Starting /dee2/code/volunteer_pipeline.sh SRR12670156 current disk space = 3055017463808 free memory = 1219552376 SRR12670156 SRAfilesize 0b5fcab6ebc0150f4f27ba4146e7b1a6 SRR12670156.sra SRR12670156.sra file validated SRR12670156 is paired end SRR12670156 is conventional basespace SRR12670156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.597 37.0 37.0 37.0 37.0 37.0 2 36.4265 37.0 37.0 37.0 37.0 37.0 3 36.619 37.0 37.0 37.0 37.0 37.0 4 36.724 37.0 37.0 37.0 37.0 37.0 5 36.633 37.0 37.0 37.0 37.0 37.0 6 36.7045 37.0 37.0 37.0 37.0 37.0 7 36.6105 37.0 37.0 37.0 37.0 37.0 8 36.631 37.0 37.0 37.0 37.0 37.0 9 36.673 37.0 37.0 37.0 37.0 37.0 10-14 36.632 37.0 37.0 37.0 37.0 37.0 15-19 36.5774 37.0 37.0 37.0 37.0 37.0 20-24 36.5524 37.0 37.0 37.0 37.0 37.0 25-29 36.5046 37.0 37.0 37.0 37.0 37.0 30-34 36.5018 37.0 37.0 37.0 37.0 37.0 35-39 36.5222 37.0 37.0 37.0 37.0 37.0 40-44 36.4697 37.0 37.0 37.0 37.0 37.0 45-49 36.501400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4582 37.0 37.0 37.0 37.0 37.0 55-59 36.369899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3585 37.0 37.0 37.0 37.0 37.0 65-69 36.3324 37.0 37.0 37.0 37.0 37.0 70-74 36.2885 37.0 37.0 37.0 37.0 37.0 75-79 36.2852 37.0 37.0 37.0 37.0 37.0 80-84 36.26989999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.238099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2493 37.0 37.0 37.0 37.0 37.0 95-99 36.1749 37.0 37.0 37.0 37.0 37.0 100-104 36.1471 37.0 37.0 37.0 37.0 37.0 105-109 36.14059999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.1141 37.0 37.0 37.0 37.0 37.0 115-119 36.0708 37.0 37.0 37.0 37.0 37.0 120-124 35.898399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.8533 37.0 37.0 37.0 37.0 37.0 130-134 35.678700000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.5674 37.0 37.0 37.0 37.0 37.0 140-144 35.2774 37.0 37.0 37.0 34.6 37.0 145-149 35.0997 37.0 37.0 37.0 29.8 37.0 150-151 34.9065 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 1.0 27 11.0 28 3.0 29 20.0 30 26.0 31 30.0 32 49.0 33 99.0 34 178.0 35 380.0 36 2893.0 37 305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.125 10.549999999999999 5.3 47.025 2 18.077115673510267 11.69253880821232 39.15873810716074 31.071607411116673 3 17.150000000000002 14.825 27.750000000000004 40.275 4 22.55 24.349999999999998 24.2 28.9 5 23.674999999999997 31.65 24.0 20.674999999999997 6 21.025 35.05 23.3 20.625 7 15.55 26.8 40.475 17.175 8 16.825000000000003 25.275 32.9 25.0 9 17.075000000000003 24.075 34.35 24.5 10-14 19.495 30.73 27.71 22.065 15-19 19.67 28.98 27.63 23.72 20-24 20.665 28.565 27.295 23.474999999999998 25-29 19.915 29.075 28.144999999999996 22.865 30-34 19.895 28.685 27.855 23.565 35-39 20.535 28.28 27.505000000000003 23.68 40-44 19.81 29.299999999999997 27.365000000000002 23.525 45-49 20.0 28.349999999999998 27.96 23.69 50-54 19.97 28.499999999999996 28.325 23.205000000000002 55-59 20.325 28.794999999999998 27.37 23.51 60-64 20.64 28.544999999999998 28.08 22.735 65-69 20.435 28.4 27.435 23.73 70-74 20.275000000000002 28.975 28.125 22.625 75-79 21.085 28.51 27.415 22.99 80-84 20.560000000000002 28.249999999999996 27.935 23.255 85-89 20.785 28.470000000000002 27.315 23.43 90-94 20.805 28.73 27.165 23.3 95-99 20.630000000000003 28.810000000000002 27.639999999999997 22.919999999999998 100-104 20.674999999999997 29.189999999999998 27.295 22.84 105-109 21.37 28.444999999999997 26.68 23.505000000000003 110-114 21.154999999999998 28.945 26.75 23.150000000000002 115-119 21.16 29.459999999999997 26.05 23.330000000000002 120-124 20.93 28.365000000000002 26.56 24.145 125-129 21.17 28.065 26.735 24.03 130-134 20.145 28.415000000000003 26.72 24.72 135-139 20.93 27.105 27.500000000000004 24.465 140-144 20.735 27.005000000000003 27.67 24.59 145-149 21.0 25.985000000000003 27.505000000000003 25.509999999999998 150-151 22.9375 26.6125 26.174999999999997 24.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 4.0 27 6.5 28 11.5 29 16.5 30 17.5 31 22.5 32 28.5 33 34.0 34 43.0 35 63.0 36 81.5 37 118.5 38 153.5 39 165.0 40 196.5 41 231.5 42 252.5 43 256.5 44 253.5 45 244.5 46 272.0 47 280.5 48 235.0 49 202.0 50 185.5 51 145.5 52 108.5 53 91.5 54 64.0 55 51.0 56 41.0 57 30.5 58 19.5 59 21.0 60 18.0 61 6.5 62 7.0 63 4.5 64 0.5 65 0.5 66 2.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.875 #Duplication Level Percentage of deduplicated Percentage of total 1 84.07239819004525 69.675 2 12.2473604826546 20.3 3 2.805429864253394 6.9750000000000005 4 0.7239819004524887 2.4 5 0.12066365007541478 0.5 6 0.030165912518853696 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCACTTATAAAGTTGGATAAACCGAATGTGGAAAAAGGATCTTGCCTGG 6 0.15 No Hit CAGTGATCTCCACATTAAAAAACTCTCCGAGAGGAGCAGTACTGAGAGTC 5 0.125 No Hit CCTCCACAAAAGCCTCGATTCGAAGAAGAACGAACCCGACAGCAACTCCA 5 0.125 No Hit CTCAACTATTGGAAACGTTGATGGCTCGCTGCAACTCCCATTTCCTCTGT 5 0.125 No Hit GTCGAGTTTAACAGTGTACATCCCATTTTCTAGACAATATCCATAATAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5375 0.0 0.0 0.0 0.0 76-77 0.825 0.0 0.0 0.0 0.0 78-79 1.0875 0.0 0.0 0.0 0.0 80-81 1.3375 0.0 0.0 0.0 0.0 82-83 1.6 0.0 0.0 0.0 0.0 84-85 1.95 0.0 0.0 0.0 0.0 86-87 2.325 0.0 0.0 0.0 0.0 88-89 2.7625 0.0 0.0 0.0 0.0 90-91 3.2375 0.0 0.0 0.0 0.0 92-93 3.7125000000000004 0.0 0.0 0.0 0.0 94-95 4.25 0.0 0.0 0.0 0.0 96-97 5.0625 0.0 0.0 0.0 0.0 98-99 5.675 0.0 0.0 0.0 0.0 100-101 6.35 0.0 0.0 0.0 0.0 102-103 7.1875 0.0 0.0 0.0 0.0 104-105 8.2125 0.0 0.0 0.0 0.0 106-107 9.275 0.0 0.0 0.0 0.0 108-109 10.45 0.0 0.0 0.0 0.0 110-111 11.7 0.0 0.0 0.0 0.0 112-113 12.774999999999999 0.0 0.0 0.0 0.0 114-115 13.6625 0.0 0.0 0.0 0.0 116-117 14.8 0.0 0.0 0.0 0.0 118-119 15.8625 0.0 0.0 0.0 0.0 120-121 16.825 0.0 0.0 0.0 0.0 122-123 17.7875 0.0 0.0 0.0 0.0 124-125 18.875 0.0 0.0 0.0 0.0 126-127 19.7125 0.0 0.0 0.0 0.0 128-129 20.700000000000003 0.0 0.0 0.0 0.0 130-131 21.7625 0.0 0.0 0.0 0.0 132-133 22.85 0.0 0.0 0.0 0.0 134-135 23.9 0.0 0.0 0.0 0.0 136-137 24.8125 0.0 0.0 0.0 0.0 138-139 25.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCATA 10 0.006830828 145.0 5 GAATGTC 10 0.006830828 145.0 4 CTGAATG 10 0.006830828 145.0 2 TCTGATT 10 0.006830828 145.0 9 ATGTCTG 10 0.006830828 145.0 6 GCTGAAT 10 0.006830828 145.0 1 AGTCTTG 10 0.006830828 145.0 145 >>END_MODULE SRR12670156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.358 37.0 37.0 37.0 37.0 37.0 2 36.2645 37.0 37.0 37.0 37.0 37.0 3 36.381 37.0 37.0 37.0 37.0 37.0 4 36.2875 37.0 37.0 37.0 37.0 37.0 5 36.3565 37.0 37.0 37.0 37.0 37.0 6 36.284 37.0 37.0 37.0 37.0 37.0 7 36.3775 37.0 37.0 37.0 37.0 37.0 8 36.41 37.0 37.0 37.0 37.0 37.0 9 36.4415 37.0 37.0 37.0 37.0 37.0 10-14 36.3584 37.0 37.0 37.0 37.0 37.0 15-19 36.3784 37.0 37.0 37.0 37.0 37.0 20-24 36.3098 37.0 37.0 37.0 37.0 37.0 25-29 36.3107 37.0 37.0 37.0 37.0 37.0 30-34 36.2294 37.0 37.0 37.0 37.0 37.0 35-39 36.231399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1599 37.0 37.0 37.0 37.0 37.0 45-49 36.216499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1308 37.0 37.0 37.0 37.0 37.0 55-59 36.0921 37.0 37.0 37.0 37.0 37.0 60-64 36.1193 37.0 37.0 37.0 37.0 37.0 65-69 36.087900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0254 37.0 37.0 37.0 37.0 37.0 75-79 36.010400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9443 37.0 37.0 37.0 37.0 37.0 85-89 35.893100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9338 37.0 37.0 37.0 37.0 37.0 95-99 35.89790000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.841499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7987 37.0 37.0 37.0 37.0 37.0 110-114 35.750800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7543 37.0 37.0 37.0 37.0 37.0 120-124 35.6411 37.0 37.0 37.0 37.0 37.0 125-129 35.52569999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3783 37.0 37.0 37.0 34.6 37.0 135-139 35.254900000000006 37.0 37.0 37.0 34.6 37.0 140-144 35.0828 37.0 37.0 37.0 27.4 37.0 145-149 34.6582 37.0 37.0 37.0 25.0 37.0 150-151 34.162625000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 0.0 19 0.0 20 1.0 21 0.0 22 8.0 23 6.0 24 7.0 25 2.0 26 8.0 27 11.0 28 10.0 29 22.0 30 27.0 31 41.0 32 76.0 33 96.0 34 207.0 35 578.0 36 2598.0 37 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 21.95 10.2 30.175 2 25.650000000000002 26.974999999999998 32.800000000000004 14.575 3 21.4 27.375 30.85 20.375 4 22.225 35.675000000000004 23.575 18.525 5 23.474999999999998 38.275 21.6 16.650000000000002 6 20.25 40.0 22.425 17.325 7 20.45 21.8 37.574999999999996 20.175 8 21.525 24.2 29.75 24.525 9 21.275 25.775 30.375000000000004 22.575 10-14 22.365 29.86 26.840000000000003 20.935000000000002 15-19 23.400000000000002 29.435 26.63 20.535 20-24 22.509999999999998 28.615000000000002 28.12 20.755000000000003 25-29 23.119999999999997 28.194999999999997 28.310000000000002 20.375 30-34 22.085 28.73 28.625 20.560000000000002 35-39 22.33 28.599999999999998 28.105000000000004 20.965 40-44 22.485 28.63 28.22 20.665 45-49 22.025 28.485 28.384999999999998 21.105 50-54 21.925 28.689999999999998 28.754999999999995 20.630000000000003 55-59 22.365 27.615000000000002 28.825 21.195 60-64 22.994999999999997 28.349999999999998 27.98 20.674999999999997 65-69 22.830000000000002 28.02 28.525 20.625 70-74 23.075000000000003 28.355000000000004 27.705000000000002 20.865000000000002 75-79 22.830000000000002 27.865000000000002 28.139999999999997 21.165 80-84 23.150000000000002 28.804999999999996 27.295 20.75 85-89 23.615 27.765 28.505000000000003 20.115 90-94 23.685000000000002 27.389999999999997 28.08 20.845 95-99 24.14 28.505000000000003 27.51 19.845 100-104 24.325 28.605000000000004 27.034999999999997 20.035 105-109 25.165 28.444999999999997 27.155 19.235 110-114 25.345000000000002 27.894999999999996 26.985 19.775000000000002 115-119 25.755 28.29 26.669999999999998 19.285 120-124 25.885 28.025 27.305 18.785 125-129 26.490000000000002 28.215 26.669999999999998 18.625 130-134 26.895000000000003 27.834999999999997 26.634999999999998 18.634999999999998 135-139 27.565 26.66 27.245 18.529999999999998 140-144 27.544999999999998 26.68 27.150000000000002 18.625 145-149 27.892789278927893 25.82258225822582 27.42774277427743 18.856885688568855 150-151 29.703712964120516 25.55319414926866 27.403425428178522 17.339667458432302 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.0 25 3.0 26 4.5 27 8.5 28 11.0 29 13.0 30 17.0 31 24.0 32 35.5 33 43.0 34 60.5 35 74.5 36 93.0 37 113.5 38 127.5 39 176.0 40 232.0 41 250.5 42 274.0 43 275.5 44 264.0 45 258.0 46 238.0 47 231.5 48 225.0 49 205.5 50 173.5 51 134.5 52 103.5 53 85.0 54 62.0 55 43.5 56 33.5 57 29.0 58 17.5 59 9.0 60 8.5 61 8.5 62 6.0 63 4.0 64 2.0 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 84.12938331318017 69.575 2 12.15235792019347 20.1 3 2.720677146311971 6.75 4 0.7859733978234582 2.6 5 0.12091898428053204 0.5 6 0.06045949214026602 0.3 7 0.03022974607013301 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CCACAGCTTCAAGCTGCATTCCCCCCAATGAAGAAATTGAGATATCCAAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit ACCTTCCATACCAATTTCGAGGAGATGGATGCATACAAAGGAAGAGGTCA 5 0.125 No Hit ACTAGACAGACACCATAAAAAACAAGGTTTTGTGTCAATGGCAACAACCT 5 0.125 No Hit CCGGATGAAACCAATGGGAGTATCTTGTATGAAGGTGACGACAGCATTAA 5 0.125 No Hit CTGATAAAACCTCTGCTGTTGCCAAGCTTCAGTCTCTTATTTCTCTTACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5375 0.0 0.0 0.0 0.0 76-77 0.825 0.0 0.0 0.0 0.0 78-79 1.0875 0.0 0.0 0.0 0.0 80-81 1.3375 0.0 0.0 0.0 0.0 82-83 1.6 0.0 0.0 0.0 0.0 84-85 1.9625 0.0 0.0 0.0 0.0 86-87 2.35 0.0 0.0 0.0 0.0 88-89 2.7874999999999996 0.0 0.0 0.0 0.0 90-91 3.2625 0.0 0.0 0.0 0.0 92-93 3.7375 0.0 0.0 0.0 0.0 94-95 4.275 0.0 0.0 0.0 0.0 96-97 5.1 0.0 0.0 0.0 0.0 98-99 5.725 0.0 0.0 0.0 0.0 100-101 6.425000000000001 0.0 0.0 0.0 0.0 102-103 7.2875 0.0 0.0 0.0 0.0 104-105 8.3375 0.0 0.0 0.0 0.0 106-107 9.4 0.0 0.0 0.0 0.0 108-109 10.575 0.0 0.0 0.0 0.0 110-111 11.825 0.0 0.0 0.0 0.0 112-113 12.899999999999999 0.0 0.0 0.0 0.0 114-115 13.7875 0.0 0.0 0.0 0.0 116-117 14.9 0.0 0.0 0.0 0.0 118-119 15.9375 0.0 0.0 0.0 0.0 120-121 16.875 0.0 0.0 0.0 0.0 122-123 17.8375 0.0 0.0 0.0 0.0 124-125 18.924999999999997 0.0 0.0 0.0 0.0 126-127 19.7875 0.0 0.0 0.0 0.0 128-129 20.762500000000003 0.0 0.0 0.0 0.0 130-131 21.85 0.0 0.0 0.0 0.0 132-133 22.925 0.0 0.0 0.0 0.0 134-135 23.987499999999997 0.0 0.0 0.0 0.0 136-137 24.9125 0.0 0.0 0.0 0.0 138-139 25.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTAG 10 0.006830828 145.0 2 AAACTAT 10 0.006830828 145.0 5 CTTAGTA 10 0.006830828 145.0 4 TAGTAGC 10 0.006830828 145.0 6 AACTATT 10 0.006830828 145.0 6 CCTTAGT 10 0.006830828 145.0 3 TTAGTAG 10 0.006830828 145.0 5 GGAAAGG 10 0.006830828 145.0 2 >>END_MODULE Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517783 spots for SRR12670156.sra Written 517783 spots for SRR12670156.sra Read 517796 spots for SRR12670156.sra Written 517796 spots for SRR12670156.sra SRR ids: ['SRR12670156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7_3r16mg SRR12670156.sra spots: 10355673 blocks: [[1, 517783], [517784, 1035566], [1035567, 1553349], [1553350, 2071132], [2071133, 2588915], [2588916, 3106698], [3106699, 3624481], [3624482, 4142264], [4142265, 4660047], [4660048, 5177830], [5177831, 5695613], [5695614, 6213396], [6213397, 6731179], [6731180, 7248962], [7248963, 7766745], [7766746, 8284528], [8284529, 8802311], [8802312, 9320094], [9320095, 9837877], [9837878, 10355673]] SRR12670156 file size 3497610 SRR12670156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670156 SRR12670156_1.fastq SRR12670156_2.fastq Input file: SRR12670156_1.fastq Paired file: SRR12670156_2.fastq trimmed: SRR12670156-trimmed-pair1.fastq, SRR12670156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 06:40:58 2025 >> started Tue Feb 11 06:43:57 2025 >> done (179.564s) 10355673 read pairs processed; of these: 47 ( 0.00%) short read pairs filtered out after trimming by size control 3511 ( 0.03%) empty read pairs filtered out after trimming by size control 10352115 (99.97%) read pairs available; of these: 3225572 (31.16%) trimmed read pairs available after processing 7126543 (68.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 7 0.00% 24 4 0.00% 25 4 0.00% 26 9 0.00% 27 8 0.00% 28 15 0.00% 29 23 0.00% 30 21 0.00% 31 30 0.00% 32 34 0.00% 33 43 0.00% 34 40 0.00% 35 42 0.00% 36 65 0.00% 37 61 0.00% 38 79 0.00% 39 86 0.00% 40 95 0.00% 41 124 0.00% 42 137 0.00% 43 151 0.00% 44 153 0.00% 45 156 0.00% 46 170 0.00% 47 248 0.00% 48 247 0.00% 49 331 0.00% 50 432 0.00% 51 445 0.00% 52 556 0.01% 53 534 0.01% 54 597 0.01% 55 678 0.01% 56 762 0.01% 57 913 0.01% 58 1030 0.01% 59 1257 0.01% 60 1534 0.01% 61 1801 0.02% 62 2028 0.02% 63 2242 0.02% 64 2550 0.02% 65 2515 0.02% 66 3025 0.03% 67 3351 0.03% 68 3660 0.04% 69 4265 0.04% 70 4717 0.05% 71 5785 0.06% 72 6408 0.06% 73 7069 0.07% 74 7896 0.08% 75 8740 0.08% 76 9478 0.09% 77 10168 0.10% 78 10947 0.11% 79 12238 0.12% 80 13028 0.13% 81 14810 0.14% 82 16635 0.16% 83 17735 0.17% 84 19842 0.19% 85 21019 0.20% 86 22350 0.22% 87 23309 0.23% 88 24640 0.24% 89 25380 0.25% 90 27065 0.26% 91 28898 0.28% 92 29878 0.29% 93 32559 0.31% 94 34202 0.33% 95 35731 0.35% 96 36660 0.35% 97 38422 0.37% 98 38255 0.37% 99 39159 0.38% 100 40451 0.39% 101 40469 0.39% 102 41860 0.40% 103 43618 0.42% 104 44628 0.43% 105 46011 0.44% 106 47025 0.45% 107 47416 0.46% 108 47185 0.46% 109 47490 0.46% 110 47753 0.46% 111 48477 0.47% 112 49508 0.48% 113 48891 0.47% 114 50394 0.49% 115 51447 0.50% 116 52113 0.50% 117 52621 0.51% 118 52872 0.51% 119 51689 0.50% 120 52468 0.51% 121 52588 0.51% 122 52788 0.51% 123 52896 0.51% 124 52522 0.51% 125 53297 0.51% 126 53819 0.52% 127 53277 0.51% 128 53086 0.51% 129 53337 0.52% 130 52837 0.51% 131 52025 0.50% 132 52293 0.51% 133 52186 0.50% 134 51851 0.50% 135 51934 0.50% 136 52697 0.51% 137 52360 0.51% 138 51892 0.50% 139 52776 0.51% 140 52228 0.50% 141 51062 0.49% 142 51013 0.49% 143 50845 0.49% 144 51579 0.50% 145 50562 0.49% 146 50720 0.49% 147 50749 0.49% 148 51186 0.49% 149 50442 0.49% 150 50743 0.49% 151 7126543 68.84% 10352115 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=23.15 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.5 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTAG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=6.15 fanout-score-rank=9 prefix-density=1.42 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=47.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.3 sequence=AAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670156 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:28:46 Started mapping on | Feb 11 07:29:06 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 149.67 Number of input reads | 10352115 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 9733107 Uniquely mapped reads % | 94.02% Average mapped length | 279.85 Number of splices: Total | 9075264 Number of splices: Annotated (sjdb) | 8827891 Number of splices: GT/AG | 8884747 Number of splices: GC/AG | 143620 Number of splices: AT/AC | 6218 Number of splices: Non-canonical | 40679 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268709 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 51376 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 350299 350299 350299 N_multimapping 268709 268709 268709 N_noFeature 453068 9578371 528836 N_ambiguous 145390 667 66065 UnstrandedReadsAssigned:9134649 PositiveStrandReadsAssigned:154069 NegativeStrandReadsAssigned:9138206 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=128 echo kmer=123 SRR12670156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670156-trimmed-pair1.fastq SRR12670156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,352,115 reads, 9,155,439 reads pseudoaligned [quant] estimated average fragment length: 199.101 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR12670156.ke.tsv 34699 SRR12670156.se.tsv 87100 total ==> SRR12670156.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.9 447 26.8787 Potri.005G024800.1.v4.1 1035 836.899 206 26.9366 Potri.004G059700.1.v4.1 961 763.003 2 0.286848 Potri.007G009000.2.v4.1 1416 1217.9 0 0 Potri.003G141000.2.v4.1 2943 2744.9 506 20.1731 Potri.016G087400.1.v4.1 270 113.493 441 425.223 Potri.015G069301.1.v4.1 564 373.912 0 0 Potri.010G195200.1.v4.1 1773 1574.9 122 8.47725 Potri.012G127500.1.v4.1 977 778.954 82 11.5199 ==> SRR12670156.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 149 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12670156 completed mapping pipeline successfully