Starting /dee2/code/volunteer_pipeline.sh SRR12670154 current disk space = 3054902513664 free memory = 1354438508 SRR12670154 SRAfilesize 956d8a33f36e465897d64d397c47595c SRR12670154.sra SRR12670154.sra file validated SRR12670154 is paired end SRR12670154 is conventional basespace SRR12670154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6305 37.0 37.0 37.0 37.0 37.0 2 36.397 37.0 37.0 37.0 37.0 37.0 3 36.6515 37.0 37.0 37.0 37.0 37.0 4 36.6065 37.0 37.0 37.0 37.0 37.0 5 36.7035 37.0 37.0 37.0 37.0 37.0 6 36.651 37.0 37.0 37.0 37.0 37.0 7 36.6095 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.6545 37.0 37.0 37.0 37.0 37.0 10-14 36.61710000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.54639999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5305 37.0 37.0 37.0 37.0 37.0 25-29 36.53439999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5218 37.0 37.0 37.0 37.0 37.0 35-39 36.490500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4773 37.0 37.0 37.0 37.0 37.0 45-49 36.3659 37.0 37.0 37.0 37.0 37.0 50-54 36.3313 37.0 37.0 37.0 37.0 37.0 55-59 36.337900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.330200000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3114 37.0 37.0 37.0 37.0 37.0 70-74 36.2571 37.0 37.0 37.0 37.0 37.0 75-79 36.2827 37.0 37.0 37.0 37.0 37.0 80-84 36.3257 37.0 37.0 37.0 37.0 37.0 85-89 36.2649 37.0 37.0 37.0 37.0 37.0 90-94 36.2334 37.0 37.0 37.0 37.0 37.0 95-99 36.2537 37.0 37.0 37.0 37.0 37.0 100-104 36.249399999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.2027 37.0 37.0 37.0 37.0 37.0 110-114 36.070100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1032 37.0 37.0 37.0 37.0 37.0 120-124 35.954100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.769 37.0 37.0 37.0 37.0 37.0 130-134 35.5866 37.0 37.0 37.0 37.0 37.0 135-139 35.2876 37.0 37.0 37.0 37.0 37.0 140-144 34.9495 37.0 37.0 37.0 27.4 37.0 145-149 34.5195 37.0 37.0 37.0 25.0 37.0 150-151 34.18625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 4.0 26 2.0 27 2.0 28 11.0 29 16.0 30 27.0 31 42.0 32 87.0 33 116.0 34 187.0 35 355.0 36 2785.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.75 11.625 5.525 33.1 2 21.238716148445334 12.83851554663992 35.0802407221665 30.842527582748247 3 17.349999999999998 19.775000000000002 30.15 32.725 4 22.3 26.474999999999998 23.275000000000002 27.950000000000003 5 23.5 33.050000000000004 22.075 21.375 6 21.85 35.85 22.425 19.875 7 15.325 27.500000000000004 41.325 15.85 8 18.0 24.5 31.924999999999997 25.575 9 18.125 24.275 32.725 24.875 10-14 20.705000000000002 29.659999999999997 26.3 23.335 15-19 20.595 27.644999999999996 28.065 23.695 20-24 20.87 27.67 27.944999999999997 23.515 25-29 20.755000000000003 27.72 27.625 23.9 30-34 20.13 27.48 27.650000000000002 24.740000000000002 35-39 20.43 27.49 27.91 24.169999999999998 40-44 20.18 28.395 27.150000000000002 24.275 45-49 21.195 27.284999999999997 27.175 24.345 50-54 21.34 27.084999999999997 27.650000000000002 23.925 55-59 20.995 27.185 27.41 24.41 60-64 21.135 27.13 28.235 23.5 65-69 21.005 27.42 27.565 24.01 70-74 21.61 27.21 27.42 23.76 75-79 21.27 27.26 27.595 23.875 80-84 21.565 26.75 27.615000000000002 24.07 85-89 21.81 28.044999999999998 26.939999999999998 23.205000000000002 90-94 21.8 27.075 27.235 23.89 95-99 21.965 28.235 25.94 23.86 100-104 22.335 28.1 26.205000000000002 23.36 105-109 21.575 28.535 25.75 24.14 110-114 22.18 27.744999999999997 25.505 24.57 115-119 22.305 27.900000000000002 25.05 24.745 120-124 21.855 27.04 25.915 25.19 125-129 21.755 27.46 25.27 25.515 130-134 21.785 27.675 25.31 25.230000000000004 135-139 21.675 26.61 25.259999999999998 26.455000000000002 140-144 21.905 26.640000000000004 25.650000000000002 25.805 145-149 22.375 26.395000000000003 25.53 25.7 150-151 22.0625 26.7125 25.324999999999996 25.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 3.0 27 3.5 28 5.0 29 6.5 30 8.5 31 10.0 32 12.5 33 23.5 34 45.0 35 63.0 36 76.5 37 92.0 38 113.5 39 135.5 40 164.5 41 195.0 42 219.0 43 251.5 44 265.5 45 260.5 46 266.5 47 260.5 48 243.5 49 220.5 50 190.0 51 155.0 52 131.5 53 115.0 54 91.5 55 75.5 56 60.5 57 60.0 58 47.0 59 24.0 60 21.5 61 17.5 62 11.5 63 10.5 64 7.0 65 2.5 66 2.0 67 4.0 68 3.5 69 3.5 70 5.5 71 4.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.925 #Duplication Level Percentage of deduplicated Percentage of total 1 83.06377784559048 68.05 2 13.182789136405248 21.6 3 2.8684772657918827 7.049999999999999 4 0.6103143118706134 2.0 5 0.15257857796765334 0.625 6 0.061031431187061336 0.3 7 0.030515715593530668 0.17500000000000002 8 0.030515715593530668 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTAATTCACCAAGGAGTCAGGATGTTCAATTCTTTCCACCTTGTCAAAA 8 0.2 No Hit CTCCAGTAGCACCAAAAGGCCCATCGTGTCCACAAGAACTAACCACAATC 7 0.17500000000000002 No Hit ATTTGAAGCAAGAAGATCAGTGAAAGAAGAAGAGGTCATGAAAGGGTAGT 6 0.15 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 6 0.15 No Hit CAGCAATTGGTGAAAAGTATCCCTGCACAACAAGCGATACCTTCTCAGTG 5 0.125 No Hit GGTAAAGGCAAGTGTGACTGGAGGACATAATGACAACATCCCTGTAGAGG 5 0.125 No Hit GCTCGTATTCACATAGCATACCTCTATGACATAGGATGTTTTGGCTCTGT 5 0.125 No Hit CCAACAATGATTCACAAGCATCTTCAAGTAGATCCAAGACCTTCTCAAAA 5 0.125 No Hit GTAAATAGAAGGAAACTAGTGCTGACATCACAAAAATCATGTCTTTCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.2375 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4625 0.0 0.0 0.0 0.0 66-67 0.6125 0.0 0.0 0.0 0.0 68-69 0.6875 0.0 0.0 0.0 0.0 70-71 0.7625 0.0 0.0 0.0 0.0 72-73 0.925 0.0 0.0 0.0 0.0 74-75 1.225 0.0 0.0 0.0 0.0 76-77 1.35 0.0 0.0 0.0 0.0 78-79 1.625 0.0 0.0 0.0 0.0 80-81 1.975 0.0 0.0 0.0 0.0 82-83 2.35 0.0 0.0 0.0 0.0 84-85 2.775 0.0 0.0 0.0 0.0 86-87 3.4375 0.0 0.0 0.0 0.0 88-89 3.7875 0.0 0.0 0.0 0.0 90-91 4.4625 0.0 0.0 0.0 0.0 92-93 5.300000000000001 0.0 0.0 0.0 0.0 94-95 5.95 0.0 0.0 0.0 0.0 96-97 6.525 0.0 0.0 0.0 0.0 98-99 7.574999999999999 0.0 0.0 0.0 0.0 100-101 8.5375 0.0 0.0 0.0 0.0 102-103 9.425 0.0 0.0 0.0 0.0 104-105 10.337499999999999 0.0 0.0 0.0 0.0 106-107 11.4875 0.0 0.0 0.0 0.0 108-109 12.45 0.0 0.0 0.0 0.0 110-111 13.350000000000001 0.0 0.0 0.0 0.0 112-113 14.5125 0.0 0.0 0.0 0.0 114-115 15.7375 0.0 0.0 0.0 0.0 116-117 16.8125 0.0 0.0 0.0 0.0 118-119 17.7875 0.0 0.0 0.0 0.0 120-121 18.6125 0.0 0.0 0.0 0.0 122-123 19.5375 0.0 0.0 0.0 0.0 124-125 20.5625 0.0 0.0 0.0 0.0 126-127 21.575 0.0 0.0 0.0 0.0 128-129 22.425 0.0 0.0 0.0 0.0 130-131 23.137500000000003 0.0 0.0 0.0 0.0 132-133 24.225 0.0 0.0 0.0 0.0 134-135 25.1875 0.0 0.0 0.0 0.0 136-137 26.225 0.0 0.0 0.0 0.0 138-139 27.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATAAG 10 0.006830828 145.0 5 AATCTCG 55 1.1668232E-4 18.454546 135-139 TCACCAA 75 0.0012377208 13.533334 130-134 CACCTTC 85 0.0031733946 11.941176 125-129 >>END_MODULE SRR12670154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3185 37.0 37.0 37.0 37.0 37.0 2 36.16 37.0 37.0 37.0 37.0 37.0 3 36.191 37.0 37.0 37.0 37.0 37.0 4 36.231 37.0 37.0 37.0 37.0 37.0 5 36.317 37.0 37.0 37.0 37.0 37.0 6 36.35 37.0 37.0 37.0 37.0 37.0 7 36.3595 37.0 37.0 37.0 37.0 37.0 8 36.33 37.0 37.0 37.0 37.0 37.0 9 36.327 37.0 37.0 37.0 37.0 37.0 10-14 36.3498 37.0 37.0 37.0 37.0 37.0 15-19 36.2959 37.0 37.0 37.0 37.0 37.0 20-24 36.2442 37.0 37.0 37.0 37.0 37.0 25-29 36.2255 37.0 37.0 37.0 37.0 37.0 30-34 36.1058 37.0 37.0 37.0 37.0 37.0 35-39 36.0951 37.0 37.0 37.0 37.0 37.0 40-44 36.0835 37.0 37.0 37.0 37.0 37.0 45-49 36.1293 37.0 37.0 37.0 37.0 37.0 50-54 36.047399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0291 37.0 37.0 37.0 37.0 37.0 60-64 36.0346 37.0 37.0 37.0 37.0 37.0 65-69 36.0235 37.0 37.0 37.0 37.0 37.0 70-74 35.9738 37.0 37.0 37.0 37.0 37.0 75-79 35.9127 37.0 37.0 37.0 37.0 37.0 80-84 35.8971 37.0 37.0 37.0 37.0 37.0 85-89 35.9255 37.0 37.0 37.0 37.0 37.0 90-94 35.974900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.932100000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8502 37.0 37.0 37.0 37.0 37.0 105-109 35.8371 37.0 37.0 37.0 37.0 37.0 110-114 35.7768 37.0 37.0 37.0 37.0 37.0 115-119 35.8061 37.0 37.0 37.0 37.0 37.0 120-124 35.6824 37.0 37.0 37.0 37.0 37.0 125-129 35.528200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.2714 37.0 37.0 37.0 32.2 37.0 135-139 35.3095 37.0 37.0 37.0 37.0 37.0 140-144 35.0356 37.0 37.0 37.0 27.4 37.0 145-149 34.726 37.0 37.0 37.0 25.0 37.0 150-151 34.19425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 4.0 14 5.0 15 5.0 16 0.0 17 2.0 18 0.0 19 3.0 20 2.0 21 2.0 22 6.0 23 3.0 24 6.0 25 5.0 26 9.0 27 15.0 28 13.0 29 21.0 30 20.0 31 23.0 32 55.0 33 106.0 34 196.0 35 560.0 36 2587.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.575 22.400000000000002 8.15 22.875 2 27.975 23.325000000000003 29.849999999999998 18.85 3 20.424999999999997 27.650000000000002 31.775 20.150000000000002 4 24.15 34.8 21.8 19.25 5 25.0 37.4 20.825 16.775000000000002 6 23.225 38.7 20.3 17.775 7 21.3 22.35 34.849999999999994 21.5 8 21.975 26.900000000000002 27.1 24.025 9 23.875 24.125 27.375 24.625 10-14 23.985 28.799999999999997 25.575 21.64 15-19 23.155 27.83 27.445000000000004 21.57 20-24 24.18 27.439999999999998 27.6 20.78 25-29 24.27 27.93 26.6 21.2 30-34 23.665 28.015 26.655 21.665 35-39 23.72 27.965 26.945000000000004 21.37 40-44 23.68 27.994999999999997 26.884999999999998 21.44 45-49 24.060000000000002 27.224999999999998 26.889999999999997 21.825 50-54 24.345 27.97 26.985 20.7 55-59 23.745 28.07 26.855 21.33 60-64 23.905 27.57 27.169999999999998 21.355 65-69 23.62 27.500000000000004 27.145000000000003 21.735 70-74 24.779999999999998 27.705000000000002 26.36 21.154999999999998 75-79 23.925 27.145000000000003 26.810000000000002 22.12 80-84 24.455 27.839999999999996 26.534999999999997 21.17 85-89 25.0 26.99 27.08 20.93 90-94 25.525 26.935 26.52 21.02 95-99 25.779999999999998 27.735 25.509999999999998 20.974999999999998 100-104 25.795 27.965 25.395 20.845 105-109 26.32 27.675 26.090000000000003 19.915 110-114 26.06 27.96 24.955 21.025 115-119 27.115000000000002 27.875 24.915000000000003 20.095 120-124 27.310000000000002 27.794999999999998 25.215 19.68 125-129 27.279999999999998 26.974999999999998 25.89 19.855 130-134 27.400000000000002 27.29 25.415 19.895 135-139 27.860000000000003 26.450000000000003 25.86 19.830000000000002 140-144 27.800000000000004 26.705000000000002 25.669999999999998 19.825 145-149 28.675 26.545 25.415 19.365 150-151 29.8875 25.5 24.8 19.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.5 12 1.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 0.5 28 2.5 29 2.5 30 4.5 31 9.0 32 15.5 33 22.0 34 30.5 35 55.0 36 73.0 37 81.5 38 109.0 39 155.5 40 177.5 41 188.0 42 207.5 43 262.5 44 299.5 45 267.0 46 244.0 47 249.0 48 255.5 49 226.0 50 179.5 51 155.5 52 133.5 53 110.5 54 98.5 55 80.5 56 69.5 57 60.5 58 39.5 59 27.0 60 22.0 61 13.5 62 11.0 63 8.5 64 3.0 65 1.5 66 1.5 67 1.5 68 1.0 69 1.5 70 2.0 71 1.0 72 0.0 73 1.0 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.5 85 0.5 86 1.5 87 1.5 88 0.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.5 96 1.0 97 1.0 98 1.0 99 3.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.25 #Duplication Level Percentage of deduplicated Percentage of total 1 83.46504559270517 68.65 2 12.887537993920972 21.2 3 2.735562310030395 6.75 4 0.60790273556231 2.0 5 0.182370820668693 0.75 6 0.0911854103343465 0.44999999999999996 7 0.0 0.0 8 0.030395136778115502 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATATTACCGAACAGATTTATACCGACGACATTTGGATGAGGTACCT 8 0.2 No Hit CATCACCAAGCTCCCTCTTTCGATCAGAATTTCTAGCTCTCTCTCTCTCA 6 0.15 No Hit CTACACAGCTATCTTGTTTCACAGGATGTGGATGGGGTTAAGGTTGATGT 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GTTCTGTATGAGTTTGTGTACAATAGACATCCTTCAGGAGTTCCTATATC 5 0.125 No Hit ACAAGTATTCCTGCTGATGATGGAGTGCCTGACATGAGTAAGAGGGAGCT 5 0.125 No Hit AGCAGACTCAAGAATGAGGGCAGCTTCTAAAAGGCGTGGGATTGAGATAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit CATCAACAGCCGCTATCAAAGCATGCACTCCAACAGGCTCAGGCTCAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.2375 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.4625 0.0 0.0 0.0 0.0 66-67 0.6125 0.0 0.0 0.0 0.0 68-69 0.6875 0.0 0.0 0.0 0.0 70-71 0.7625 0.0 0.0 0.0 0.0 72-73 0.925 0.0 0.0 0.0 0.0 74-75 1.225 0.0 0.0 0.0 0.0 76-77 1.35 0.0 0.0 0.0 0.0 78-79 1.625 0.0 0.0 0.0 0.0 80-81 1.975 0.0 0.0 0.0 0.0 82-83 2.35 0.0 0.0 0.0 0.0 84-85 2.775 0.0 0.0 0.0 0.0 86-87 3.425 0.0 0.0 0.0 0.0 88-89 3.7625 0.0 0.0 0.0 0.0 90-91 4.4375 0.0 0.0 0.0 0.0 92-93 5.275 0.0 0.0 0.0 0.0 94-95 5.95 0.0 0.0 0.0 0.0 96-97 6.55 0.0 0.0 0.0 0.0 98-99 7.6 0.0 0.0 0.0 0.0 100-101 8.5625 0.0 0.0 0.0 0.0 102-103 9.45 0.0 0.0 0.0 0.0 104-105 10.35 0.0 0.0 0.0 0.0 106-107 11.5125 0.0 0.0 0.0 0.0 108-109 12.4875 0.0 0.0 0.0 0.0 110-111 13.425 0.0 0.0 0.0 0.0 112-113 14.537500000000001 0.0 0.0 0.0 0.0 114-115 15.7625 0.0 0.0 0.0 0.0 116-117 16.825000000000003 0.0 0.0 0.0 0.0 118-119 17.7875 0.0 0.0 0.0 0.0 120-121 18.6125 0.0 0.0 0.0 0.0 122-123 19.5375 0.0 0.0 0.0 0.0 124-125 20.6 0.0 0.0 0.0 0.0 126-127 21.6625 0.0 0.0 0.0 0.0 128-129 22.525 0.0 0.0 0.0 0.0 130-131 23.262500000000003 0.0 0.0 0.0 0.0 132-133 24.3625 0.0 0.0 0.0 0.0 134-135 25.35 0.0 0.0 0.0 0.0 136-137 26.4625 0.0 0.0 0.0 0.0 138-139 27.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGA 55 0.0025160722 15.818182 135-139 CACCAGT 70 7.343502E-4 14.5 130-134 AGTGTAG 65 0.0076375785 13.384615 135-139 >>END_MODULE Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546597 spots for SRR12670154.sra Written 546597 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra Read 546579 spots for SRR12670154.sra Written 546579 spots for SRR12670154.sra SRR ids: ['SRR12670154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ug4ws3az SRR12670154.sra spots: 10931598 blocks: [[1, 546579], [546580, 1093158], [1093159, 1639737], [1639738, 2186316], [2186317, 2732895], [2732896, 3279474], [3279475, 3826053], [3826054, 4372632], [4372633, 4919211], [4919212, 5465790], [5465791, 6012369], [6012370, 6558948], [6558949, 7105527], [7105528, 7652106], [7652107, 8198685], [8198686, 8745264], [8745265, 9291843], [9291844, 9838422], [9838423, 10385001], [10385002, 10931598]] SRR12670154 file size 3693334 SRR12670154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670154 SRR12670154_1.fastq SRR12670154_2.fastq Input file: SRR12670154_1.fastq Paired file: SRR12670154_2.fastq trimmed: SRR12670154-trimmed-pair1.fastq, SRR12670154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 06:11:10 2025 >> started Tue Feb 11 06:14:15 2025 >> done (185.753s) 10931598 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 30875 ( 0.28%) empty read pairs filtered out after trimming by size control 10900594 (99.72%) read pairs available; of these: 3502451 (32.13%) trimmed read pairs available after processing 7398143 (67.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 23 0.00% 20 32 0.00% 21 44 0.00% 22 52 0.00% 23 93 0.00% 24 123 0.00% 25 128 0.00% 26 175 0.00% 27 165 0.00% 28 152 0.00% 29 177 0.00% 30 216 0.00% 31 201 0.00% 32 186 0.00% 33 201 0.00% 34 206 0.00% 35 201 0.00% 36 267 0.00% 37 287 0.00% 38 277 0.00% 39 323 0.00% 40 361 0.00% 41 394 0.00% 42 354 0.00% 43 447 0.00% 44 462 0.00% 45 492 0.00% 46 537 0.00% 47 699 0.01% 48 724 0.01% 49 824 0.01% 50 937 0.01% 51 1037 0.01% 52 1154 0.01% 53 1216 0.01% 54 1311 0.01% 55 1369 0.01% 56 1632 0.01% 57 1846 0.02% 58 2173 0.02% 59 2460 0.02% 60 2839 0.03% 61 3354 0.03% 62 3652 0.03% 63 3922 0.04% 64 4252 0.04% 65 4420 0.04% 66 4819 0.04% 67 5384 0.05% 68 5952 0.05% 69 6772 0.06% 70 7891 0.07% 71 8691 0.08% 72 9977 0.09% 73 11165 0.10% 74 12023 0.11% 75 12665 0.12% 76 13263 0.12% 77 14090 0.13% 78 15279 0.14% 79 16489 0.15% 80 18115 0.17% 81 20419 0.19% 82 22712 0.21% 83 24008 0.22% 84 25339 0.23% 85 26822 0.25% 86 27910 0.26% 87 28118 0.26% 88 29414 0.27% 89 30270 0.28% 90 32620 0.30% 91 34276 0.31% 92 36027 0.33% 93 38436 0.35% 94 40036 0.37% 95 41512 0.38% 96 41899 0.38% 97 41821 0.38% 98 42204 0.39% 99 42172 0.39% 100 43796 0.40% 101 44357 0.41% 102 46099 0.42% 103 48252 0.44% 104 49885 0.46% 105 50069 0.46% 106 50586 0.46% 107 49220 0.45% 108 49075 0.45% 109 48561 0.45% 110 49151 0.45% 111 50123 0.46% 112 50845 0.47% 113 52388 0.48% 114 53360 0.49% 115 53520 0.49% 116 54300 0.50% 117 53809 0.49% 118 52790 0.48% 119 52619 0.48% 120 52478 0.48% 121 53111 0.49% 122 53899 0.49% 123 54235 0.50% 124 55896 0.51% 125 55149 0.51% 126 56019 0.51% 127 55144 0.51% 128 53953 0.49% 129 53983 0.50% 130 53890 0.49% 131 52609 0.48% 132 52853 0.48% 133 53789 0.49% 134 54386 0.50% 135 54959 0.50% 136 54375 0.50% 137 54277 0.50% 138 53815 0.49% 139 53847 0.49% 140 52216 0.48% 141 51872 0.48% 142 52369 0.48% 143 52371 0.48% 144 53758 0.49% 145 54166 0.50% 146 53795 0.49% 147 53010 0.49% 148 53292 0.49% 149 52836 0.48% 150 52288 0.48% 151 7398143 67.87% 10900594 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=41.20 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=1.10 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=40.75 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670154 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 06:37:35 Started mapping on | Feb 11 06:38:16 Finished on | Feb 11 07:21:58 Mapping speed, Million of reads per hour | 14.97 Number of input reads | 10900594 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 10069477 Uniquely mapped reads % | 92.38% Average mapped length | 277.96 Number of splices: Total | 9393195 Number of splices: Annotated (sjdb) | 9206016 Number of splices: GT/AG | 9185524 Number of splices: GC/AG | 169556 Number of splices: AT/AC | 6097 Number of splices: Non-canonical | 32018 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249858 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 144827 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581259 581259 581259 N_multimapping 249858 249858 249858 N_noFeature 305974 9887921 378222 N_ambiguous 164460 674 54727 UnstrandedReadsAssigned:9599043 PositiveStrandReadsAssigned:180882 NegativeStrandReadsAssigned:9636528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=126 echo kmer=121 SRR12670154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670154-trimmed-pair1.fastq SRR12670154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,900,594 reads, 9,766,383 reads pseudoaligned [quant] estimated average fragment length: 192.167 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR12670154.ke.tsv 34699 SRR12670154.se.tsv 87100 total ==> SRR12670154.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1826.83 278 13.9607 Potri.005G024800.1.v4.1 1035 843.833 122 13.2637 Potri.004G059700.1.v4.1 961 769.875 7 0.834142 Potri.007G009000.2.v4.1 1416 1224.83 0 0 Potri.003G141000.2.v4.1 2943 2751.83 496.083 16.5385 Potri.016G087400.1.v4.1 270 114.412 419.238 336.165 Potri.015G069301.1.v4.1 564 377.633 0 0 Potri.010G195200.1.v4.1 1773 1581.83 18 1.04394 Potri.012G127500.1.v4.1 977 785.849 66 7.70491 ==> SRR12670154.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 99 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12670154 completed mapping pipeline successfully