Starting /dee2/code/volunteer_pipeline.sh SRR12670155 current disk space = 3054954708992 free memory = 1465025176 SRR12670155 SRAfilesize 9a2c4ec299782aba3f8123c1e63f99cd SRR12670155.sra SRR12670155.sra file validated SRR12670155 is paired end SRR12670155 is conventional basespace SRR12670155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.597 37.0 37.0 37.0 37.0 37.0 2 36.45625 37.0 37.0 37.0 37.0 37.0 3 36.6475 37.0 37.0 37.0 37.0 37.0 4 36.7245 37.0 37.0 37.0 37.0 37.0 5 36.6405 37.0 37.0 37.0 37.0 37.0 6 36.696 37.0 37.0 37.0 37.0 37.0 7 36.607 37.0 37.0 37.0 37.0 37.0 8 36.664 37.0 37.0 37.0 37.0 37.0 9 36.609 37.0 37.0 37.0 37.0 37.0 10-14 36.6563 37.0 37.0 37.0 37.0 37.0 15-19 36.6115 37.0 37.0 37.0 37.0 37.0 20-24 36.5661 37.0 37.0 37.0 37.0 37.0 25-29 36.5385 37.0 37.0 37.0 37.0 37.0 30-34 36.558800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5071 37.0 37.0 37.0 37.0 37.0 40-44 36.498999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4455 37.0 37.0 37.0 37.0 37.0 50-54 36.4554 37.0 37.0 37.0 37.0 37.0 55-59 36.422999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4057 37.0 37.0 37.0 37.0 37.0 65-69 36.390299999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.364 37.0 37.0 37.0 37.0 37.0 75-79 36.3507 37.0 37.0 37.0 37.0 37.0 80-84 36.345000000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3033 37.0 37.0 37.0 37.0 37.0 90-94 36.291700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.270799999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.2669 37.0 37.0 37.0 37.0 37.0 105-109 36.2907 37.0 37.0 37.0 37.0 37.0 110-114 36.182199999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1726 37.0 37.0 37.0 37.0 37.0 120-124 36.064099999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0278 37.0 37.0 37.0 37.0 37.0 130-134 35.9637 37.0 37.0 37.0 37.0 37.0 135-139 35.8273 37.0 37.0 37.0 37.0 37.0 140-144 35.8032 37.0 37.0 37.0 37.0 37.0 145-149 35.7613 37.0 37.0 37.0 37.0 37.0 150-151 35.536500000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 3.0 27 8.0 28 15.0 29 13.0 30 19.0 31 26.0 32 45.0 33 61.0 34 116.0 35 305.0 36 3010.0 37 376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.375 11.200000000000001 6.675000000000001 38.75 2 18.313735301476108 12.909682261696274 36.97773329997498 31.798849136852642 3 18.775 18.25 26.6 36.375 4 22.025 25.650000000000002 24.2 28.125 5 21.625 33.425 24.925 20.025000000000002 6 21.05 33.875 25.525 19.55 7 15.275 25.85 41.925000000000004 16.950000000000003 8 18.099999999999998 24.224999999999998 32.925 24.75 9 17.95 23.400000000000002 35.05 23.599999999999998 10-14 20.375 29.395 27.195000000000004 23.035 15-19 19.97 28.595 27.750000000000004 23.685000000000002 20-24 20.075000000000003 28.63 28.155 23.14 25-29 20.599999999999998 29.18 27.625 22.595000000000002 30-34 20.435 28.115000000000002 27.894999999999996 23.555 35-39 20.905 28.52 27.24 23.335 40-44 20.205000000000002 29.54 27.584999999999997 22.67 45-49 20.49 29.080000000000002 27.334999999999997 23.095 50-54 20.46 28.38 27.55 23.61 55-59 20.82 28.275 27.639999999999997 23.265 60-64 19.945 28.205000000000002 28.23 23.62 65-69 19.98 28.754999999999995 27.785 23.48 70-74 20.885 28.215 27.715 23.185 75-79 20.555 28.735 27.525 23.185 80-84 20.544999999999998 28.785 27.55 23.119999999999997 85-89 20.665 28.63 27.675 23.03 90-94 20.305 29.110000000000003 27.015 23.57 95-99 20.805 27.779999999999998 27.825 23.59 100-104 20.73 29.075 27.35 22.845 105-109 20.915 28.860000000000003 26.75 23.474999999999998 110-114 21.09 28.904999999999998 27.13 22.875 115-119 21.78 28.965000000000003 26.575 22.68 120-124 20.44 28.865000000000002 27.005000000000003 23.69 125-129 21.404999999999998 28.95 26.165 23.48 130-134 21.455 29.38 26.08 23.085 135-139 21.575 29.020000000000003 26.125 23.28 140-144 21.92 29.145 25.314999999999998 23.62 145-149 22.355 28.625 25.95 23.07 150-151 22.325 29.0875 24.712500000000002 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 2.0 26 4.5 27 5.0 28 6.5 29 11.0 30 19.0 31 31.5 32 38.5 33 40.0 34 50.0 35 70.0 36 95.0 37 113.0 38 136.0 39 159.5 40 178.0 41 225.0 42 241.5 43 249.5 44 270.0 45 253.0 46 254.5 47 261.0 48 237.5 49 211.5 50 187.0 51 148.0 52 112.0 53 92.5 54 70.5 55 51.5 56 44.0 57 37.0 58 24.5 59 19.5 60 20.0 61 12.0 62 5.5 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.625 #Duplication Level Percentage of deduplicated Percentage of total 1 83.66111951588502 69.125 2 12.859304084720122 21.25 3 2.6021180030257187 6.45 4 0.6051437216338881 2.0 5 0.2118003025718608 0.8750000000000001 6 0.0605143721633888 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGAAATGTGTTCAGACGAGCTTTCAGGTTAGGTGTTCGGAAACTTGCA 6 0.15 No Hit CTCCATCTCTGGCGGTCCCGCCAAAGTCGGTCCCGGAATGCTATCCATGG 6 0.15 No Hit CAGAATTTCAAAAAAAAGAAAAAAACACGAAATTGGAAACCAACCCCTGA 5 0.125 No Hit CCTTGGCCTGGAATTTGAGGCCAGCATACAGCTTCATGTAGTCATCAAAT 5 0.125 No Hit CTGCATACAGACTTAGCACTAACATGAAACTCAGGACATGCAATTAAATT 5 0.125 No Hit CCACCACCCAACTGAGCAAACAGTGCGACAAATGAAGCTCCAAATCCATA 5 0.125 No Hit ATCCGCTTTGTCAAATCCAAACCTAGACCCAAAATAGAAGGACACAGAGA 5 0.125 No Hit GCCCAGGTGACACCAGAAATCCCACCAAAGAAGAATCCTCCAGTGAACTT 5 0.125 No Hit TGTAAACTTCATAACCTTAATCTAGGAAGCAGTTCAGCTTACTTCACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.037500000000000006 0.0 0.0 0.025 0.0 62-63 0.1 0.0 0.0 0.025 0.0 64-65 0.1 0.0 0.0 0.025 0.0 66-67 0.175 0.0 0.0 0.025 0.0 68-69 0.25 0.0 0.0 0.025 0.0 70-71 0.32499999999999996 0.0 0.0 0.025 0.0 72-73 0.42500000000000004 0.0 0.0 0.025 0.0 74-75 0.5249999999999999 0.0 0.0 0.025 0.0 76-77 0.625 0.0 0.0 0.025 0.0 78-79 0.6875 0.0 0.0 0.025 0.0 80-81 0.8375 0.0 0.0 0.025 0.0 82-83 1.0125 0.0 0.0 0.025 0.0 84-85 1.2625000000000002 0.0 0.0 0.025 0.0 86-87 1.475 0.0 0.0 0.025 0.0 88-89 1.6124999999999998 0.0 0.0 0.025 0.0 90-91 1.8375 0.0 0.0 0.025 0.0 92-93 2.1125 0.0 0.0 0.025 0.0 94-95 2.325 0.0 0.0 0.025 0.0 96-97 2.55 0.0 0.0 0.025 0.0 98-99 2.825 0.0 0.0 0.025 0.0 100-101 3.3375 0.0 0.0 0.025 0.0 102-103 3.75 0.0 0.0 0.025 0.0 104-105 4.1375 0.0 0.0 0.025 0.0 106-107 4.5125 0.0 0.0 0.025 0.0 108-109 5.0 0.0 0.0 0.025 0.0 110-111 5.574999999999999 0.0 0.0 0.025 0.0 112-113 5.95 0.0 0.0 0.025 0.0 114-115 6.375 0.0 0.0 0.025 0.0 116-117 6.925 0.0 0.0 0.025 0.0 118-119 7.4625 0.0 0.0 0.025 0.0 120-121 8.05 0.0 0.0 0.025 0.0 122-123 8.6125 0.0 0.0 0.025 0.0 124-125 9.600000000000001 0.0 0.0 0.025 0.0 126-127 10.225 0.0 0.0 0.025 0.0 128-129 10.775 0.0 0.0 0.025 0.0 130-131 11.425 0.0 0.0 0.025 0.0 132-133 12.3625 0.0 0.0 0.025 0.0 134-135 13.087499999999999 0.0 0.0 0.025 0.0 136-137 13.975000000000001 0.0 0.0 0.025 0.0 138-139 14.8 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12670155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.449 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.436 37.0 37.0 37.0 37.0 37.0 4 36.308 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.397 37.0 37.0 37.0 37.0 37.0 7 36.364 37.0 37.0 37.0 37.0 37.0 8 36.4535 37.0 37.0 37.0 37.0 37.0 9 36.365 37.0 37.0 37.0 37.0 37.0 10-14 36.4332 37.0 37.0 37.0 37.0 37.0 15-19 36.4233 37.0 37.0 37.0 37.0 37.0 20-24 36.372400000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.321099999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.285 37.0 37.0 37.0 37.0 37.0 35-39 36.279799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.232600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.25090000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1896 37.0 37.0 37.0 37.0 37.0 55-59 36.152300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1717 37.0 37.0 37.0 37.0 37.0 65-69 36.1991 37.0 37.0 37.0 37.0 37.0 70-74 36.1557 37.0 37.0 37.0 37.0 37.0 75-79 36.1183 37.0 37.0 37.0 37.0 37.0 80-84 36.05800000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0149 37.0 37.0 37.0 37.0 37.0 90-94 36.040000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.9852 37.0 37.0 37.0 37.0 37.0 100-104 35.8882 37.0 37.0 37.0 37.0 37.0 105-109 35.8525 37.0 37.0 37.0 37.0 37.0 110-114 35.862 37.0 37.0 37.0 37.0 37.0 115-119 35.84499999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.719100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6709 37.0 37.0 37.0 37.0 37.0 130-134 35.547399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4186 37.0 37.0 37.0 37.0 37.0 140-144 35.3374 37.0 37.0 37.0 37.0 37.0 145-149 35.113600000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.874624999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 3.0 15 2.0 16 4.0 17 1.0 18 0.0 19 1.0 20 4.0 21 1.0 22 5.0 23 8.0 24 4.0 25 6.0 26 7.0 27 7.0 28 5.0 29 23.0 30 16.0 31 36.0 32 54.0 33 77.0 34 174.0 35 444.0 36 2816.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 20.45 11.799999999999999 27.750000000000004 2 26.85 26.05 31.35 15.75 3 19.675 29.625 31.674999999999997 19.025 4 22.575 34.725 24.25 18.45 5 23.75 37.075 22.175 17.0 6 21.725 37.0 22.725 18.55 7 18.575 24.05 38.125 19.25 8 20.974999999999998 24.975 27.450000000000003 26.6 9 21.175 25.025 31.724999999999998 22.075 10-14 23.69 28.1 26.695 21.515 15-19 22.634999999999998 27.76 28.110000000000003 21.495 20-24 22.805 28.105000000000004 28.055000000000003 21.035 25-29 22.445 28.255000000000003 28.54 20.76 30-34 22.855 28.134999999999998 27.955000000000002 21.055 35-39 22.485 28.499999999999996 28.32 20.695 40-44 22.35 28.095 28.68 20.875 45-49 22.495 27.089999999999996 28.89 21.525 50-54 22.57 27.88 28.605000000000004 20.945 55-59 23.0 27.384999999999998 28.544999999999998 21.07 60-64 22.900000000000002 27.295 28.84 20.965 65-69 23.325000000000003 27.650000000000002 28.1 20.925 70-74 22.795 28.205000000000002 28.060000000000002 20.94 75-79 23.25 26.995 28.58 21.175 80-84 23.635 28.000000000000004 27.71 20.655 85-89 23.419999999999998 27.925 28.299999999999997 20.355 90-94 23.27 27.939999999999998 27.845 20.945 95-99 24.025 27.915 27.26 20.8 100-104 24.175 27.994999999999997 27.62 20.21 105-109 24.2 28.07 27.435 20.294999999999998 110-114 24.610000000000003 27.689999999999998 27.36 20.34 115-119 24.585 28.439999999999998 26.965 20.01 120-124 25.575 27.810000000000002 27.52 19.095000000000002 125-129 25.474999999999998 28.27 26.314999999999998 19.939999999999998 130-134 26.005 28.07 26.400000000000002 19.525000000000002 135-139 26.47 28.235 26.06 19.235 140-144 27.005000000000003 27.815 26.045 19.134999999999998 145-149 27.927792779277926 28.5028502850285 25.402540254025403 18.166816681668166 150-151 29.203650456307038 28.178522315289413 24.79059882485311 17.827228403550443 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 3.5 18 2.5 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 1.5 25 0.5 26 2.5 27 4.5 28 5.0 29 9.5 30 15.0 31 25.0 32 43.5 33 53.5 34 59.5 35 67.5 36 98.5 37 114.5 38 126.0 39 161.0 40 199.5 41 237.0 42 240.0 43 251.5 44 271.0 45 272.0 46 268.5 47 256.0 48 226.5 49 193.5 50 154.0 51 121.0 52 101.0 53 81.5 54 74.5 55 68.0 56 48.0 57 33.5 58 31.0 59 18.0 60 9.0 61 10.5 62 6.0 63 2.0 64 1.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 1.0 78 0.5 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.675 #Duplication Level Percentage of deduplicated Percentage of total 1 83.79195645600241 69.27499999999999 2 12.670093740550348 20.95 3 2.691260961596613 6.675000000000001 4 0.6047777441790142 2.0 5 0.15119443604475355 0.625 6 0.06047777441790142 0.3 7 0.03023888720895071 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit ATTCCTTAGGAGGCCACTTGCTATTGTCGCTGCTCTTTTAACAGCACTTT 6 0.15 No Hit AGTAACAGAGGAAGTTCTGTACAAGAAAACCACCATCAACAGCAACAGCC 6 0.15 No Hit CAAGAATCTTCTGGCCTTGGAAGGTCAACATCTGCATATATCACTGTCGC 5 0.125 No Hit CTGAAGCCATTCTCCGAAACAACATAATATATGGCTCCTAATCTTTCCCA 5 0.125 No Hit GCAGCGTGAAACACTAGCAAATTTTGTGCTGGATTACAGTAATTTTTGCT 5 0.125 No Hit GGGGTACCTCAAAAGGGCTTTCTATGGATCAAACGGTAGTCCAACCTTTG 5 0.125 No Hit GGTGCCTCCTGAGCTTCCAGAGCCTGCTTTAGGTATCAACTTTGCCAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.42500000000000004 0.0 0.0 0.0 0.0 74-75 0.5249999999999999 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.8375 0.0 0.0 0.0 0.0 82-83 1.0125 0.0 0.0 0.0 0.0 84-85 1.2625000000000002 0.0 0.0 0.0 0.0 86-87 1.4875 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 90-91 1.875 0.0 0.0 0.0 0.0 92-93 2.1625 0.0 0.0 0.0 0.0 94-95 2.375 0.0 0.0 0.0 0.0 96-97 2.625 0.0 0.0 0.0 0.0 98-99 2.9 0.0 0.0 0.0 0.0 100-101 3.4125 0.0 0.0 0.0 0.0 102-103 3.8375 0.0 0.0 0.0 0.0 104-105 4.25 0.0 0.0 0.0 0.0 106-107 4.6875 0.0 0.0 0.0 0.0 108-109 5.175 0.0 0.0 0.0 0.0 110-111 5.75 0.0 0.0 0.0 0.0 112-113 6.125 0.0 0.0 0.0 0.0 114-115 6.55 0.0 0.0 0.0 0.0 116-117 7.1 0.0 0.0 0.0 0.0 118-119 7.625 0.0 0.0 0.0 0.0 120-121 8.1875 0.0 0.0 0.0 0.0 122-123 8.7 0.0 0.0 0.0 0.0 124-125 9.6125 0.0 0.0 0.0 0.0 126-127 10.275 0.0 0.0 0.0 0.0 128-129 10.8125 0.0 0.0 0.0 0.0 130-131 11.45 0.0 0.0 0.0 0.0 132-133 12.375 0.0 0.0 0.0 0.0 134-135 13.125 0.0 0.0 0.0 0.0 136-137 14.0375 0.0 0.0 0.0 0.0 138-139 14.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGTC 10 0.006830828 145.0 3 GTAGTCT 10 0.006830828 145.0 4 >>END_MODULE Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra Read 549210 spots for SRR12670155.sra Written 549210 spots for SRR12670155.sra SRR ids: ['SRR12670155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__66r4o1y SRR12670155.sra spots: 10984200 blocks: [[1, 549210], [549211, 1098420], [1098421, 1647630], [1647631, 2196840], [2196841, 2746050], [2746051, 3295260], [3295261, 3844470], [3844471, 4393680], [4393681, 4942890], [4942891, 5492100], [5492101, 6041310], [6041311, 6590520], [6590521, 7139730], [7139731, 7688940], [7688941, 8238150], [8238151, 8787360], [8787361, 9336570], [9336571, 9885780], [9885781, 10434990], [10434991, 10984200]] SRR12670155 file size 3711211 SRR12670155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670155 SRR12670155_1.fastq SRR12670155_2.fastq Input file: SRR12670155_1.fastq Paired file: SRR12670155_2.fastq trimmed: SRR12670155-trimmed-pair1.fastq, SRR12670155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 06:34:24 2025 >> started Tue Feb 11 06:41:36 2025 >> done (431.335s) 10984200 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 4148 ( 0.04%) empty read pairs filtered out after trimming by size control 10979981 (99.96%) read pairs available; of these: 2058881 (18.75%) trimmed read pairs available after processing 8921100 (81.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 13 0.00% 21 16 0.00% 22 19 0.00% 23 28 0.00% 24 44 0.00% 25 32 0.00% 26 47 0.00% 27 50 0.00% 28 68 0.00% 29 53 0.00% 30 81 0.00% 31 69 0.00% 32 86 0.00% 33 75 0.00% 34 69 0.00% 35 101 0.00% 36 106 0.00% 37 102 0.00% 38 109 0.00% 39 138 0.00% 40 154 0.00% 41 174 0.00% 42 152 0.00% 43 179 0.00% 44 214 0.00% 45 184 0.00% 46 215 0.00% 47 232 0.00% 48 276 0.00% 49 291 0.00% 50 410 0.00% 51 365 0.00% 52 472 0.00% 53 462 0.00% 54 453 0.00% 55 533 0.00% 56 558 0.01% 57 625 0.01% 58 750 0.01% 59 906 0.01% 60 998 0.01% 61 1107 0.01% 62 1360 0.01% 63 1407 0.01% 64 1451 0.01% 65 1595 0.01% 66 1708 0.02% 67 1959 0.02% 68 1978 0.02% 69 2392 0.02% 70 2688 0.02% 71 3235 0.03% 72 3679 0.03% 73 3961 0.04% 74 4244 0.04% 75 4502 0.04% 76 4823 0.04% 77 5266 0.05% 78 5700 0.05% 79 6106 0.06% 80 6732 0.06% 81 7715 0.07% 82 8833 0.08% 83 9349 0.09% 84 10071 0.09% 85 10576 0.10% 86 10941 0.10% 87 11397 0.10% 88 11690 0.11% 89 12541 0.11% 90 13304 0.12% 91 14367 0.13% 92 15198 0.14% 93 16388 0.15% 94 17687 0.16% 95 17993 0.16% 96 18782 0.17% 97 18700 0.17% 98 19013 0.17% 99 19452 0.18% 100 20330 0.19% 101 20783 0.19% 102 22856 0.21% 103 23624 0.22% 104 23807 0.22% 105 24820 0.23% 106 24992 0.23% 107 25450 0.23% 108 25596 0.23% 109 25281 0.23% 110 25754 0.23% 111 26719 0.24% 112 27943 0.25% 113 28593 0.26% 114 29377 0.27% 115 30316 0.28% 116 30625 0.28% 117 31032 0.28% 118 31094 0.28% 119 30317 0.28% 120 31352 0.29% 121 31854 0.29% 122 32468 0.30% 123 33747 0.31% 124 34400 0.31% 125 35235 0.32% 126 36075 0.33% 127 35610 0.32% 128 35723 0.33% 129 35548 0.32% 130 35731 0.33% 131 36335 0.33% 132 36705 0.33% 133 37635 0.34% 134 38294 0.35% 135 39339 0.36% 136 39501 0.36% 137 39637 0.36% 138 40021 0.36% 139 39998 0.36% 140 39906 0.36% 141 40066 0.36% 142 40798 0.37% 143 41057 0.37% 144 42326 0.39% 145 42741 0.39% 146 43381 0.40% 147 43805 0.40% 148 43881 0.40% 149 43319 0.39% 150 43279 0.39% 151 8921100 81.25% 10979981 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=391.46 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=17.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.55 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=37.27 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=13.5 sequence=AAAGAAAAGAAAA SRR12670155 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 06:59:20 Started mapping on | Feb 11 06:59:29 Finished on | Feb 11 07:32:17 Mapping speed, Million of reads per hour | 20.09 Number of input reads | 10979981 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10279024 Uniquely mapped reads % | 93.62% Average mapped length | 289.28 Number of splices: Total | 10140770 Number of splices: Annotated (sjdb) | 9898812 Number of splices: GT/AG | 9933567 Number of splices: GC/AG | 166391 Number of splices: AT/AC | 6511 Number of splices: Non-canonical | 34301 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234195 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 12683 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466762 466762 466762 N_multimapping 234195 234195 234195 N_noFeature 394908 10150848 447614 N_ambiguous 132597 578 56807 UnstrandedReadsAssigned:9751519 PositiveStrandReadsAssigned:127598 NegativeStrandReadsAssigned:9774603 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670155-trimmed-pair1.fastq SRR12670155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,979,981 reads, 9,780,302 reads pseudoaligned [quant] estimated average fragment length: 223.75 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR12670155.ke.tsv 34699 SRR12670155.se.tsv 87100 total ==> SRR12670155.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.25 315 18.9848 Potri.005G024800.1.v4.1 1035 812.25 206 27.4408 Potri.004G059700.1.v4.1 961 738.332 0 0 Potri.007G009000.2.v4.1 1416 1193.25 0 0 Potri.003G141000.2.v4.1 2943 2720.25 535.465 21.2981 Potri.016G087400.1.v4.1 270 97.4439 472 524.091 Potri.015G069301.1.v4.1 564 348.617 0 0 Potri.010G195200.1.v4.1 1773 1550.25 51 3.55949 Potri.012G127500.1.v4.1 977 754.309 37 5.30728 ==> SRR12670155.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 114 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12670155 completed mapping pipeline successfully