Starting /dee2/code/volunteer_pipeline.sh SRR12670159 current disk space = 3055614832640 free memory = 1506654284 SRR12670159 SRAfilesize 005d6fe0fd39c703b71ef173a4ce27a0 SRR12670159.sra SRR12670159.sra file validated SRR12670159 is paired end SRR12670159 is conventional basespace SRR12670159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6325 37.0 37.0 37.0 37.0 37.0 2 36.4695 37.0 37.0 37.0 37.0 37.0 3 36.5755 37.0 37.0 37.0 37.0 37.0 4 36.6545 37.0 37.0 37.0 37.0 37.0 5 36.669 37.0 37.0 37.0 37.0 37.0 6 36.661 37.0 37.0 37.0 37.0 37.0 7 36.596 37.0 37.0 37.0 37.0 37.0 8 36.531 37.0 37.0 37.0 37.0 37.0 9 36.6925 37.0 37.0 37.0 37.0 37.0 10-14 36.635299999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6118 37.0 37.0 37.0 37.0 37.0 20-24 36.579299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5584 37.0 37.0 37.0 37.0 37.0 30-34 36.558800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5203 37.0 37.0 37.0 37.0 37.0 40-44 36.51469999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.5171 37.0 37.0 37.0 37.0 37.0 50-54 36.486200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4601 37.0 37.0 37.0 37.0 37.0 60-64 36.4293 37.0 37.0 37.0 37.0 37.0 65-69 36.4339 37.0 37.0 37.0 37.0 37.0 70-74 36.3664 37.0 37.0 37.0 37.0 37.0 75-79 36.3769 37.0 37.0 37.0 37.0 37.0 80-84 36.3069 37.0 37.0 37.0 37.0 37.0 85-89 36.3388 37.0 37.0 37.0 37.0 37.0 90-94 36.305099999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.268899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.26219999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.2565 37.0 37.0 37.0 37.0 37.0 110-114 36.2238 37.0 37.0 37.0 37.0 37.0 115-119 36.2315 37.0 37.0 37.0 37.0 37.0 120-124 36.1291 37.0 37.0 37.0 37.0 37.0 125-129 36.0021 37.0 37.0 37.0 37.0 37.0 130-134 35.8265 37.0 37.0 37.0 37.0 37.0 135-139 35.627500000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.188100000000006 37.0 37.0 37.0 37.0 37.0 145-149 34.8784 37.0 37.0 37.0 27.4 37.0 150-151 34.528 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 1.0 26 2.0 27 5.0 28 15.0 29 13.0 30 22.0 31 25.0 32 58.0 33 95.0 34 158.0 35 311.0 36 2892.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.45 10.325 5.2749999999999995 44.95 2 16.90881763527054 13.627254509018035 38.62725450901804 30.836673346693388 3 16.950000000000003 16.8 29.375 36.875 4 23.75 24.224999999999998 22.400000000000002 29.625 5 23.25 31.474999999999998 25.2 20.075000000000003 6 19.925 35.625 24.6 19.85 7 15.525 25.8 41.275 17.4 8 16.0 23.9 34.725 25.374999999999996 9 18.175 23.575 34.675 23.575 10-14 19.435 29.885 27.505000000000003 23.175 15-19 20.055 28.139999999999997 28.175 23.630000000000003 20-24 20.535 28.525 27.805000000000003 23.135 25-29 20.59 27.93 28.405 23.075000000000003 30-34 19.975 29.060000000000002 27.150000000000002 23.815 35-39 20.805 28.27 27.639999999999997 23.285 40-44 19.98 28.4 27.939999999999998 23.68 45-49 20.145 27.88 28.449999999999996 23.525 50-54 20.080000000000002 28.815 27.224999999999998 23.880000000000003 55-59 20.015 29.075 27.765 23.145 60-64 20.775 28.555000000000003 27.544999999999998 23.125 65-69 20.19 28.03 28.08 23.7 70-74 20.3 29.025000000000002 27.310000000000002 23.365 75-79 21.09 27.83 27.51 23.57 80-84 20.880000000000003 27.689999999999998 28.105000000000004 23.325000000000003 85-89 20.805 28.599999999999998 27.71 22.884999999999998 90-94 20.865000000000002 28.58 27.235 23.32 95-99 21.19 28.610000000000003 27.16 23.04 100-104 21.89 27.975 26.950000000000003 23.185 105-109 21.795 28.265 26.950000000000003 22.99 110-114 21.765 29.805 25.15 23.28 115-119 21.335 29.685 25.3 23.68 120-124 21.485000000000003 29.065 25.480000000000004 23.97 125-129 21.47 28.175 25.665 24.69 130-134 22.12 28.910000000000004 24.925 24.044999999999998 135-139 21.775 28.384999999999998 25.435000000000002 24.404999999999998 140-144 21.775 27.650000000000002 25.869999999999997 24.705 145-149 22.39 26.545 26.740000000000002 24.325 150-151 24.075 26.025 25.674999999999997 24.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 4.0 26 4.5 27 6.5 28 11.0 29 17.5 30 22.0 31 25.5 32 25.5 33 44.0 34 64.5 35 66.5 36 86.5 37 118.0 38 135.0 39 150.5 40 184.0 41 222.5 42 227.0 43 221.5 44 245.0 45 263.0 46 273.0 47 264.0 48 234.5 49 208.5 50 169.0 51 136.5 52 111.0 53 100.0 54 91.0 55 64.5 56 54.0 57 42.5 58 29.5 59 22.0 60 17.0 61 13.0 62 7.0 63 5.5 64 3.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.975 #Duplication Level Percentage of deduplicated Percentage of total 1 82.86062824031717 67.925 2 13.601707837755415 22.3 3 2.6227508386703264 6.45 4 0.6404391582799633 2.1 5 0.18298261665141813 0.75 6 0.060994205550472705 0.3 7 0.030497102775236352 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCTCTGTCTCATACCTCTTTCCATGCCTGTGAGCAAAACGAGCAAAGG 7 0.17500000000000002 No Hit CTTCTCCATAAGCTGCAATGTGTTCTTTATGCCTCAGACCAAGCTTTTCA 6 0.15 No Hit CTTCATCAATGTACCGTTCAGATTGCTTCATAAGCTCTCCAATAAAGATC 6 0.15 No Hit ATCGTTTAGAAATGATATCCTGTTAGTTAAAAATCAATGATGCTAGCGAA 5 0.125 No Hit TATAGAGTATAAATTTTCATGAATTCATTTACATGCAAACTTCAAAGCTC 5 0.125 No Hit CTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATC 5 0.125 No Hit CTTGCAAATGTAAAGCTTGCCATCTTTCACAGTGGCTGTGATCAGTTGGT 5 0.125 No Hit GCTTGCATCAACACCTTTCCTTTGGCTGAGTTCTTAACCTTTGGCAGACT 5 0.125 No Hit GTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 0.875 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.3250000000000002 0.0 0.0 0.0 0.0 86-87 1.975 0.0 0.0 0.0 0.0 88-89 2.3499999999999996 0.0 0.0 0.0 0.0 90-91 2.8625 0.0 0.0 0.0 0.0 92-93 3.2875 0.0 0.0 0.0 0.0 94-95 3.5625 0.0 0.0 0.0 0.0 96-97 4.2625 0.0 0.0 0.0 0.0 98-99 5.0 0.0 0.0 0.0 0.0 100-101 5.7875 0.0 0.0 0.0 0.0 102-103 6.487500000000001 0.0 0.0 0.0 0.0 104-105 7.3375 0.0 0.0 0.0 0.0 106-107 8.35 0.0 0.0 0.0 0.0 108-109 9.4375 0.0 0.0 0.0 0.0 110-111 10.525 0.0 0.0 0.0 0.0 112-113 11.45 0.0 0.0 0.0 0.0 114-115 12.4 0.0 0.0 0.0 0.0 116-117 13.35 0.0 0.0 0.0 0.0 118-119 14.149999999999999 0.0 0.0 0.0 0.0 120-121 15.2375 0.0 0.0 0.0 0.0 122-123 16.3125 0.0 0.0 0.0 0.0 124-125 17.475 0.0 0.0 0.0 0.0 126-127 18.8625 0.0 0.0 0.0 0.0 128-129 20.1375 0.0 0.0 0.0 0.0 130-131 21.2 0.0 0.0 0.0 0.0 132-133 22.05 0.0 0.0 0.0 0.0 134-135 22.95 0.0 0.0 0.0 0.0 136-137 23.6625 0.0 0.0 0.0 0.0 138-139 24.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATTT 10 0.006830828 145.0 1 GCCACTT 10 0.006830828 145.0 1 GGGGGGG 35 0.0035366106 20.714287 140-144 >>END_MODULE SRR12670159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3045 37.0 37.0 37.0 37.0 37.0 2 36.2845 37.0 37.0 37.0 37.0 37.0 3 36.2995 37.0 37.0 37.0 37.0 37.0 4 36.3585 37.0 37.0 37.0 37.0 37.0 5 36.4125 37.0 37.0 37.0 37.0 37.0 6 36.3325 37.0 37.0 37.0 37.0 37.0 7 36.256 37.0 37.0 37.0 37.0 37.0 8 36.4385 37.0 37.0 37.0 37.0 37.0 9 36.3745 37.0 37.0 37.0 37.0 37.0 10-14 36.4362 37.0 37.0 37.0 37.0 37.0 15-19 36.4555 37.0 37.0 37.0 37.0 37.0 20-24 36.377300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3452 37.0 37.0 37.0 37.0 37.0 30-34 36.3109 37.0 37.0 37.0 37.0 37.0 35-39 36.276 37.0 37.0 37.0 37.0 37.0 40-44 36.2284 37.0 37.0 37.0 37.0 37.0 45-49 36.2811 37.0 37.0 37.0 37.0 37.0 50-54 36.2085 37.0 37.0 37.0 37.0 37.0 55-59 36.1512 37.0 37.0 37.0 37.0 37.0 60-64 36.1914 37.0 37.0 37.0 37.0 37.0 65-69 36.1417 37.0 37.0 37.0 37.0 37.0 70-74 36.15419999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.109899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.092999999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.0599 37.0 37.0 37.0 37.0 37.0 90-94 36.0287 37.0 37.0 37.0 37.0 37.0 95-99 35.9798 37.0 37.0 37.0 37.0 37.0 100-104 35.92809999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.882799999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.799099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.83990000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7107 37.0 37.0 37.0 37.0 37.0 125-129 35.6507 37.0 37.0 37.0 37.0 37.0 130-134 35.4859 37.0 37.0 37.0 34.6 37.0 135-139 35.3159 37.0 37.0 37.0 34.6 37.0 140-144 35.0986 37.0 37.0 37.0 27.4 37.0 145-149 34.6517 37.0 37.0 37.0 25.0 37.0 150-151 34.2595 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 4.0 23 5.0 24 3.0 25 7.0 26 6.0 27 10.0 28 4.0 29 20.0 30 22.0 31 25.0 32 67.0 33 100.0 34 210.0 35 529.0 36 2660.0 37 315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.300000000000004 23.724999999999998 8.425 28.549999999999997 2 25.575 26.5 31.85 16.075 3 20.1 27.6 33.025 19.275000000000002 4 23.724999999999998 34.75 22.525000000000002 19.0 5 23.425 36.575 22.6 17.4 6 20.575 39.625 21.8 18.0 7 20.45 22.825 37.925 18.8 8 20.549999999999997 25.575 28.825 25.05 9 21.975 23.9 31.0 23.125 10-14 23.24 29.604999999999997 26.340000000000003 20.815 15-19 22.455 28.18 27.685 21.68 20-24 22.395 28.249999999999996 27.994999999999997 21.36 25-29 23.385 27.96 27.685 20.97 30-34 22.384999999999998 28.28 27.834999999999997 21.5 35-39 23.24 28.065 27.544999999999998 21.15 40-44 22.64 27.675 28.255000000000003 21.43 45-49 22.74 28.044999999999998 27.925 21.29 50-54 22.34 27.985 28.235 21.44 55-59 23.325000000000003 28.544999999999998 27.279999999999998 20.849999999999998 60-64 22.64 28.235 28.23 20.895 65-69 22.85 27.455000000000002 28.244999999999997 21.45 70-74 23.189999999999998 27.395000000000003 28.349999999999998 21.065 75-79 23.04 27.51 27.955000000000002 21.495 80-84 23.405 28.01 27.92 20.665 85-89 23.52 28.525 27.66 20.294999999999998 90-94 23.47 27.595 27.77 21.165 95-99 24.235 27.889999999999997 27.395000000000003 20.48 100-104 24.9 27.825 26.875 20.4 105-109 24.715 28.63 26.86 19.794999999999998 110-114 25.645 28.42 26.275 19.66 115-119 25.985000000000003 28.48 25.974999999999998 19.56 120-124 26.284999999999997 28.035 26.3 19.38 125-129 26.82 28.16 25.855 19.165 130-134 26.97 28.37 25.424999999999997 19.235 135-139 27.435 27.98 26.119999999999997 18.465 140-144 27.88 26.955000000000002 26.11 19.055 145-149 28.599999999999998 26.88 25.905 18.615000000000002 150-151 30.162499999999998 26.5125 25.025 18.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 1.0 23 0.5 24 2.5 25 4.0 26 2.5 27 5.5 28 9.0 29 8.0 30 13.5 31 25.5 32 32.5 33 38.5 34 47.0 35 74.5 36 109.5 37 114.0 38 135.0 39 173.0 40 197.0 41 218.0 42 239.5 43 248.5 44 264.0 45 277.5 46 247.5 47 224.5 48 211.5 49 202.0 50 169.5 51 145.0 52 135.5 53 103.0 54 76.5 55 60.0 56 40.5 57 26.5 58 28.5 59 24.5 60 14.5 61 10.5 62 11.0 63 6.5 64 3.0 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.175 #Duplication Level Percentage of deduplicated Percentage of total 1 82.87191968360207 68.10000000000001 2 13.629449345908123 22.400000000000002 3 2.6772132643748097 6.6000000000000005 4 0.6388804380894433 2.1 5 0.152114390021296 0.625 6 0.0 0.0 7 0.0304228780042592 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTTCATTTGATCCCAAGCCAATTCAGGGCGATTGGAATGGAGCGGGGG 7 0.17500000000000002 No Hit AAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAAT 5 0.125 No Hit GTTCTTAGCTTGGCATGGATGAAATTGGCAATGGAGTCACTCTGTGAGAC 5 0.125 No Hit GGCACCATCAAGATGCTTGTTGGTGGTGCTGGAGATATAAAACTCACAAA 5 0.125 No Hit AGCTAACATATTGGAGACATCAACTCCAGTGGTTGGTGGGAAGCAATATT 5 0.125 No Hit ATTTGAGAGATTTAAACACATAAGCCCTAAACACGTGAGTGTTGGAGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 0.875 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.3250000000000002 0.0 0.0 0.0 0.0 86-87 1.975 0.0 0.0 0.0 0.0 88-89 2.3499999999999996 0.0 0.0 0.0 0.0 90-91 2.8625 0.0 0.0 0.0 0.0 92-93 3.2875 0.0 0.0 0.0 0.0 94-95 3.5625 0.0 0.0 0.0 0.0 96-97 4.25 0.0 0.0 0.0 0.0 98-99 5.0 0.0 0.0 0.0 0.0 100-101 5.8125 0.0 0.0 0.0 0.0 102-103 6.4625 0.0 0.0 0.0 0.0 104-105 7.3125 0.0 0.0 0.0 0.0 106-107 8.337499999999999 0.0 0.0 0.0 0.0 108-109 9.425 0.0 0.0 0.0 0.0 110-111 10.5 0.0 0.0 0.0 0.0 112-113 11.45 0.0 0.0 0.0 0.0 114-115 12.4125 0.0 0.0 0.0 0.0 116-117 13.375 0.0 0.0 0.0 0.0 118-119 14.175 0.0 0.0 0.0 0.0 120-121 15.2625 0.0 0.0 0.0 0.0 122-123 16.362499999999997 0.0 0.0 0.0 0.0 124-125 17.512500000000003 0.0 0.0 0.0 0.0 126-127 18.8625 0.0 0.0 0.0 0.0 128-129 20.1375 0.0 0.0 0.0 0.0 130-131 21.2 0.0 0.0 0.0 0.0 132-133 22.1 0.0 0.0 0.0 0.0 134-135 23.025 0.0 0.0 0.0 0.0 136-137 23.762500000000003 0.0 0.0 0.0 0.0 138-139 24.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAATTT 10 0.006830828 145.0 3 >>END_MODULE Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638818 spots for SRR12670159.sra Written 638818 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra Read 638815 spots for SRR12670159.sra Written 638815 spots for SRR12670159.sra SRR ids: ['SRR12670159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_boi1mekn SRR12670159.sra spots: 12776303 blocks: [[1, 638815], [638816, 1277630], [1277631, 1916445], [1916446, 2555260], [2555261, 3194075], [3194076, 3832890], [3832891, 4471705], [4471706, 5110520], [5110521, 5749335], [5749336, 6388150], [6388151, 7026965], [7026966, 7665780], [7665781, 8304595], [8304596, 8943410], [8943411, 9582225], [9582226, 10221040], [10221041, 10859855], [10859856, 11498670], [11498671, 12137485], [12137486, 12776303]] SRR12670159 file size 4320246 SRR12670159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670159 SRR12670159_1.fastq SRR12670159_2.fastq Input file: SRR12670159_1.fastq Paired file: SRR12670159_2.fastq trimmed: SRR12670159-trimmed-pair1.fastq, SRR12670159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:34:53 2025 >> started Tue Feb 11 07:35:13 2025 >> done (20.009s) 12776303 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 1926 ( 0.02%) empty read pairs filtered out after trimming by size control 12774306 (99.98%) read pairs available; of these: 3924779 (30.72%) trimmed read pairs available after processing 8849527 (69.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 9 0.00% 22 17 0.00% 23 12 0.00% 24 22 0.00% 25 18 0.00% 26 29 0.00% 27 26 0.00% 28 45 0.00% 29 46 0.00% 30 53 0.00% 31 51 0.00% 32 63 0.00% 33 91 0.00% 34 87 0.00% 35 90 0.00% 36 86 0.00% 37 120 0.00% 38 127 0.00% 39 158 0.00% 40 199 0.00% 41 212 0.00% 42 216 0.00% 43 239 0.00% 44 238 0.00% 45 226 0.00% 46 291 0.00% 47 320 0.00% 48 436 0.00% 49 508 0.00% 50 546 0.00% 51 678 0.01% 52 715 0.01% 53 807 0.01% 54 780 0.01% 55 865 0.01% 56 899 0.01% 57 1093 0.01% 58 1319 0.01% 59 1551 0.01% 60 1788 0.01% 61 2114 0.02% 62 2249 0.02% 63 2725 0.02% 64 2793 0.02% 65 3079 0.02% 66 3220 0.03% 67 3611 0.03% 68 3963 0.03% 69 4493 0.04% 70 5257 0.04% 71 6080 0.05% 72 7108 0.06% 73 8109 0.06% 74 8595 0.07% 75 9195 0.07% 76 9978 0.08% 77 10555 0.08% 78 11537 0.09% 79 12836 0.10% 80 14309 0.11% 81 15916 0.12% 82 17734 0.14% 83 19499 0.15% 84 21760 0.17% 85 23103 0.18% 86 24227 0.19% 87 25505 0.20% 88 26443 0.21% 89 27705 0.22% 90 29947 0.23% 91 32646 0.26% 92 34470 0.27% 93 36941 0.29% 94 39451 0.31% 95 41917 0.33% 96 42898 0.34% 97 43591 0.34% 98 44225 0.35% 99 45132 0.35% 100 46956 0.37% 101 48169 0.38% 102 50932 0.40% 103 52590 0.41% 104 53875 0.42% 105 55720 0.44% 106 56596 0.44% 107 56674 0.44% 108 56888 0.45% 109 57540 0.45% 110 57767 0.45% 111 58680 0.46% 112 59760 0.47% 113 60829 0.48% 114 62257 0.49% 115 63722 0.50% 116 64464 0.50% 117 64363 0.50% 118 64575 0.51% 119 63100 0.49% 120 63893 0.50% 121 64017 0.50% 122 64463 0.50% 123 64885 0.51% 124 66199 0.52% 125 66629 0.52% 126 68172 0.53% 127 67106 0.53% 128 66802 0.52% 129 66008 0.52% 130 65892 0.52% 131 65107 0.51% 132 65155 0.51% 133 65830 0.52% 134 65783 0.51% 135 67536 0.53% 136 66963 0.52% 137 67008 0.52% 138 65817 0.52% 139 65920 0.52% 140 64393 0.50% 141 64036 0.50% 142 64820 0.51% 143 64340 0.50% 144 65302 0.51% 145 65239 0.51% 146 65565 0.51% 147 64831 0.51% 148 64272 0.50% 149 63486 0.50% 150 63847 0.50% 151 8849527 69.28% 12774306 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=234.22 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.64 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=20.55 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=4.9 sequence=GCTGCTGTTTCTATCCCATCTTTCACCGGTCTTAAGGCAG SRR12670159 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:35:52 Started mapping on | Feb 11 07:35:52 Finished on | Feb 11 07:37:26 Mapping speed, Million of reads per hour | 489.23 Number of input reads | 12774306 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 11803946 Uniquely mapped reads % | 92.40% Average mapped length | 280.86 Number of splices: Total | 10836854 Number of splices: Annotated (sjdb) | 10576160 Number of splices: GT/AG | 10610907 Number of splices: GC/AG | 177988 Number of splices: AT/AC | 7140 Number of splices: Non-canonical | 40819 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312307 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 87727 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 658053 658053 658053 N_multimapping 312307 312307 312307 N_noFeature 485865 11646241 556634 N_ambiguous 157464 717 70104 UnstrandedReadsAssigned:11160617 PositiveStrandReadsAssigned:156988 NegativeStrandReadsAssigned:11177208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=130 echo kmer=125 SRR12670159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670159-trimmed-pair1.fastq SRR12670159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,774,306 reads, 11,264,283 reads pseudoaligned [quant] estimated average fragment length: 197.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 977 rounds 52401 SRR12670159.ke.tsv 34699 SRR12670159.se.tsv 87100 total ==> SRR12670159.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.73 495 26.1886 Potri.005G024800.1.v4.1 1035 838.733 116 13.3299 Potri.004G059700.1.v4.1 961 764.813 17 2.14233 Potri.007G009000.2.v4.1 1416 1219.73 0 0 Potri.003G141000.2.v4.1 2943 2746.73 514.687 18.0601 Potri.016G087400.1.v4.1 270 113.179 477.649 406.758 Potri.015G069301.1.v4.1 564 375.479 0 0 Potri.010G195200.1.v4.1 1773 1576.73 60 3.66763 Potri.012G127500.1.v4.1 977 780.78 280 34.5638 ==> SRR12670159.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 623 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 185 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12670159 completed mapping pipeline successfully