.0 37.0 37.0 37.0 37.0 9 36.746 37.0 37.0 37.0 37.0 37.0 10-14 36.6882 37.0 37.0 37.0 37.0 37.0 15-19 36.66029999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.61619999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5985 37.0 37.0 37.0 37.0 37.0 30-34 36.5926 37.0 37.0 37.0 37.0 37.0 35-39 36.6014 37.0 37.0 37.0 37.0 37.0 40-44 36.5346 37.0 37.0 37.0 37.0 37.0 45-49 36.5704 37.0 37.0 37.0 37.0 37.0 50-54 36.516999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.4613 37.0 37.0 37.0 37.0 37.0 60-64 36.4425 37.0 37.0 37.0 37.0 37.0 65-69 36.42280000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3804 37.0 37.0 37.0 37.0 37.0 75-79 36.419500000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.4189 37.0 37.0 37.0 37.0 37.0 85-89 36.403600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.325300000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.3366 37.0 37.0 37.0 37.0 37.0 100-104 36.366600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.334 37.0 37.0 37.0 37.0 37.0 110-114 36.2806 37.0 37.0 37.0 37.0 37.0 115-119 36.23629999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.146699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9791 37.0 37.0 37.0 37.0 37.0 130-134 35.8919 37.0 37.0 37.0 37.0 37.0 135-139 35.716899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.383599999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.1281 37.0 37.0 37.0 32.2 37.0 150-151 34.90625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 8.0 28 10.0 29 7.0 30 19.0 31 30.0 32 35.0 33 86.0 34 165.0 35 311.0 36 2902.0 37 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.125 10.674999999999999 5.2749999999999995 41.925000000000004 2 17.333666833416707 13.006503251625812 38.519259629814904 31.140570285142573 3 17.7 15.950000000000001 29.175 37.175000000000004 4 22.125 25.724999999999998 24.15 28.000000000000004 5 24.15 30.2 25.1 20.549999999999997 6 21.6 33.375 24.8 20.225 7 15.475 25.25 42.025 17.25 8 17.1 23.625 35.25 24.025 9 16.425 22.650000000000002 35.6 25.324999999999996 10-14 19.73 29.585 27.905 22.78 15-19 20.22 28.005000000000003 27.92 23.855 20-24 20.080000000000002 28.04 28.285 23.595 25-29 20.47 28.7 27.950000000000003 22.88 30-34 19.86 29.45 27.415 23.275000000000002 35-39 20.150000000000002 28.694999999999997 27.675 23.48 40-44 20.630000000000003 28.660000000000004 27.689999999999998 23.02 45-49 20.775 28.28 27.72 23.225 50-54 20.685000000000002 28.449999999999996 27.889999999999997 22.975 55-59 20.53 28.42 27.445000000000004 23.605 60-64 20.849999999999998 28.525 27.625 23.0 65-69 20.200000000000003 27.265 29.244999999999997 23.29 70-74 20.665 28.425 27.839999999999996 23.07 75-79 20.595 28.58 27.91 22.915 80-84 19.919999999999998 29.315 27.089999999999996 23.674999999999997 85-89 21.044999999999998 29.185 26.61 23.16 90-94 20.72 28.15 27.98 23.150000000000002 95-99 20.919999999999998 28.185 26.995 23.9 100-104 20.919999999999998 28.884999999999998 26.66 23.535 105-109 21.55 28.720000000000002 26.545 23.185 110-114 21.505 28.62 26.35 23.525 115-119 21.85 29.225 25.52 23.405 120-124 21.84 28.555000000000003 25.55 24.055 125-129 22.185 28.88 24.990000000000002 23.945 130-134 21.945 28.1 25.21 24.745 135-139 22.675 28.249999999999996 25.924999999999997 23.150000000000002 140-144 22.67 27.884999999999998 26.055 23.39 145-149 23.150000000000002 27.825 25.435000000000002 23.59 150-151 23.175 27.962500000000002 26.2875 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 2.0 27 2.0 28 8.5 29 11.5 30 12.0 31 22.0 32 31.0 33 38.5 34 53.5 35 80.0 36 110.5 37 132.5 38 146.0 39 159.5 40 181.5 41 207.0 42 229.0 43 258.5 44 269.5 45 262.0 46 251.5 47 235.0 48 217.0 49 213.0 50 188.5 51 149.5 52 128.5 53 101.0 54 71.0 55 54.0 56 46.5 57 34.0 58 25.5 59 22.0 60 15.5 61 10.0 62 7.0 63 2.0 64 2.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.75 #Duplication Level Percentage of deduplicated Percentage of total 1 83.17220543806646 68.825 2 13.836858006042297 22.900000000000002 3 2.1450151057401814 5.325 4 0.7552870090634441 2.5 5 0.030211480362537763 0.125 6 0.030211480362537763 0.15 7 0.030211480362537763 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTC 7 0.17500000000000002 No Hit GCACTTGACGCGTGTTGTCGAATCCGATTATACGGATAAAGGCGTTAGGG 6 0.15 No Hit GTCTTGGTGCCTTGATTTGTCTATTTATTTATTTATTTATTTATTTATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.3625 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6625 0.0 0.0 0.0 0.0 76-77 0.8999999999999999 0.0 0.0 0.0 0.0 78-79 1.1875 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.6749999999999998 0.0 0.0 0.0 0.0 84-85 2.0125 0.0 0.0 0.0 0.0 86-87 2.5374999999999996 0.0 0.0 0.0 0.0 88-89 3.0625 0.0 0.0 0.0 0.0 90-91 3.5375 0.0 0.0 0.0 0.0 92-93 3.9125 0.0 0.0 0.0 0.0 94-95 4.5875 0.0 0.0 0.0 0.0 96-97 5.3375 0.0 0.0 0.0 0.0 98-99 6.199999999999999 0.0 0.0 0.0 0.0 100-101 7.275 0.0 0.0 0.0 0.0 102-103 8.1625 0.0 0.0 0.0 0.0 104-105 9.1125 0.0 0.0 0.0 0.0 106-107 10.1875 0.0 0.0 0.0 0.0 108-109 11.2875 0.0 0.0 0.0 0.0 110-111 12.100000000000001 0.0 0.0 0.0 0.0 112-113 13.149999999999999 0.0 0.0 0.0 0.0 114-115 14.125 0.0 0.0 0.0 0.0 116-117 15.1875 0.0 0.0 0.0 0.0 118-119 16.0625 0.0 0.0 0.0 0.0 120-121 17.012500000000003 0.0 0.0 0.0 0.0 122-123 18.2125 0.0 0.0 0.0 0.0 124-125 19.375 0.0 0.0 0.0 0.0 126-127 20.375 0.0 0.0 0.0 0.0 128-129 21.625 0.0 0.0 0.0 0.0 130-131 22.7 0.0 0.0 0.0 0.0 132-133 23.9875 0.0 0.0 0.0 0.0 134-135 25.075000000000003 0.0 0.0 0.0 0.0 136-137 26.0875 0.0 0.0 0.0 0.0 138-139 27.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.375 37.0 37.0 37.0 37.0 37.0 2 36.4225 37.0 37.0 37.0 37.0 37.0 3 36.4185 37.0 37.0 37.0 37.0 37.0 4 36.478 37.0 37.0 37.0 37.0 37.0 5 36.533 37.0 37.0 37.0 37.0 37.0 6 36.429 37.0 37.0 37.0 37.0 37.0 7 36.345 37.0 37.0 37.0 37.0 37.0 8 36.535 37.0 37.0 37.0 37.0 37.0 9 36.432 37.0 37.0 37.0 37.0 37.0 10-14 36.488 37.0 37.0 37.0 37.0 37.0 15-19 36.461200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3839 37.0 37.0 37.0 37.0 37.0 25-29 36.3565 37.0 37.0 37.0 37.0 37.0 30-34 36.358999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.28679999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.2741 37.0 37.0 37.0 37.0 37.0 45-49 36.2496 37.0 37.0 37.0 37.0 37.0 50-54 36.2264 37.0 37.0 37.0 37.0 37.0 55-59 36.2359 37.0 37.0 37.0 37.0 37.0 60-64 36.2057 37.0 37.0 37.0 37.0 37.0 65-69 36.1774 37.0 37.0 37.0 37.0 37.0 70-74 36.1037 37.0 37.0 37.0 37.0 37.0 75-79 36.1188 37.0 37.0 37.0 37.0 37.0 80-84 36.0935 37.0 37.0 37.0 37.0 37.0 85-89 36.0571 37.0 37.0 37.0 37.0 37.0 90-94 36.05839999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.0087 37.0 37.0 37.0 37.0 37.0 100-104 35.9387 37.0 37.0 37.0 37.0 37.0 105-109 35.865700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.74640000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.7761 37.0 37.0 37.0 37.0 37.0 120-124 35.50840000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.3788 37.0 37.0 37.0 37.0 37.0 130-134 35.1562 37.0 37.0 37.0 32.2 37.0 135-139 34.9443 37.0 37.0 37.0 25.0 37.0 140-144 34.59089999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.1457 37.0 37.0 37.0 25.0 37.0 150-151 33.89175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 3.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 4.0 23 3.0 24 2.0 25 8.0 26 3.0 27 7.0 28 13.0 29 21.0 30 25.0 31 39.0 32 58.0 33 109.0 34 275.0 35 537.0 36 2592.0 37 288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.1 23.425 8.15 25.324999999999996 2 25.35 25.825 32.725 16.1 3 20.525 27.525 33.025 18.925 4 24.224999999999998 34.775 23.625 17.375 5 24.925 37.95 21.224999999999998 15.9 6 21.2 40.1 20.575 18.125 7 19.925 23.075000000000003 36.8 20.200000000000003 8 20.0 26.174999999999997 29.475 24.349999999999998 9 22.8 24.575 30.599999999999998 22.025 10-14 22.96 29.360000000000003 26.595000000000002 21.085 15-19 23.169999999999998 28.07 27.994999999999997 20.765 20-24 22.82 28.310000000000002 28.025 20.845 25-29 23.3 28.265 28.205000000000002 20.23 30-34 22.725 27.605 28.225 21.445 35-39 22.95 27.779999999999998 28.01 21.26 40-44 22.68 28.854999999999997 27.810000000000002 20.655 45-49 23.135 27.43 28.849999999999998 20.585 50-54 23.135 28.21 28.035 20.62 55-59 23.26 27.089999999999996 28.34 21.310000000000002 60-64 22.655 27.565 27.884999999999998 21.895 65-69 22.55 28.244999999999997 28.01 21.195 70-74 23.72 27.71 27.965 20.605 75-79 23.25 27.825 27.83 21.095 80-84 23.04 28.095 27.500000000000004 21.365000000000002 85-89 24.135 28.025 27.284999999999997 20.555 90-94 23.895 27.66 27.224999999999998 21.22 95-99 23.95 28.549999999999997 27.810000000000002 19.689999999999998 100-104 25.240000000000002 27.76 27.115000000000002 19.885 105-109 25.759999999999998 28.515 26.16 19.564999999999998 110-114 26.169999999999998 28.33 25.81 19.689999999999998 115-119 26.450000000000003 28.24 26.07 19.24 120-124 27.389999999999997 27.97 25.21 19.43 125-129 27.935 28.83 25.09 18.145 130-134 29.794999999999998 27.35 25.635 17.22 135-139 30.755 27.24 25.509999999999998 16.495 140-144 31.915 26.605 24.995 16.485 145-149 33.085 25.480000000000004 24.555 16.88 150-151 35.0125 25.4625 24.575 14.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 2.5 17 1.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 4.5 26 9.0 27 7.5 28 6.5 29 8.0 30 10.0 31 26.5 32 28.5 33 32.0 34 63.0 35 90.5 36 96.0 37 103.0 38 123.5 39 148.0 40 176.5 41 218.0 42 260.5 43 273.0 44 274.5 45 276.5 46 262.5 47 242.0 48 216.5 49 191.0 50 184.5 51 148.0 52 105.5 53 87.5 54 71.5 55 60.5 56 51.5 57 38.5 58 27.5 59 21.0 60 14.0 61 10.0 62 7.0 63 4.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 1.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.85 #Duplication Level Percentage of deduplicated Percentage of total 1 83.58479179239589 69.25 2 13.216656608328304 21.9 3 2.323476161738081 5.775 4 0.724200362100181 2.4 5 0.09052504526252263 0.375 6 0.06035003017501509 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 6 0.15 No Hit GGCTAATGACATTACTTCCATTGCAAGCAATGGTGGACGAGTTCAATGCA 6 0.15 No Hit GCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGC 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit ATCATCCTCTATCTCTCAAACCCTAACAACCTCTCCATCAAATTCTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.3625 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.6625 0.0 0.0 0.0 0.0 76-77 0.8999999999999999 0.0 0.0 0.0 0.0 78-79 1.1875 0.0 0.0 0.0 0.0 80-81 1.35 0.0 0.0 0.0 0.0 82-83 1.6749999999999998 0.0 0.0 0.0 0.0 84-85 2.0 0.0 0.0 0.0 0.0 86-87 2.5125 0.0 0.0 0.0 0.0 88-89 3.0125 0.0 0.0 0.0 0.0 90-91 3.4875 0.0 0.0 0.0 0.0 92-93 3.875 0.0 0.0 0.0 0.0 94-95 4.550000000000001 0.0 0.0 0.0 0.0 96-97 5.3125 0.0 0.0 0.0 0.0 98-99 6.1875 0.0 0.0 0.0 0.0 100-101 7.300000000000001 0.0 0.0 0.0 0.0 102-103 8.2125 0.0 0.0 0.0 0.0 104-105 9.2 0.0 0.0 0.0 0.0 106-107 10.2875 0.0 0.0 0.0 0.0 108-109 11.35 0.0 0.0 0.0 0.0 110-111 12.175 0.0 0.0 0.0 0.0 112-113 13.2375 0.0 0.0 0.0 0.0 114-115 14.25 0.0 0.0 0.0 0.0 116-117 15.2875 0.0 0.0 0.0 0.0 118-119 16.174999999999997 0.0 0.0 0.0 0.0 120-121 17.112499999999997 0.0 0.0 0.0 0.0 122-123 18.3125 0.0 0.0 0.0 0.0 124-125 19.487499999999997 0.0 0.0 0.0 0.0 126-127 20.4875 0.0 0.0 0.0 0.0 128-129 21.75 0.0 0.0 0.0 0.0 130-131 22.825 0.0 0.0 0.0 0.0 132-133 24.1125 0.0 0.0 0.0 0.0 134-135 25.200000000000003 0.0 0.0 0.0 0.0 136-137 26.200000000000003 0.0 0.0 0.0 0.0 138-139 27.325000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529619 spots for SRR12670152.sra Written 529619 spots for SRR12670152.sra Read 529637 spots for SRR12670152.sra Written 529637 spots for SRR12670152.sra SRR ids: ['SRR12670152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zvw4h7iw SRR12670152.sra spots: 10592398 blocks: [[1, 529619], [529620, 1059238], [1059239, 1588857], [1588858, 2118476], [2118477, 2648095], [2648096, 3177714], [3177715, 3707333], [3707334, 4236952], [4236953, 4766571], [4766572, 5296190], [5296191, 5825809], [5825810, 6355428], [6355429, 6885047], [6885048, 7414666], [7414667, 7944285], [7944286, 8473904], [8473905, 9003523], [9003524, 9533142], [9533143, 10062761], [10062762, 10592398]] SRR12670152 file size 3578059 SRR12670152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670152 SRR12670152_1.fastq SRR12670152_2.fastq Input file: SRR12670152_1.fastq Paired file: SRR12670152_2.fastq trimmed: SRR12670152-trimmed-pair1.fastq, SRR12670152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:55:37 2025 >> started Tue Feb 11 05:05:06 2025 >> done (568.432s) 10592398 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 1465 ( 0.01%) empty read pairs filtered out after trimming by size control 10590875 (99.99%) read pairs available; of these: 3366511 (31.79%) trimmed read pairs available after processing 7224364 (68.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 15 0.00% 21 8 0.00% 22 6 0.00% 23 18 0.00% 24 17 0.00% 25 20 0.00% 26 30 0.00% 27 24 0.00% 28 32 0.00% 29 49 0.00% 30 34 0.00% 31 66 0.00% 32 60 0.00% 33 66 0.00% 34 61 0.00% 35 67 0.00% 36 101 0.00% 37 100 0.00% 38 110 0.00% 39 128 0.00% 40 172 0.00% 41 194 0.00% 42 212 0.00% 43 192 0.00% 44 236 0.00% 45 256 0.00% 46 289 0.00% 47 350 0.00% 48 399 0.00% 49 510 0.00% 50 634 0.01% 51 657 0.01% 52 761 0.01% 53 768 0.01% 54 807 0.01% 55 867 0.01% 56 952 0.01% 57 1116 0.01% 58 1419 0.01% 59 1660 0.02% 60 1785 0.02% 61 2246 0.02% 62 2398 0.02% 63 2701 0.03% 64 2903 0.03% 65 3211 0.03% 66 3547 0.03% 67 4049 0.04% 68 4528 0.04% 69 4970 0.05% 70 5647 0.05% 71 6467 0.06% 72 7486 0.07% 73 8144 0.08% 74 9149 0.09% 75 9866 0.09% 76 10909 0.10% 77 11198 0.11% 78 12273 0.12% 79 13504 0.13% 80 15034 0.14% 81 16703 0.16% 82 18589 0.18% 83 20011 0.19% 84 21804 0.21% 85 23663 0.22% 86 24343 0.23% 87 24920 0.24% 88 26688 0.25% 89 27935 0.26% 90 29610 0.28% 91 31398 0.30% 92 33344 0.31% 93 35182 0.33% 94 37314 0.35% 95 38552 0.36% 96 39854 0.38% 97 40696 0.38% 98 40669 0.38% 99 41603 0.39% 100 43342 0.41% 101 43856 0.41% 102 45739 0.43% 103 46627 0.44% 104 47692 0.45% 105 48628 0.46% 106 49531 0.47% 107 49552 0.47% 108 50041 0.47% 109 50094 0.47% 110 50093 0.47% 111 50792 0.48% 112 51214 0.48% 113 52126 0.49% 114 52455 0.50% 115 53229 0.50% 116 53682 0.51% 117 53952 0.51% 118 53979 0.51% 119 52947 0.50% 120 53423 0.50% 121 53173 0.50% 122 53577 0.51% 123 54144 0.51% 124 55000 0.52% 125 54174 0.51% 126 55903 0.53% 127 55053 0.52% 128 53635 0.51% 129 53945 0.51% 130 53765 0.51% 131 53082 0.50% 132 52674 0.50% 133 53605 0.51% 134 52930 0.50% 135 53925 0.51% 136 53482 0.50% 137 52985 0.50% 138 52909 0.50% 139 52740 0.50% 140 52222 0.49% 141 51690 0.49% 142 51680 0.49% 143 51554 0.49% 144 51717 0.49% 145 51853 0.49% 146 51299 0.48% 147 50976 0.48% 148 51522 0.49% 149 49752 0.47% 150 50193 0.47% 151 7224364 68.21% 10590875 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=193.43 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=21 prefix-density=0.48 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.93 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.8 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670152 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 06:04:41 Started mapping on | Feb 11 06:05:03 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 7.20 Number of input reads | 10590875 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 9978017 Uniquely mapped reads % | 94.21% Average mapped length | 278.85 Number of splices: Total | 9159206 Number of splices: Annotated (sjdb) | 8957508 Number of splices: GT/AG | 8971160 Number of splices: GC/AG | 150683 Number of splices: AT/AC | 6354 Number of splices: Non-canonical | 31009 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238975 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 13181 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373883 373883 373883 N_multimapping 238975 238975 238975 N_noFeature 389060 9848937 448141 N_ambiguous 124317 403 54124 UnstrandedReadsAssigned:9464640 PositiveStrandReadsAssigned:128677 NegativeStrandReadsAssigned:9475752 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=126 echo kmer=121 SRR12670152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670152-trimmed-pair1.fastq SRR12670152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,590,875 reads, 9,493,889 reads pseudoaligned [quant] estimated average fragment length: 196.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12670152.ke.tsv 34699 SRR12670152.se.tsv 87100 total ==> SRR12670152.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.87 262 16.4626 Potri.005G024800.1.v4.1 1035 839.874 93 12.683 Potri.004G059700.1.v4.1 961 765.923 7 1.04681 Potri.007G009000.2.v4.1 1416 1220.87 0 0 Potri.003G141000.2.v4.1 2943 2747.87 467.413 19.4831 Potri.016G087400.1.v4.1 270 115.895 331 327.129 Potri.015G069301.1.v4.1 564 374.97 0 0 Potri.010G195200.1.v4.1 1773 1577.87 3 0.217773 Potri.012G127500.1.v4.1 977 781.912 57 8.34971 ==> SRR12670152.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 327 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 105 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR12670152 completed mapping pipeline successfully