Starting /dee2/code/volunteer_pipeline.sh SRR12670162 current disk space = 3055801827328 free memory = 1462513716 SRR12670162 SRAfilesize 8328e6c78904aa0c0029c13759afe25a SRR12670162.sra SRR12670162.sra file validated SRR12670162 is paired end SRR12670162 is conventional basespace SRR12670162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.674 37.0 37.0 37.0 37.0 37.0 2 36.48075 37.0 37.0 37.0 37.0 37.0 3 36.6565 37.0 37.0 37.0 37.0 37.0 4 36.7205 37.0 37.0 37.0 37.0 37.0 5 36.682 37.0 37.0 37.0 37.0 37.0 6 36.6655 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.6475 37.0 37.0 37.0 37.0 37.0 9 36.6745 37.0 37.0 37.0 37.0 37.0 10-14 36.6133 37.0 37.0 37.0 37.0 37.0 15-19 36.579699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5598 37.0 37.0 37.0 37.0 37.0 25-29 36.5348 37.0 37.0 37.0 37.0 37.0 30-34 36.531 37.0 37.0 37.0 37.0 37.0 35-39 36.4884 37.0 37.0 37.0 37.0 37.0 40-44 36.4636 37.0 37.0 37.0 37.0 37.0 45-49 36.459500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.476800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.451299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.407000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.33 37.0 37.0 37.0 37.0 37.0 70-74 36.29 37.0 37.0 37.0 37.0 37.0 75-79 36.3369 37.0 37.0 37.0 37.0 37.0 80-84 36.3519 37.0 37.0 37.0 37.0 37.0 85-89 36.286100000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.3146 37.0 37.0 37.0 37.0 37.0 95-99 36.2349 37.0 37.0 37.0 37.0 37.0 100-104 36.2276 37.0 37.0 37.0 37.0 37.0 105-109 36.2175 37.0 37.0 37.0 37.0 37.0 110-114 36.1404 37.0 37.0 37.0 37.0 37.0 115-119 36.217 37.0 37.0 37.0 37.0 37.0 120-124 36.073899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.968599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.887699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.7668 37.0 37.0 37.0 37.0 37.0 140-144 35.4667 37.0 37.0 37.0 37.0 37.0 145-149 35.3812 37.0 37.0 37.0 37.0 37.0 150-151 35.1535 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 5.0 27 2.0 28 11.0 29 18.0 30 31.0 31 34.0 32 45.0 33 72.0 34 131.0 35 346.0 36 2939.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.95 11.225 8.0 41.825 2 20.235411970949162 13.19809666917105 36.614074630603554 29.952416729276234 3 18.75 18.475 26.700000000000003 36.075 4 23.375 24.9 21.575 30.15 5 21.675 32.875 24.25 21.2 6 19.025 34.475 25.05 21.45 7 15.4 24.65 41.85 18.099999999999998 8 17.125 25.124999999999996 32.574999999999996 25.174999999999997 9 17.825 23.325000000000003 35.099999999999994 23.75 10-14 20.14 29.79 27.11 22.96 15-19 20.495 28.54 27.355 23.61 20-24 19.7 28.475 28.050000000000004 23.775 25-29 20.575 27.465 27.589999999999996 24.37 30-34 20.315 28.405 27.534999999999997 23.745 35-39 20.505000000000003 28.28 26.950000000000003 24.265 40-44 20.974999999999998 27.779999999999998 27.975 23.27 45-49 20.560000000000002 28.07 27.845 23.525 50-54 20.724999999999998 27.169999999999998 27.884999999999998 24.22 55-59 19.919999999999998 28.525 27.555000000000003 24.0 60-64 20.115 28.1 27.845 23.94 65-69 21.365000000000002 28.144999999999996 27.689999999999998 22.8 70-74 20.845 27.900000000000002 28.065 23.189999999999998 75-79 20.48 28.76 27.105 23.655 80-84 20.25 28.515 28.02 23.215 85-89 21.195 28.935 26.875 22.994999999999997 90-94 21.245 28.23 27.544999999999998 22.98 95-99 21.27 28.835 26.69 23.205000000000002 100-104 22.095000000000002 29.005 25.845000000000002 23.055 105-109 22.0 27.955000000000002 26.415 23.630000000000003 110-114 21.865000000000002 28.765 25.790000000000003 23.580000000000002 115-119 21.935 28.92 25.905 23.24 120-124 21.765 28.325 25.509999999999998 24.4 125-129 21.69 28.28 25.72 24.310000000000002 130-134 22.07 27.544999999999998 26.424999999999997 23.96 135-139 21.790000000000003 27.884999999999998 25.86 24.465 140-144 22.225 27.36 26.395000000000003 24.02 145-149 23.69 27.07 25.605 23.635 150-151 23.7625 26.525 25.6 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.0 25 1.5 26 2.5 27 5.5 28 5.5 29 4.5 30 10.0 31 16.5 32 26.5 33 36.5 34 51.0 35 68.5 36 72.5 37 99.0 38 134.0 39 142.0 40 170.0 41 219.5 42 246.5 43 253.5 44 255.5 45 273.0 46 283.0 47 253.5 48 241.5 49 223.0 50 186.0 51 154.0 52 113.0 53 103.0 54 96.0 55 69.0 56 50.0 57 42.5 58 33.5 59 19.5 60 12.0 61 6.5 62 4.0 63 3.0 64 0.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.05 #Duplication Level Percentage of deduplicated Percentage of total 1 82.35831809872029 67.575 2 14.168190127970751 23.25 3 2.803168799512492 6.9 4 0.578915295551493 1.9 5 0.09140767824497258 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAGGCAAAGGCAGTGTGAAGAGGAGCACATATGGGAAGTAGTCCATGT 5 0.125 No Hit GCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGG 5 0.125 No Hit CTTGTGAAATAAAAATAAATATGAAGTTTAATGCGCAATTACAGGCTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.32499999999999996 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.5625 0.0 0.0 0.0 0.0 72-73 0.7749999999999999 0.0 0.0 0.0 0.0 74-75 1.025 0.0 0.0 0.0 0.0 76-77 1.2875 0.0 0.0 0.0 0.0 78-79 1.5875 0.0 0.0 0.0 0.0 80-81 1.9875 0.0 0.0 0.0 0.0 82-83 2.2750000000000004 0.0 0.0 0.0 0.0 84-85 2.7 0.0 0.0 0.0 0.0 86-87 3.3125 0.0 0.0 0.0 0.0 88-89 3.9499999999999997 0.0 0.0 0.0 0.0 90-91 4.525 0.0 0.0 0.0 0.0 92-93 5.35 0.0 0.0 0.0 0.0 94-95 6.2875 0.0 0.0 0.0 0.0 96-97 7.125 0.0 0.0 0.0 0.0 98-99 7.7875 0.0 0.0 0.0 0.0 100-101 8.85 0.0 0.0 0.0 0.0 102-103 9.6625 0.0 0.0 0.0 0.0 104-105 10.4875 0.0 0.0 0.0 0.0 106-107 11.587499999999999 0.0 0.0 0.0 0.0 108-109 12.6625 0.0 0.0 0.0 0.0 110-111 13.7 0.0 0.0 0.0 0.0 112-113 14.75 0.0 0.0 0.0 0.0 114-115 15.65 0.0 0.0 0.0 0.0 116-117 16.9 0.0 0.0 0.0 0.0 118-119 17.9125 0.0 0.0 0.0 0.0 120-121 18.525 0.0 0.0 0.0 0.0 122-123 19.45 0.0 0.0 0.0 0.0 124-125 20.475 0.0 0.0 0.0 0.0 126-127 21.325 0.0125 0.0 0.0 0.0 128-129 22.1375 0.025 0.0 0.0 0.0 130-131 23.15 0.025 0.0 0.0 0.0 132-133 24.049999999999997 0.025 0.0 0.0 0.0 134-135 24.9125 0.025 0.0 0.0 0.0 136-137 25.75 0.025 0.0 0.0 0.0 138-139 26.637500000000003 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1945 37.0 37.0 37.0 37.0 37.0 2 36.224 37.0 37.0 37.0 37.0 37.0 3 36.229 37.0 37.0 37.0 37.0 37.0 4 36.4315 37.0 37.0 37.0 37.0 37.0 5 36.376 37.0 37.0 37.0 37.0 37.0 6 36.4595 37.0 37.0 37.0 37.0 37.0 7 36.3735 37.0 37.0 37.0 37.0 37.0 8 36.346 37.0 37.0 37.0 37.0 37.0 9 36.2755 37.0 37.0 37.0 37.0 37.0 10-14 36.339 37.0 37.0 37.0 37.0 37.0 15-19 36.3402 37.0 37.0 37.0 37.0 37.0 20-24 36.2776 37.0 37.0 37.0 37.0 37.0 25-29 36.2275 37.0 37.0 37.0 37.0 37.0 30-34 36.2149 37.0 37.0 37.0 37.0 37.0 35-39 36.2317 37.0 37.0 37.0 37.0 37.0 40-44 36.1779 37.0 37.0 37.0 37.0 37.0 45-49 36.1613 37.0 37.0 37.0 37.0 37.0 50-54 36.1587 37.0 37.0 37.0 37.0 37.0 55-59 36.1459 37.0 37.0 37.0 37.0 37.0 60-64 36.12670000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1383 37.0 37.0 37.0 37.0 37.0 70-74 36.0416 37.0 37.0 37.0 37.0 37.0 75-79 36.074200000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.013999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.95869999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.9064 37.0 37.0 37.0 37.0 37.0 95-99 35.9109 37.0 37.0 37.0 37.0 37.0 100-104 35.78189999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.725199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.6564 37.0 37.0 37.0 37.0 37.0 115-119 35.6262 37.0 37.0 37.0 37.0 37.0 120-124 35.388999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.2127 37.0 37.0 37.0 29.8 37.0 130-134 34.995799999999996 37.0 37.0 37.0 29.8 37.0 135-139 34.7638 37.0 37.0 37.0 25.0 37.0 140-144 34.43729999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.0407 37.0 37.0 37.0 25.0 37.0 150-151 33.66675 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 2.0 16 0.0 17 2.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 6.0 24 4.0 25 4.0 26 6.0 27 10.0 28 15.0 29 20.0 30 23.0 31 51.0 32 82.0 33 153.0 34 258.0 35 595.0 36 2491.0 37 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35 21.375 11.075 28.199999999999996 2 25.074999999999996 26.5 31.525 16.900000000000002 3 20.849999999999998 26.400000000000002 32.324999999999996 20.424999999999997 4 22.725 34.475 23.0 19.8 5 26.224999999999998 35.099999999999994 22.0 16.675 6 18.85 40.375 22.275 18.5 7 20.4 20.674999999999997 37.425000000000004 21.5 8 20.1 25.45 29.325000000000003 25.124999999999996 9 21.575 24.224999999999998 30.349999999999998 23.849999999999998 10-14 23.11 28.975 26.36 21.555 15-19 22.905 27.875 27.800000000000004 21.42 20-24 23.115 28.555000000000003 27.355 20.974999999999998 25-29 22.869999999999997 28.365000000000002 28.055000000000003 20.71 30-34 22.555 28.65 27.735 21.060000000000002 35-39 22.8 27.47 28.285 21.445 40-44 23.23 28.470000000000002 27.49 20.810000000000002 45-49 22.78 27.900000000000002 28.384999999999998 20.935000000000002 50-54 22.98 28.28 28.26 20.48 55-59 23.175 27.560000000000002 27.839999999999996 21.425 60-64 22.835 28.575 27.07 21.52 65-69 23.04 27.99 28.055000000000003 20.915 70-74 23.31 27.97 27.435 21.285 75-79 23.48 27.750000000000004 27.71 21.060000000000002 80-84 23.04 28.455000000000002 26.805 21.7 85-89 23.68 28.34 27.11 20.87 90-94 24.68 27.310000000000002 27.474999999999998 20.535 95-99 24.75 28.16 26.685 20.405 100-104 25.365 28.325 26.595000000000002 19.715 105-109 25.509999999999998 27.99 26.455000000000002 20.044999999999998 110-114 25.88 27.76 26.605 19.755 115-119 27.145000000000003 28.439999999999998 25.47 18.945 120-124 27.855 27.755000000000003 25.96 18.43 125-129 27.779999999999998 27.529999999999998 26.215 18.475 130-134 29.189999999999998 27.145000000000003 25.759999999999998 17.904999999999998 135-139 29.615000000000002 26.950000000000003 25.790000000000003 17.645 140-144 30.75 26.345000000000002 25.580000000000002 17.325 145-149 32.415 25.745 24.88 16.96 150-151 33.4625 25.637500000000003 24.3875 16.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 3.0 26 2.0 27 2.0 28 5.5 29 9.0 30 12.5 31 18.5 32 25.0 33 34.5 34 44.5 35 62.0 36 92.5 37 111.0 38 133.5 39 161.0 40 192.0 41 239.0 42 261.0 43 264.5 44 265.0 45 265.0 46 263.0 47 251.0 48 216.0 49 193.5 50 181.5 51 143.5 52 112.0 53 93.5 54 77.5 55 66.0 56 49.5 57 38.5 58 30.5 59 16.5 60 14.0 61 11.0 62 6.0 63 3.0 64 2.0 65 4.0 66 3.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 82.94902912621359 68.35 2 13.713592233009708 22.6 3 2.578883495145631 6.375 4 0.5764563106796117 1.9 5 0.15169902912621358 0.625 6 0.030339805825242715 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCA 5 0.125 No Hit GCTACCTTTTGGCCCTATGGAAATGTGGAGAGTTCCGCAGATTCTCCAGC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.32499999999999996 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.5625 0.0 0.0 0.0 0.0 72-73 0.8125 0.0 0.0 0.0 0.0 74-75 1.075 0.0 0.0 0.0 0.0 76-77 1.3375 0.0 0.0 0.0 0.0 78-79 1.6375000000000002 0.0 0.0 0.0 0.0 80-81 2.025 0.0 0.0 0.0 0.0 82-83 2.3 0.0 0.0 0.0 0.0 84-85 2.725 0.0 0.0 0.0 0.0 86-87 3.3375 0.0 0.0 0.0 0.0 88-89 3.975 0.0 0.0 0.0 0.0 90-91 4.5375 0.0 0.0 0.0 0.0 92-93 5.35 0.0 0.0 0.0 0.0 94-95 6.275 0.0 0.0 0.0 0.0 96-97 7.1 0.0 0.0 0.0 0.0 98-99 7.762499999999999 0.0 0.0 0.0 0.0 100-101 8.825 0.0 0.0 0.0 0.0 102-103 9.6625 0.0 0.0 0.0 0.0 104-105 10.4875 0.0 0.0 0.0 0.0 106-107 11.587499999999999 0.0 0.0 0.0 0.0 108-109 12.6875 0.0 0.0 0.0 0.0 110-111 13.725000000000001 0.0 0.0 0.0 0.0 112-113 14.7625 0.0 0.0 0.0 0.0 114-115 15.65 0.0 0.0 0.0 0.0 116-117 16.9 0.0 0.0 0.0 0.0 118-119 17.9125 0.0 0.0 0.0 0.0 120-121 18.525 0.0 0.0 0.0 0.0 122-123 19.4625 0.0 0.0 0.0 0.0 124-125 20.4625 0.0 0.0 0.0 0.0 126-127 21.3125 0.0 0.0 0.0 0.0 128-129 22.125 0.0 0.0 0.0 0.0 130-131 23.125 0.0 0.0 0.0 0.0 132-133 24.012500000000003 0.0 0.0 0.0 0.0 134-135 24.8625 0.0 0.0 0.0 0.0 136-137 25.725 0.0 0.0 0.0 0.0 138-139 26.612499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAC 10 0.006830828 145.0 2 GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562126 spots for SRR12670162.sra Written 562126 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra Read 562123 spots for SRR12670162.sra Written 562123 spots for SRR12670162.sra SRR ids: ['SRR12670162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r93gxce_ SRR12670162.sra spots: 11242463 blocks: [[1, 562123], [562124, 1124246], [1124247, 1686369], [1686370, 2248492], [2248493, 2810615], [2810616, 3372738], [3372739, 3934861], [3934862, 4496984], [4496985, 5059107], [5059108, 5621230], [5621231, 6183353], [6183354, 6745476], [6745477, 7307599], [7307600, 7869722], [7869723, 8431845], [8431846, 8993968], [8993969, 9556091], [9556092, 10118214], [10118215, 10680337], [10680338, 11242463]] SRR12670162 file size 3798980 SRR12670162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670162 SRR12670162_1.fastq SRR12670162_2.fastq Input file: SRR12670162_1.fastq Paired file: SRR12670162_2.fastq trimmed: SRR12670162-trimmed-pair1.fastq, SRR12670162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:09:06 2025 >> started Tue Feb 11 08:09:24 2025 >> done (18.577s) 11242463 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 3211 ( 0.03%) empty read pairs filtered out after trimming by size control 11239194 (99.97%) read pairs available; of these: 3482393 (30.98%) trimmed read pairs available after processing 7756801 (69.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 10 0.00% 22 16 0.00% 23 18 0.00% 24 15 0.00% 25 20 0.00% 26 34 0.00% 27 38 0.00% 28 55 0.00% 29 49 0.00% 30 66 0.00% 31 74 0.00% 32 73 0.00% 33 87 0.00% 34 91 0.00% 35 114 0.00% 36 131 0.00% 37 162 0.00% 38 182 0.00% 39 223 0.00% 40 223 0.00% 41 262 0.00% 42 307 0.00% 43 286 0.00% 44 345 0.00% 45 355 0.00% 46 452 0.00% 47 513 0.00% 48 650 0.01% 49 756 0.01% 50 849 0.01% 51 1068 0.01% 52 1116 0.01% 53 1113 0.01% 54 1212 0.01% 55 1270 0.01% 56 1498 0.01% 57 1623 0.01% 58 1924 0.02% 59 2278 0.02% 60 2746 0.02% 61 3362 0.03% 62 3710 0.03% 63 3870 0.03% 64 4064 0.04% 65 4467 0.04% 66 4816 0.04% 67 5203 0.05% 68 5940 0.05% 69 6743 0.06% 70 7790 0.07% 71 8948 0.08% 72 10094 0.09% 73 11318 0.10% 74 12202 0.11% 75 13020 0.12% 76 13582 0.12% 77 14436 0.13% 78 15536 0.14% 79 17419 0.15% 80 18271 0.16% 81 20709 0.18% 82 23210 0.21% 83 24853 0.22% 84 26666 0.24% 85 28234 0.25% 86 29605 0.26% 87 29993 0.27% 88 31160 0.28% 89 31914 0.28% 90 34091 0.30% 91 35923 0.32% 92 37618 0.33% 93 40866 0.36% 94 42285 0.38% 95 44095 0.39% 96 43871 0.39% 97 44466 0.40% 98 45013 0.40% 99 44858 0.40% 100 46190 0.41% 101 46692 0.42% 102 48766 0.43% 103 50456 0.45% 104 51759 0.46% 105 52432 0.47% 106 52722 0.47% 107 52097 0.46% 108 51482 0.46% 109 50899 0.45% 110 50821 0.45% 111 51468 0.46% 112 52536 0.47% 113 52701 0.47% 114 53903 0.48% 115 54470 0.48% 116 55124 0.49% 117 54273 0.48% 118 54263 0.48% 119 52643 0.47% 120 52810 0.47% 121 52747 0.47% 122 53033 0.47% 123 52801 0.47% 124 54208 0.48% 125 54222 0.48% 126 54575 0.49% 127 53217 0.47% 128 52254 0.46% 129 51359 0.46% 130 51384 0.46% 131 50507 0.45% 132 50641 0.45% 133 51547 0.46% 134 51172 0.46% 135 51762 0.46% 136 51845 0.46% 137 50966 0.45% 138 49993 0.44% 139 50490 0.45% 140 50080 0.45% 141 49042 0.44% 142 49005 0.44% 143 48986 0.44% 144 49702 0.44% 145 49255 0.44% 146 49073 0.44% 147 48765 0.43% 148 49168 0.44% 149 47936 0.43% 150 47615 0.42% 151 7756801 69.02% 11239194 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=23.46 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.8 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=1.03 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=56.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.1 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR12670162 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:10:11 Started mapping on | Feb 11 08:10:11 Finished on | Feb 11 08:13:20 Mapping speed, Million of reads per hour | 214.08 Number of input reads | 11239194 Average input read length | 279 UNIQUE READS: Uniquely mapped reads number | 10512087 Uniquely mapped reads % | 93.53% Average mapped length | 278.23 Number of splices: Total | 9790248 Number of splices: Annotated (sjdb) | 9565650 Number of splices: GT/AG | 9581653 Number of splices: GC/AG | 164259 Number of splices: AT/AC | 6024 Number of splices: Non-canonical | 38312 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249248 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 26743 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477859 477859 477859 N_multimapping 249248 249248 249248 N_noFeature 412463 10351252 482865 N_ambiguous 151574 554 60818 UnstrandedReadsAssigned:9948050 PositiveStrandReadsAssigned:160281 NegativeStrandReadsAssigned:9968404 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=126 echo kmer=121 SRR12670162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670162-trimmed-pair1.fastq SRR12670162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,239,194 reads, 9,974,635 reads pseudoaligned [quant] estimated average fragment length: 201.815 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 SRR12670162.ke.tsv 34699 SRR12670162.se.tsv 87100 total ==> SRR12670162.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1817.18 405 22.6088 Potri.005G024800.1.v4.1 1035 834.185 237 28.8209 Potri.004G059700.1.v4.1 961 760.279 1 0.133428 Potri.007G009000.2.v4.1 1416 1215.18 0 0 Potri.003G141000.2.v4.1 2943 2742.18 777.532 28.7636 Potri.016G087400.1.v4.1 270 116.641 358.133 311.469 Potri.015G069301.1.v4.1 564 371.296 0 0 Potri.010G195200.1.v4.1 1773 1572.18 86 5.54902 Potri.012G127500.1.v4.1 977 776.237 41 5.3581 ==> SRR12670162.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 5 SRR12670162 completed mapping pipeline successfully