Starting /dee2/code/volunteer_pipeline.sh SRR12670158 current disk space = 3055088582656 free memory = 1562222148 SRR12670158 SRAfilesize f2817e6c36a068bb25416b775752074c SRR12670158.sra SRR12670158.sra file validated SRR12670158 is paired end SRR12670158 is conventional basespace SRR12670158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7485 37.0 37.0 37.0 37.0 37.0 2 36.39425 37.0 37.0 37.0 37.0 37.0 3 36.659 37.0 37.0 37.0 37.0 37.0 4 36.614 37.0 37.0 37.0 37.0 37.0 5 36.6735 37.0 37.0 37.0 37.0 37.0 6 36.6765 37.0 37.0 37.0 37.0 37.0 7 36.64 37.0 37.0 37.0 37.0 37.0 8 36.653 37.0 37.0 37.0 37.0 37.0 9 36.643 37.0 37.0 37.0 37.0 37.0 10-14 36.6134 37.0 37.0 37.0 37.0 37.0 15-19 36.605000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5458 37.0 37.0 37.0 37.0 37.0 25-29 36.5172 37.0 37.0 37.0 37.0 37.0 30-34 36.5467 37.0 37.0 37.0 37.0 37.0 35-39 36.4878 37.0 37.0 37.0 37.0 37.0 40-44 36.5081 37.0 37.0 37.0 37.0 37.0 45-49 36.4584 37.0 37.0 37.0 37.0 37.0 50-54 36.4547 37.0 37.0 37.0 37.0 37.0 55-59 36.4028 37.0 37.0 37.0 37.0 37.0 60-64 36.3952 37.0 37.0 37.0 37.0 37.0 65-69 36.387 37.0 37.0 37.0 37.0 37.0 70-74 36.34400000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.32019999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3292 37.0 37.0 37.0 37.0 37.0 85-89 36.297399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.233399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.254 37.0 37.0 37.0 37.0 37.0 100-104 36.2668 37.0 37.0 37.0 37.0 37.0 105-109 36.2524 37.0 37.0 37.0 37.0 37.0 110-114 36.216899999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1999 37.0 37.0 37.0 37.0 37.0 120-124 36.105399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9741 37.0 37.0 37.0 37.0 37.0 130-134 35.904399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.728699999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.397600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.1866 37.0 37.0 37.0 34.6 37.0 150-151 34.9315 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 2.0 26 1.0 27 7.0 28 17.0 29 16.0 30 23.0 31 29.0 32 52.0 33 98.0 34 111.0 35 349.0 36 2887.0 37 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.0 10.925 5.825 36.25 2 21.49837133550489 12.37785016286645 34.728138311200205 31.395640190428466 3 17.549999999999997 18.6 27.650000000000002 36.199999999999996 4 23.375 25.6 23.575 27.450000000000003 5 25.0 30.675 23.375 20.95 6 21.175 33.324999999999996 24.0 21.5 7 15.55 26.85 41.349999999999994 16.25 8 17.65 24.425 31.974999999999998 25.95 9 18.15 24.275 33.550000000000004 24.025 10-14 21.195 29.165000000000003 27.189999999999998 22.45 15-19 20.835 27.82 27.815 23.53 20-24 20.65 28.754999999999995 27.555000000000003 23.04 25-29 20.815 27.96 27.42 23.805 30-34 20.8 28.144999999999996 27.384999999999998 23.669999999999998 35-39 20.155 27.43 28.13 24.285 40-44 20.830000000000002 28.050000000000004 27.505000000000003 23.615 45-49 20.979999999999997 27.76 27.51 23.75 50-54 20.66 27.37 28.07 23.9 55-59 21.404999999999998 27.63 28.165000000000003 22.8 60-64 21.265 28.155 26.884999999999998 23.695 65-69 20.805 28.29 27.57 23.335 70-74 20.965 27.87 27.925 23.24 75-79 20.810000000000002 27.05 28.235 23.905 80-84 22.17 27.965 27.115000000000002 22.75 85-89 21.865000000000002 28.22 27.334999999999997 22.58 90-94 20.985 28.060000000000002 27.37 23.585 95-99 21.3 28.615000000000002 27.355 22.73 100-104 21.94 28.53 26.840000000000003 22.689999999999998 105-109 21.52 28.660000000000004 26.669999999999998 23.150000000000002 110-114 21.82 28.645 26.119999999999997 23.415 115-119 22.305 28.89 25.695 23.11 120-124 22.09 28.7 25.900000000000002 23.31 125-129 22.18 28.9 25.22 23.7 130-134 21.725 28.51 25.0 24.765 135-139 21.935 28.035 25.619999999999997 24.41 140-144 21.54 27.99 25.679999999999996 24.79 145-149 22.25 27.634999999999998 25.465 24.65 150-151 22.025 27.075 25.025 25.874999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.5 25 2.5 26 4.0 27 6.5 28 5.5 29 4.5 30 12.5 31 20.0 32 33.0 33 35.0 34 39.5 35 65.0 36 83.0 37 88.5 38 123.0 39 150.0 40 160.5 41 189.5 42 220.0 43 242.5 44 262.5 45 280.0 46 262.0 47 249.0 48 245.0 49 218.0 50 199.5 51 165.0 52 126.0 53 111.5 54 87.0 55 69.5 56 67.5 57 54.5 58 35.5 59 28.0 60 19.5 61 10.5 62 5.5 63 2.0 64 0.0 65 1.5 66 2.5 67 3.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.66178266178265 67.7 2 13.553113553113553 22.2 3 3.0525030525030523 7.5 4 0.5494505494505495 1.7999999999999998 5 0.1221001221001221 0.5 6 0.06105006105006105 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TAGGGATTCACTGCTAAGTTGAGAGAAATTACTGCTAACAGCTGTAAGCT 6 0.15 No Hit CCAAGCAACACTGTACAAGTCACCCAAACAAGTTTCGTATTCTGGGGGAG 6 0.15 No Hit CAGGAAAACTAAAACAAAGCAGTTCCAGAATGCTAAAAGCACTTACCTTC 5 0.125 No Hit CGCTCTTCAATAGAAAGTTGATTGAAACGTTTTTCACCATCCTCCATACT 5 0.125 No Hit CCCTGTACAGCACGGTGCAGAAATGCTGGGTTTCCAGGATCAAGAGGGAG 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.5375 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 1.025 0.0 0.0 0.0 0.0 82-83 1.275 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 1.875 0.0 0.0 0.0 0.0 90-91 2.1125 0.0 0.0 0.0 0.0 92-93 2.7125000000000004 0.0 0.0 0.0 0.0 94-95 3.3875 0.0 0.0 0.0 0.0 96-97 4.0625 0.0 0.0 0.0 0.0 98-99 4.5 0.0 0.0 0.0 0.0 100-101 5.300000000000001 0.0 0.0 0.0 0.0 102-103 5.9625 0.0 0.0 0.0 0.0 104-105 6.8125 0.0 0.0 0.0 0.0 106-107 7.737500000000001 0.0 0.0 0.0 0.0 108-109 8.6875 0.0 0.0 0.0 0.0 110-111 9.55 0.0 0.0 0.0 0.0 112-113 10.8125 0.0 0.0 0.0 0.0 114-115 11.8375 0.0 0.0 0.0 0.0 116-117 12.7875 0.0 0.0 0.0 0.0 118-119 14.175 0.0 0.0 0.0 0.0 120-121 15.3625 0.0 0.0 0.0 0.0 122-123 16.725 0.0 0.0 0.0 0.0 124-125 18.049999999999997 0.0 0.0 0.0 0.0 126-127 19.175 0.0 0.0 0.0 0.0 128-129 20.4 0.0 0.0 0.0 0.0 130-131 21.450000000000003 0.0 0.0 0.0 0.0 132-133 22.2125 0.0 0.0 0.0 0.0 134-135 23.1875 0.0 0.0 0.0 0.0 136-137 24.225 0.0 0.0 0.0 0.0 138-139 25.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTGA 10 0.006830828 145.0 1 CGTCTTC 10 0.006830828 145.0 145 >>END_MODULE SRR12670158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.466 37.0 37.0 37.0 37.0 37.0 2 36.299 37.0 37.0 37.0 37.0 37.0 3 36.313 37.0 37.0 37.0 37.0 37.0 4 36.2535 37.0 37.0 37.0 37.0 37.0 5 36.376 37.0 37.0 37.0 37.0 37.0 6 36.386 37.0 37.0 37.0 37.0 37.0 7 36.338 37.0 37.0 37.0 37.0 37.0 8 36.425 37.0 37.0 37.0 37.0 37.0 9 36.33 37.0 37.0 37.0 37.0 37.0 10-14 36.392900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.402 37.0 37.0 37.0 37.0 37.0 20-24 36.371300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3306 37.0 37.0 37.0 37.0 37.0 30-34 36.27479999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2889 37.0 37.0 37.0 37.0 37.0 40-44 36.231 37.0 37.0 37.0 37.0 37.0 45-49 36.2818 37.0 37.0 37.0 37.0 37.0 50-54 36.201100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.170399999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.1986 37.0 37.0 37.0 37.0 37.0 65-69 36.1981 37.0 37.0 37.0 37.0 37.0 70-74 36.1849 37.0 37.0 37.0 37.0 37.0 75-79 36.1319 37.0 37.0 37.0 37.0 37.0 80-84 36.0702 37.0 37.0 37.0 37.0 37.0 85-89 36.065099999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.024699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0066 37.0 37.0 37.0 37.0 37.0 100-104 35.9584 37.0 37.0 37.0 37.0 37.0 105-109 35.9152 37.0 37.0 37.0 37.0 37.0 110-114 35.7909 37.0 37.0 37.0 37.0 37.0 115-119 35.8647 37.0 37.0 37.0 37.0 37.0 120-124 35.697199999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.599999999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.512699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.327299999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.00750000000001 37.0 37.0 37.0 27.4 37.0 145-149 34.7615 37.0 37.0 37.0 25.0 37.0 150-151 34.335499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 1.0 21 2.0 22 7.0 23 7.0 24 6.0 25 6.0 26 8.0 27 4.0 28 12.0 29 20.0 30 20.0 31 33.0 32 63.0 33 91.0 34 205.0 35 494.0 36 2672.0 37 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.8 24.425 9.45 22.325 2 27.0 25.4 30.45 17.150000000000002 3 21.95 27.85 31.825 18.375 4 24.6 33.7 22.925 18.775 5 24.725 36.625 22.900000000000002 15.75 6 20.674999999999997 41.5 20.7 17.125 7 20.849999999999998 21.425 38.4 19.325 8 21.075 26.400000000000002 27.525 25.0 9 22.650000000000002 25.3 30.525000000000002 21.525 10-14 23.225 28.994999999999997 26.83 20.95 15-19 23.169999999999998 27.845 28.23 20.755000000000003 20-24 22.795 26.96 28.79 21.455 25-29 23.145 28.310000000000002 27.465 21.08 30-34 22.675 28.854999999999997 27.529999999999998 20.94 35-39 23.31 27.83 27.794999999999998 21.065 40-44 22.88 27.93 27.3 21.89 45-49 22.869999999999997 28.23 27.845 21.055 50-54 22.945 28.535 27.650000000000002 20.87 55-59 22.845 27.700000000000003 27.794999999999998 21.66 60-64 23.34 27.634999999999998 27.825 21.2 65-69 22.634999999999998 27.400000000000002 28.315 21.65 70-74 22.63 28.375 27.36 21.634999999999998 75-79 22.945 27.145000000000003 27.905 22.005 80-84 23.380000000000003 28.044999999999998 27.400000000000002 21.175 85-89 23.27 27.51 27.229999999999997 21.990000000000002 90-94 23.605 28.235 27.169999999999998 20.990000000000002 95-99 24.175 28.49 26.22 21.115000000000002 100-104 24.72 28.035 26.479999999999997 20.765 105-109 24.610000000000003 28.244999999999997 26.840000000000003 20.305 110-114 25.380000000000003 27.99 26.61 20.02 115-119 26.16 27.965 25.775 20.1 120-124 26.77 28.439999999999998 25.455 19.335 125-129 26.895000000000003 28.13 25.85 19.125 130-134 28.01 27.275 26.045 18.67 135-139 28.544999999999998 26.815 25.795 18.845 140-144 28.24 27.089999999999996 26.290000000000003 18.38 145-149 29.985 27.584999999999997 24.805 17.625 150-151 31.4875 26.387500000000003 24.7875 17.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.5 12 1.5 13 1.5 14 1.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 2.5 24 3.0 25 2.5 26 3.0 27 3.5 28 8.5 29 13.0 30 17.5 31 18.5 32 21.0 33 39.5 34 52.5 35 64.0 36 90.5 37 112.5 38 129.0 39 161.0 40 198.5 41 191.5 42 214.0 43 253.0 44 250.0 45 253.5 46 275.5 47 276.5 48 239.0 49 208.0 50 184.0 51 150.0 52 112.5 53 95.0 54 78.5 55 67.0 56 52.5 57 32.5 58 29.5 59 27.0 60 18.5 61 8.5 62 7.0 63 8.0 64 4.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.6 #Duplication Level Percentage of deduplicated Percentage of total 1 83.56537530266344 69.025 2 12.863196125907992 21.25 3 2.754237288135593 6.825 4 0.6355932203389831 2.1 5 0.12106537530266344 0.5 6 0.06053268765133172 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTATAAAAGCTTGGTGTTTTATCTTGAAGCCTGTGAATCCGGAAGCATC 6 0.15 No Hit TAAGAATCCGTTTTTATTTTCCATGCTTGTACATGCTTCTTTCCATTTAA 6 0.15 No Hit AAAGAAAGGTGTTTTTGGGACTAAAGGTGGTGATAAGGAGTCTATCGTTC 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit GTTCTCTCTCTCTGTTTATATATTTACATCTCTTGGTGTTCGTAGTTGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.5375 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 1.025 0.0 0.0 0.0 0.0 82-83 1.275 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 1.875 0.0 0.0 0.0 0.0 90-91 2.125 0.0 0.0 0.0 0.0 92-93 2.7125000000000004 0.0 0.0 0.0 0.0 94-95 3.3875 0.0 0.0 0.0 0.0 96-97 4.0625 0.0 0.0 0.0 0.0 98-99 4.512499999999999 0.0 0.0 0.0 0.0 100-101 5.324999999999999 0.0 0.0 0.0 0.0 102-103 5.9875 0.0 0.0 0.0 0.0 104-105 6.8125 0.0 0.0 0.0 0.0 106-107 7.75 0.0 0.0 0.0 0.0 108-109 8.712499999999999 0.0 0.0 0.0 0.0 110-111 9.6 0.0 0.0 0.0 0.0 112-113 10.8625 0.0 0.0 0.0 0.0 114-115 11.8875 0.0 0.0 0.0 0.0 116-117 12.8375 0.0 0.0 0.0 0.0 118-119 14.25 0.0 0.0 0.0 0.0 120-121 15.5125 0.0 0.0 0.0 0.0 122-123 16.875 0.0 0.0 0.0 0.0 124-125 18.200000000000003 0.0 0.0 0.0 0.0 126-127 19.325 0.0 0.0 0.0 0.0 128-129 20.55 0.0 0.0 0.0 0.0 130-131 21.625 0.0 0.0 0.0 0.0 132-133 22.362499999999997 0.0 0.0 0.0 0.0 134-135 23.35 0.0 0.0 0.0 0.0 136-137 24.375 0.0 0.0 0.0 0.0 138-139 25.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTAC 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451660 spots for SRR12670158.sra Written 451660 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra Read 451643 spots for SRR12670158.sra Written 451643 spots for SRR12670158.sra SRR ids: ['SRR12670158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3gmmmc23 SRR12670158.sra spots: 9032877 blocks: [[1, 451643], [451644, 903286], [903287, 1354929], [1354930, 1806572], [1806573, 2258215], [2258216, 2709858], [2709859, 3161501], [3161502, 3613144], [3613145, 4064787], [4064788, 4516430], [4516431, 4968073], [4968074, 5419716], [5419717, 5871359], [5871360, 6323002], [6323003, 6774645], [6774646, 7226288], [7226289, 7677931], [7677932, 8129574], [8129575, 8581217], [8581218, 9032877]] SRR12670158 file size 3049955 SRR12670158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670158 SRR12670158_1.fastq SRR12670158_2.fastq Input file: SRR12670158_1.fastq Paired file: SRR12670158_2.fastq trimmed: SRR12670158-trimmed-pair1.fastq, SRR12670158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:16:32 2025 >> started Tue Feb 11 07:19:04 2025 >> done (151.833s) 9032877 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 2602 ( 0.03%) empty read pairs filtered out after trimming by size control 9030249 (99.97%) read pairs available; of these: 2699667 (29.90%) trimmed read pairs available after processing 6330582 (70.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 4 0.00% 21 6 0.00% 22 10 0.00% 23 11 0.00% 24 19 0.00% 25 19 0.00% 26 22 0.00% 27 13 0.00% 28 24 0.00% 29 35 0.00% 30 26 0.00% 31 44 0.00% 32 32 0.00% 33 38 0.00% 34 32 0.00% 35 48 0.00% 36 64 0.00% 37 55 0.00% 38 83 0.00% 39 92 0.00% 40 92 0.00% 41 121 0.00% 42 129 0.00% 43 107 0.00% 44 135 0.00% 45 159 0.00% 46 169 0.00% 47 181 0.00% 48 228 0.00% 49 246 0.00% 50 311 0.00% 51 392 0.00% 52 396 0.00% 53 423 0.00% 54 473 0.01% 55 462 0.01% 56 547 0.01% 57 706 0.01% 58 741 0.01% 59 813 0.01% 60 1033 0.01% 61 1232 0.01% 62 1287 0.01% 63 1418 0.02% 64 1513 0.02% 65 1681 0.02% 66 1867 0.02% 67 2001 0.02% 68 2299 0.03% 69 2645 0.03% 70 3126 0.03% 71 3395 0.04% 72 3856 0.04% 73 4508 0.05% 74 4941 0.05% 75 5529 0.06% 76 5874 0.07% 77 6371 0.07% 78 7101 0.08% 79 7816 0.09% 80 8634 0.10% 81 9525 0.11% 82 11125 0.12% 83 11968 0.13% 84 12911 0.14% 85 14295 0.16% 86 14885 0.16% 87 15720 0.17% 88 16796 0.19% 89 17442 0.19% 90 19119 0.21% 91 20139 0.22% 92 21451 0.24% 93 23405 0.26% 94 25101 0.28% 95 26428 0.29% 96 27086 0.30% 97 28032 0.31% 98 28913 0.32% 99 29799 0.33% 100 30927 0.34% 101 31474 0.35% 102 32803 0.36% 103 34221 0.38% 104 35596 0.39% 105 37138 0.41% 106 37639 0.42% 107 38044 0.42% 108 38031 0.42% 109 38829 0.43% 110 38818 0.43% 111 39602 0.44% 112 40790 0.45% 113 41342 0.46% 114 42617 0.47% 115 43587 0.48% 116 43964 0.49% 117 44532 0.49% 118 44788 0.50% 119 44480 0.49% 120 44811 0.50% 121 45170 0.50% 122 45283 0.50% 123 45964 0.51% 124 46391 0.51% 125 46524 0.52% 126 47617 0.53% 127 47611 0.53% 128 46792 0.52% 129 47054 0.52% 130 47150 0.52% 131 46676 0.52% 132 46937 0.52% 133 47272 0.52% 134 47580 0.53% 135 48422 0.54% 136 48195 0.53% 137 47461 0.53% 138 47417 0.53% 139 48336 0.54% 140 47596 0.53% 141 47819 0.53% 142 47241 0.52% 143 47271 0.52% 144 47576 0.53% 145 47393 0.52% 146 47832 0.53% 147 48075 0.53% 148 47801 0.53% 149 46139 0.51% 150 47252 0.52% 151 6330582 70.10% 9030249 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=31 prefix-density=0.42 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=180.70 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=15.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=30 prefix-density=0.60 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=36.59 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.5 sequence=AAAGAAAAGAAAA SRR12670158 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:33:18 Started mapping on | Feb 11 07:33:18 Finished on | Feb 11 07:34:24 Mapping speed, Million of reads per hour | 492.56 Number of input reads | 9030249 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 8339445 Uniquely mapped reads % | 92.35% Average mapped length | 281.70 Number of splices: Total | 7898564 Number of splices: Annotated (sjdb) | 7720673 Number of splices: GT/AG | 7733016 Number of splices: GC/AG | 132280 Number of splices: AT/AC | 4343 Number of splices: Non-canonical | 28925 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213305 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 61666 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477499 477499 477499 N_multimapping 213305 213305 213305 N_noFeature 353822 8225908 405032 N_ambiguous 112482 566 49795 UnstrandedReadsAssigned:7873141 PositiveStrandReadsAssigned:112971 NegativeStrandReadsAssigned:7884618 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=131 echo kmer=127 SRR12670158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670158-trimmed-pair1.fastq SRR12670158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,030,249 reads, 7,951,563 reads pseudoaligned [quant] estimated average fragment length: 196.486 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR12670158.ke.tsv 34699 SRR12670158.se.tsv 87100 total ==> SRR12670158.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.51 278 19.6144 Potri.005G024800.1.v4.1 1035 839.514 181 27.7238 Potri.004G059700.1.v4.1 961 765.558 1 0.167967 Potri.007G009000.2.v4.1 1416 1220.51 0 0 Potri.003G141000.2.v4.1 2943 2747.51 557.012 26.0691 Potri.016G087400.1.v4.1 270 111.001 307.324 356.017 Potri.015G069301.1.v4.1 564 375.043 0 0 Potri.010G195200.1.v4.1 1773 1577.51 69.9545 5.70223 Potri.012G127500.1.v4.1 977 781.536 30 4.93599 ==> SRR12670158.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670158 completed mapping pipeline successfully