Starting /dee2/code/volunteer_pipeline.sh SRR12670160 current disk space = 3055622770688 free memory = 1473054924 SRR12670160 SRAfilesize 3a79e7ea6b768502b1a78349bf815a5c SRR12670160.sra SRR12670160.sra file validated SRR12670160 is paired end SRR12670160 is conventional basespace SRR12670160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6725 37.0 37.0 37.0 37.0 37.0 2 36.4995 37.0 37.0 37.0 37.0 37.0 3 36.6525 37.0 37.0 37.0 37.0 37.0 4 36.675 37.0 37.0 37.0 37.0 37.0 5 36.7055 37.0 37.0 37.0 37.0 37.0 6 36.721 37.0 37.0 37.0 37.0 37.0 7 36.63 37.0 37.0 37.0 37.0 37.0 8 36.6545 37.0 37.0 37.0 37.0 37.0 9 36.6075 37.0 37.0 37.0 37.0 37.0 10-14 36.631299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.603500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5587 37.0 37.0 37.0 37.0 37.0 25-29 36.5177 37.0 37.0 37.0 37.0 37.0 30-34 36.529199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4597 37.0 37.0 37.0 37.0 37.0 40-44 36.4798 37.0 37.0 37.0 37.0 37.0 45-49 36.406600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4494 37.0 37.0 37.0 37.0 37.0 55-59 36.3865 37.0 37.0 37.0 37.0 37.0 60-64 36.3888 37.0 37.0 37.0 37.0 37.0 65-69 36.346399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3698 37.0 37.0 37.0 37.0 37.0 75-79 36.366400000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.3442 37.0 37.0 37.0 37.0 37.0 85-89 36.3069 37.0 37.0 37.0 37.0 37.0 90-94 36.3399 37.0 37.0 37.0 37.0 37.0 95-99 36.2822 37.0 37.0 37.0 37.0 37.0 100-104 36.2477 37.0 37.0 37.0 37.0 37.0 105-109 36.21809999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.157 37.0 37.0 37.0 37.0 37.0 115-119 36.1562 37.0 37.0 37.0 37.0 37.0 120-124 36.00320000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.7638 37.0 37.0 37.0 37.0 37.0 130-134 35.7034 37.0 37.0 37.0 37.0 37.0 135-139 35.5441 37.0 37.0 37.0 37.0 37.0 140-144 35.124 37.0 37.0 37.0 32.2 37.0 145-149 34.8476 37.0 37.0 37.0 25.0 37.0 150-151 34.658 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 1.0 25 4.0 26 2.0 27 3.0 28 18.0 29 15.0 30 24.0 31 31.0 32 51.0 33 108.0 34 148.0 35 360.0 36 2824.0 37 407.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 10.625 6.875000000000001 42.35 2 19.354031046569855 12.043064596895343 38.057085628442664 30.54581872809214 3 17.8 15.7 26.85 39.65 4 23.0 23.425 23.799999999999997 29.775000000000002 5 24.15 29.599999999999998 24.15 22.1 6 20.724999999999998 33.25 24.125 21.9 7 14.975 27.375 40.475 17.175 8 18.35 25.75 33.275 22.625 9 17.875 23.775 35.5 22.85 10-14 20.005 29.794999999999998 27.560000000000002 22.64 15-19 20.535 27.500000000000004 27.750000000000004 24.215 20-24 20.495 27.96 27.805000000000003 23.74 25-29 20.560000000000002 27.950000000000003 27.355 24.135 30-34 20.465 28.499999999999996 26.889999999999997 24.145 35-39 21.255 28.005000000000003 27.41 23.330000000000002 40-44 20.09 28.34 27.47 24.099999999999998 45-49 20.31 28.565 27.529999999999998 23.595 50-54 21.145 28.405 26.755000000000003 23.695 55-59 20.47 27.985 27.935 23.61 60-64 20.735 28.32 27.415 23.53 65-69 20.825 27.77 27.52 23.885 70-74 21.23 28.575 27.439999999999998 22.755 75-79 20.95 28.01 27.52 23.52 80-84 21.605 28.03 27.279999999999998 23.085 85-89 21.365000000000002 27.765 27.555000000000003 23.315 90-94 21.475 28.23 26.805 23.49 95-99 21.48 29.049999999999997 26.279999999999998 23.189999999999998 100-104 21.154999999999998 29.095 26.345000000000002 23.405 105-109 22.42 27.965 25.985000000000003 23.630000000000003 110-114 21.98 28.804999999999996 25.385 23.830000000000002 115-119 22.264999999999997 28.549999999999997 25.15 24.035 120-124 21.185000000000002 28.49 25.455 24.87 125-129 21.745 28.225 25.424999999999997 24.605 130-134 21.945 27.87 25.15 25.035 135-139 21.57 27.48 26.355 24.595 140-144 22.615 26.63 25.97 24.785 145-149 22.415 27.12 25.905 24.560000000000002 150-151 23.2625 25.937500000000004 26.05 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 3.5 28 3.5 29 5.0 30 12.5 31 20.5 32 28.0 33 30.5 34 38.0 35 57.5 36 72.0 37 91.0 38 124.0 39 150.0 40 175.5 41 211.5 42 230.5 43 269.5 44 279.5 45 256.0 46 263.5 47 255.5 48 255.5 49 248.0 50 179.5 51 135.5 52 132.5 53 106.0 54 85.5 55 72.0 56 54.0 57 41.5 58 26.5 59 20.0 60 22.5 61 15.0 62 7.0 63 3.5 64 3.0 65 3.5 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.05860805860806 68.025 2 13.30891330891331 21.8 3 2.411477411477412 5.925 4 0.9157509157509158 3.0 5 0.3052503052503053 1.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATGAGCCAGTGTTTTCCCTGGTCCATCAAAAGGATACCGGTCCCCATG 5 0.125 No Hit TGGCCATCTCATCGTACATGGGTATGTGCTTGTCTTCCGCAAGGATAGCA 5 0.125 No Hit AGAGCAGCTTCCAAAATCACCTCTGTAGATTCTGCATCTGTGGCCTTGGC 5 0.125 No Hit GGGAGATTTCGTGGATCGAGTTCATCGAAAACAGGTCAAAACAGGAACCA 5 0.125 No Hit ATCCGAACATGGTATTGCTAATGTCATTCAACTTCATGGGTATCTATACT 5 0.125 No Hit GTCTTGGATGCAGAATTAAGTGCTTTCAACCCACTGCAGCAAGCTGCAGG 5 0.125 No Hit GCCATCACTTCCTTCAATATCACTAAGTCCATCAAGTGCTTCCTCCTCCT 5 0.125 No Hit GCTGTCAATGGACCGGTTGAATCGCGTGATTTAAAATTAGATACCGGAGA 5 0.125 No Hit TAACTTTGTGTTGGCCTCTTCTTACTTTACCTATGCCTCTTCTGCGCTTG 5 0.125 No Hit CCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.07500000000000001 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.3375 0.0 0.0 0.0 0.0 66-67 0.425 0.0 0.0 0.0 0.0 68-69 0.44999999999999996 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.7125 0.0 0.0 0.0 0.0 74-75 0.9125 0.0 0.0 0.0 0.0 76-77 1.1 0.0 0.0 0.0 0.0 78-79 1.3875 0.0 0.0 0.0 0.0 80-81 2.075 0.0 0.0 0.0 0.0 82-83 2.3499999999999996 0.0 0.0 0.0 0.0 84-85 2.6875 0.0 0.0 0.0 0.0 86-87 3.2125000000000004 0.0 0.0 0.0 0.0 88-89 3.825 0.0 0.0 0.0 0.0 90-91 4.475 0.0 0.0 0.0 0.0 92-93 5.0625 0.0 0.0 0.0 0.0 94-95 5.75 0.0 0.0 0.0 0.0 96-97 6.8375 0.0 0.0 0.0 0.0 98-99 7.8999999999999995 0.0 0.0 0.0 0.0 100-101 8.7625 0.0 0.0 0.0 0.0 102-103 9.95 0.0 0.0 0.0 0.0 104-105 11.149999999999999 0.0 0.0 0.0 0.0 106-107 12.100000000000001 0.0 0.0 0.0 0.0 108-109 13.15 0.0 0.0 0.0 0.0 110-111 14.2125 0.0 0.0 0.0 0.0 112-113 15.3875 0.0 0.0 0.0 0.0 114-115 16.4375 0.0 0.0 0.0 0.0 116-117 17.275 0.0 0.0 0.0 0.0 118-119 18.2 0.0 0.0 0.0 0.0 120-121 19.1 0.0 0.0 0.0 0.0 122-123 20.0625 0.0 0.0 0.0 0.0 124-125 21.1125 0.0 0.0 0.0 0.0 126-127 22.325000000000003 0.0 0.0 0.0 0.0 128-129 23.35 0.0 0.0 0.0 0.0 130-131 24.2375 0.0 0.0 0.0 0.0 132-133 25.325000000000003 0.0 0.0 0.0 0.0 134-135 26.3875 0.0 0.0 0.0 0.0 136-137 27.3 0.0 0.0 0.0 0.0 138-139 28.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGGA 10 0.006830828 145.0 8 TCTGCCA 10 0.006830828 145.0 8 ACCTCTG 10 0.006830828 145.0 7 >>END_MODULE SRR12670160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3975 37.0 37.0 37.0 37.0 37.0 2 36.365 37.0 37.0 37.0 37.0 37.0 3 36.256 37.0 37.0 37.0 37.0 37.0 4 36.294 37.0 37.0 37.0 37.0 37.0 5 36.44 37.0 37.0 37.0 37.0 37.0 6 36.443 37.0 37.0 37.0 37.0 37.0 7 36.3265 37.0 37.0 37.0 37.0 37.0 8 36.4105 37.0 37.0 37.0 37.0 37.0 9 36.452 37.0 37.0 37.0 37.0 37.0 10-14 36.408100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.408300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.405 37.0 37.0 37.0 37.0 37.0 25-29 36.382099999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3195 37.0 37.0 37.0 37.0 37.0 35-39 36.283699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.257600000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.258500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2333 37.0 37.0 37.0 37.0 37.0 55-59 36.1816 37.0 37.0 37.0 37.0 37.0 60-64 36.1599 37.0 37.0 37.0 37.0 37.0 65-69 36.155100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.05369999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.0721 37.0 37.0 37.0 37.0 37.0 80-84 36.0789 37.0 37.0 37.0 37.0 37.0 85-89 36.0124 37.0 37.0 37.0 37.0 37.0 90-94 36.025099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.994600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8507 37.0 37.0 37.0 37.0 37.0 105-109 35.769800000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.6349 37.0 37.0 37.0 37.0 37.0 115-119 35.4987 37.0 37.0 37.0 37.0 37.0 120-124 35.2429 37.0 37.0 37.0 34.6 37.0 125-129 35.0318 37.0 37.0 37.0 29.8 37.0 130-134 34.7307 37.0 37.0 37.0 25.0 37.0 135-139 34.2784 37.0 37.0 37.0 25.0 37.0 140-144 33.8559 37.0 37.0 37.0 25.0 37.0 145-149 33.333600000000004 37.0 37.0 37.0 11.0 37.0 150-151 33.0445 37.0 37.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 2.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 3.0 22 3.0 23 4.0 24 4.0 25 7.0 26 13.0 27 16.0 28 16.0 29 19.0 30 39.0 31 62.0 32 88.0 33 178.0 34 264.0 35 486.0 36 2477.0 37 311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 21.275 11.325000000000001 29.575000000000003 2 26.450000000000003 25.575 30.8 17.175 3 19.6 28.449999999999996 32.0 19.950000000000003 4 23.200000000000003 33.7 25.124999999999996 17.974999999999998 5 24.975 35.3 22.175 17.549999999999997 6 21.6 38.775 22.85 16.775000000000002 7 20.8 22.8 37.15 19.25 8 21.3 23.95 28.275 26.474999999999998 9 22.25 24.0 30.8 22.95 10-14 23.369999999999997 29.439999999999998 25.619999999999997 21.57 15-19 23.56 27.384999999999998 28.155 20.9 20-24 22.79 27.83 27.889999999999997 21.490000000000002 25-29 23.330000000000002 27.82 27.92 20.93 30-34 22.919999999999998 27.875 27.889999999999997 21.315 35-39 22.415 28.18 28.16 21.245 40-44 22.355 27.650000000000002 28.225 21.77 45-49 23.03 27.155 28.305000000000003 21.51 50-54 23.49 27.650000000000002 27.834999999999997 21.025 55-59 22.695 27.615000000000002 27.88 21.81 60-64 23.655 27.145000000000003 27.565 21.634999999999998 65-69 23.630000000000003 27.61 27.85 20.91 70-74 23.64 27.79 27.389999999999997 21.18 75-79 23.599999999999998 27.744999999999997 27.169999999999998 21.485000000000003 80-84 24.11 28.265 26.575 21.05 85-89 24.21 28.084999999999997 26.665 21.04 90-94 23.849999999999998 27.77 27.295 21.085 95-99 25.055 27.855 26.295 20.794999999999998 100-104 25.56 29.054999999999996 25.255 20.13 105-109 25.55 27.93 26.525 19.994999999999997 110-114 26.735 28.04 25.72 19.505 115-119 26.979999999999997 27.250000000000004 26.005 19.765 120-124 28.52 27.224999999999998 25.56 18.695 125-129 28.21 27.16 25.705 18.925 130-134 29.84 26.44 25.674999999999997 18.045 135-139 30.45 25.64 26.11 17.8 140-144 30.925000000000004 25.290000000000003 25.895000000000003 17.89 145-149 33.44 24.625 24.945 16.99 150-151 33.575 25.4375 23.525 17.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 1.0 25 2.5 26 4.5 27 4.0 28 5.5 29 6.0 30 7.0 31 13.0 32 20.5 33 30.0 34 42.5 35 69.0 36 95.0 37 116.5 38 130.0 39 144.5 40 184.0 41 217.5 42 238.0 43 253.0 44 266.0 45 265.5 46 267.5 47 233.0 48 217.5 49 222.0 50 195.0 51 160.5 52 121.0 53 96.0 54 74.0 55 69.0 56 55.5 57 39.5 58 32.0 59 26.5 60 18.5 61 11.5 62 9.0 63 5.5 64 3.5 65 3.0 66 2.0 67 0.5 68 0.0 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.05 #Duplication Level Percentage of deduplicated Percentage of total 1 83.24192565508835 68.30000000000001 2 13.132236441194395 21.55 3 2.4984765386959173 6.15 4 0.8226691042047531 2.7 5 0.2742230347349177 1.125 6 0.0 0.0 7 0.030469226081657527 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CCCGCTCCTTACTACTAGCATCAGCTGCTGTATACCTCTCTATCGATTCA 5 0.125 No Hit ACAGCATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATA 5 0.125 No Hit GTTGTTGGTTCGGACACCTTGAGGTCGGTCTGCTCAAAAGCTTTCCAAAC 5 0.125 No Hit GTTATGCTCAGCGGAGAGAGTGCAGCCGGGGCCTATCCAGAGCTTGCAGT 5 0.125 No Hit CAAACAATAACTCCTGTAATTTATGAGGACAATGATGAAAGTGACGAGGA 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit CGGAGGAAAGGAAATCACCGTTACATTTCCAAGACTGCAGCCATTGGTGT 5 0.125 No Hit CAACACTTTGGTTGTATAAATCTAATCCAACTTCCCAATTTGTTCATCTG 5 0.125 No Hit GGGAAGGCCTATGATGGAGTTGTCACAAAAAAGCCATTTGTACCAACTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.42500000000000004 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.6875 0.0 0.0 0.0 0.0 74-75 0.8875 0.0 0.0 0.0 0.0 76-77 1.1 0.0 0.0 0.0 0.0 78-79 1.4125 0.0 0.0 0.0 0.0 80-81 2.05 0.0 0.0 0.0 0.0 82-83 2.325 0.0 0.0 0.0 0.0 84-85 2.6624999999999996 0.0 0.0 0.0 0.0 86-87 3.2 0.0 0.0 0.0 0.0 88-89 3.825 0.0 0.0 0.0 0.0 90-91 4.4625 0.0 0.0 0.0 0.0 92-93 5.0625 0.0 0.0 0.0 0.0 94-95 5.775 0.0 0.0 0.0 0.0 96-97 6.9 0.0 0.0 0.0 0.0 98-99 7.9625 0.0 0.0 0.0 0.0 100-101 8.85 0.0 0.0 0.0 0.0 102-103 10.05 0.0 0.0 0.0 0.0 104-105 11.274999999999999 0.0 0.0 0.0 0.0 106-107 12.225000000000001 0.0 0.0 0.0 0.0 108-109 13.25 0.0 0.0 0.0 0.0 110-111 14.3125 0.0 0.0 0.0 0.0 112-113 15.524999999999999 0.0 0.0 0.0 0.0 114-115 16.575 0.0 0.0 0.0 0.0 116-117 17.4125 0.0 0.0 0.0 0.0 118-119 18.35 0.0 0.0 0.0 0.0 120-121 19.2625 0.0 0.0 0.0 0.0 122-123 20.2625 0.0 0.0 0.0 0.0 124-125 21.3375 0.0 0.0 0.0 0.0 126-127 22.575 0.0 0.0 0.0 0.0 128-129 23.65 0.0 0.0 0.0 0.0 130-131 24.5625 0.0 0.0 0.0 0.0 132-133 25.674999999999997 0.0 0.0 0.0 0.0 134-135 26.7625 0.0 0.0 0.0 0.0 136-137 27.65 0.0 0.0 0.0 0.0 138-139 28.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra Read 544717 spots for SRR12670160.sra Written 544717 spots for SRR12670160.sra Read 544701 spots for SRR12670160.sra Written 544701 spots for SRR12670160.sra SRR ids: ['SRR12670160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_szu9erz2 SRR12670160.sra spots: 10894036 blocks: [[1, 544701], [544702, 1089402], [1089403, 1634103], [1634104, 2178804], [2178805, 2723505], [2723506, 3268206], [3268207, 3812907], [3812908, 4357608], [4357609, 4902309], [4902310, 5447010], [5447011, 5991711], [5991712, 6536412], [6536413, 7081113], [7081114, 7625814], [7625815, 8170515], [8170516, 8715216], [8715217, 9259917], [9259918, 9804618], [9804619, 10349319], [10349320, 10894036]] SRR12670160 file size 3680569 SRR12670160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670160 SRR12670160_1.fastq SRR12670160_2.fastq Input file: SRR12670160_1.fastq Paired file: SRR12670160_2.fastq trimmed: SRR12670160-trimmed-pair1.fastq, SRR12670160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:34:10 2025 >> started Tue Feb 11 07:34:22 2025 >> done (12.268s) 10894036 read pairs processed; of these: 68 ( 0.00%) short read pairs filtered out after trimming by size control 6210 ( 0.06%) empty read pairs filtered out after trimming by size control 10887758 (99.94%) read pairs available; of these: 3606852 (33.13%) trimmed read pairs available after processing 7280906 (66.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 7 0.00% 21 9 0.00% 22 7 0.00% 23 10 0.00% 24 16 0.00% 25 26 0.00% 26 20 0.00% 27 33 0.00% 28 30 0.00% 29 50 0.00% 30 76 0.00% 31 73 0.00% 32 75 0.00% 33 102 0.00% 34 90 0.00% 35 91 0.00% 36 147 0.00% 37 150 0.00% 38 148 0.00% 39 181 0.00% 40 234 0.00% 41 213 0.00% 42 268 0.00% 43 264 0.00% 44 302 0.00% 45 293 0.00% 46 332 0.00% 47 469 0.00% 48 512 0.00% 49 671 0.01% 50 782 0.01% 51 818 0.01% 52 925 0.01% 53 1036 0.01% 54 1014 0.01% 55 1210 0.01% 56 1283 0.01% 57 1422 0.01% 58 1753 0.02% 59 2019 0.02% 60 2294 0.02% 61 2773 0.03% 62 3065 0.03% 63 3444 0.03% 64 3790 0.03% 65 4000 0.04% 66 4212 0.04% 67 4867 0.04% 68 5240 0.05% 69 5957 0.05% 70 7082 0.07% 71 7934 0.07% 72 8821 0.08% 73 9927 0.09% 74 10959 0.10% 75 11573 0.11% 76 12565 0.12% 77 13087 0.12% 78 14425 0.13% 79 16146 0.15% 80 17402 0.16% 81 18900 0.17% 82 21428 0.20% 83 22868 0.21% 84 24863 0.23% 85 27207 0.25% 86 27934 0.26% 87 28761 0.26% 88 30360 0.28% 89 31509 0.29% 90 32783 0.30% 91 35107 0.32% 92 37229 0.34% 93 39572 0.36% 94 41991 0.39% 95 43827 0.40% 96 44069 0.40% 97 45534 0.42% 98 45934 0.42% 99 46492 0.43% 100 47945 0.44% 101 48179 0.44% 102 49294 0.45% 103 50593 0.46% 104 52688 0.48% 105 53277 0.49% 106 54721 0.50% 107 55343 0.51% 108 53940 0.50% 109 54052 0.50% 110 53618 0.49% 111 53841 0.49% 112 54766 0.50% 113 55315 0.51% 114 55799 0.51% 115 57148 0.52% 116 57646 0.53% 117 57910 0.53% 118 57412 0.53% 119 56600 0.52% 120 56522 0.52% 121 55319 0.51% 122 55921 0.51% 123 55937 0.51% 124 56652 0.52% 125 56684 0.52% 126 57759 0.53% 127 57359 0.53% 128 57272 0.53% 129 56150 0.52% 130 56112 0.52% 131 55063 0.51% 132 54348 0.50% 133 55436 0.51% 134 55178 0.51% 135 54704 0.50% 136 54985 0.51% 137 55089 0.51% 138 54324 0.50% 139 54934 0.50% 140 53677 0.49% 141 52942 0.49% 142 53318 0.49% 143 52825 0.49% 144 52417 0.48% 145 52902 0.49% 146 52540 0.48% 147 52511 0.48% 148 52306 0.48% 149 51459 0.47% 150 51023 0.47% 151 7280906 66.87% 10887758 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=242.49 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=29.67 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.4 sequence=CCTTCTCCTTCCGATTAATCGCCTTCAGCACACAACACAAACAAGACCAGCAAAAACCAGGACAAAAAAGTTCAAGAATGGCCACTGTCACCTCTGCTGCTGTTTC SRR12670160 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:35:07 Started mapping on | Feb 11 07:35:08 Finished on | Feb 11 07:36:19 Mapping speed, Million of reads per hour | 552.06 Number of input reads | 10887758 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 10279048 Uniquely mapped reads % | 94.41% Average mapped length | 277.77 Number of splices: Total | 9430535 Number of splices: Annotated (sjdb) | 9239355 Number of splices: GT/AG | 9235895 Number of splices: GC/AG | 162726 Number of splices: AT/AC | 5400 Number of splices: Non-canonical | 26514 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251228 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 55938 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 357482 357482 357482 N_multimapping 251228 251228 251228 N_noFeature 350976 10150527 409698 N_ambiguous 127268 450 57221 UnstrandedReadsAssigned:9800804 PositiveStrandReadsAssigned:128071 NegativeStrandReadsAssigned:9812129 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=124 echo kmer=119 SRR12670160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670160-trimmed-pair1.fastq SRR12670160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,887,758 reads, 9,882,266 reads pseudoaligned [quant] estimated average fragment length: 194.364 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR12670160.ke.tsv 34699 SRR12670160.se.tsv 87100 total ==> SRR12670160.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1824.64 234 14.5139 Potri.005G024800.1.v4.1 1035 841.636 79 10.623 Potri.004G059700.1.v4.1 961 767.685 9 1.3268 Potri.007G009000.2.v4.1 1416 1222.64 0 0 Potri.003G141000.2.v4.1 2943 2749.64 483 19.88 Potri.016G087400.1.v4.1 270 116.648 454 440.477 Potri.015G069301.1.v4.1 564 377.488 0 0 Potri.010G195200.1.v4.1 1773 1579.64 14 1.00303 Potri.012G127500.1.v4.1 977 783.669 237 34.2263 ==> SRR12670160.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 554 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 127 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR12670160 completed mapping pipeline successfully