Starting /dee2/code/volunteer_pipeline.sh SRR12670164 current disk space = 3055807258624 free memory = 1481802496 SRR12670164 SRAfilesize d4f44a0682b9f0dabf9234d420197bd0 SRR12670164.sra SRR12670164.sra file validated SRR12670164 is paired end SRR12670164 is conventional basespace SRR12670164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.657 37.0 37.0 37.0 37.0 37.0 2 36.509 37.0 37.0 37.0 37.0 37.0 3 36.6315 37.0 37.0 37.0 37.0 37.0 4 36.661 37.0 37.0 37.0 37.0 37.0 5 36.638 37.0 37.0 37.0 37.0 37.0 6 36.67 37.0 37.0 37.0 37.0 37.0 7 36.6715 37.0 37.0 37.0 37.0 37.0 8 36.636 37.0 37.0 37.0 37.0 37.0 9 36.6315 37.0 37.0 37.0 37.0 37.0 10-14 36.6558 37.0 37.0 37.0 37.0 37.0 15-19 36.593500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.551100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5317 37.0 37.0 37.0 37.0 37.0 30-34 36.4858 37.0 37.0 37.0 37.0 37.0 35-39 36.468399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.432599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.412400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.394999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.418099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.333000000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.348499999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.30409999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.28189999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.304899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2842 37.0 37.0 37.0 37.0 37.0 90-94 36.2842 37.0 37.0 37.0 37.0 37.0 95-99 36.1927 37.0 37.0 37.0 37.0 37.0 100-104 36.231700000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.237300000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1204 37.0 37.0 37.0 37.0 37.0 115-119 36.1108 37.0 37.0 37.0 37.0 37.0 120-124 35.954899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.77400000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.6819 37.0 37.0 37.0 37.0 37.0 135-139 35.4224 37.0 37.0 37.0 37.0 37.0 140-144 35.0544 37.0 37.0 37.0 27.4 37.0 145-149 34.7756 37.0 37.0 37.0 25.0 37.0 150-151 34.467749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 4.0 26 3.0 27 6.0 28 9.0 29 22.0 30 25.0 31 31.0 32 57.0 33 124.0 34 176.0 35 339.0 36 2791.0 37 408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.375 10.525 5.4 39.7 2 18.293293293293296 12.162162162162163 36.93693693693694 32.607607607607605 3 16.575 17.549999999999997 30.425 35.449999999999996 4 22.625 24.625 24.425 28.325 5 23.9 31.324999999999996 23.775 21.0 6 19.45 35.65 23.65 21.25 7 15.9 25.174999999999997 42.175000000000004 16.75 8 17.349999999999998 24.4 33.074999999999996 25.174999999999997 9 17.2 25.45 32.300000000000004 25.05 10-14 20.655 29.134999999999998 27.060000000000002 23.150000000000002 15-19 20.765 27.975 27.79 23.47 20-24 20.669999999999998 27.644999999999996 28.49 23.195 25-29 20.580000000000002 27.63 28.389999999999997 23.400000000000002 30-34 19.97 27.975 28.34 23.715 35-39 20.02 27.944999999999997 28.575 23.46 40-44 20.43 28.439999999999998 27.685 23.445 45-49 20.345 28.12 27.375 24.16 50-54 20.24 28.03 28.175 23.555 55-59 20.775 27.894999999999996 27.800000000000004 23.53 60-64 20.73 27.834999999999997 27.97 23.465 65-69 21.73 28.03 27.355 22.884999999999998 70-74 20.335 27.894999999999996 27.71 24.060000000000002 75-79 19.89 28.46 27.700000000000003 23.95 80-84 20.855 28.384999999999998 27.889999999999997 22.869999999999997 85-89 20.919999999999998 28.34 27.310000000000002 23.43 90-94 21.115000000000002 27.894999999999996 27.235 23.755000000000003 95-99 21.19 27.944999999999997 27.169999999999998 23.695 100-104 22.11 28.610000000000003 26.71 22.57 105-109 21.73 27.655 26.985 23.630000000000003 110-114 21.92 28.255000000000003 26.21 23.615 115-119 22.650000000000002 28.754999999999995 25.900000000000002 22.695 120-124 21.75 27.900000000000002 25.985000000000003 24.365000000000002 125-129 21.88 27.955000000000002 25.735000000000003 24.43 130-134 21.88 27.439999999999998 26.085 24.595 135-139 22.2 27.97 25.735000000000003 24.095 140-144 22.295 27.165 25.81 24.73 145-149 23.1 27.084999999999997 26.16 23.655 150-151 23.1125 27.187499999999996 25.4875 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 3.0 26 4.0 27 6.0 28 11.5 29 11.0 30 6.5 31 17.0 32 29.0 33 31.5 34 42.5 35 55.0 36 86.0 37 108.5 38 126.5 39 161.0 40 191.5 41 207.5 42 217.0 43 254.0 44 268.5 45 264.5 46 251.5 47 251.5 48 265.5 49 224.5 50 190.5 51 164.0 52 129.0 53 93.5 54 69.5 55 65.5 56 50.0 57 39.0 58 31.5 59 22.5 60 15.0 61 10.0 62 5.0 63 3.5 64 4.0 65 2.0 66 1.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.8 #Duplication Level Percentage of deduplicated Percentage of total 1 83.00733496332519 67.9 2 13.141809290953546 21.5 3 2.8422982885085575 6.9750000000000005 4 0.7640586797066015 2.5 5 0.1528117359413203 0.625 6 0.030562347188264057 0.15 7 0.061124694376528114 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGCACCCGATGAAGGTTCCTCCGGTGCTACACTTCACTTTAGCACATC 7 0.17500000000000002 No Hit CTGAAAATGAGAACCTAACAAGTAACAAGGTCATCTTCGCCCAACTTTTC 7 0.17500000000000002 No Hit GACGGCGCTCCTCAAGGTACTCTAATTGGTCTTCCTTAAGGAAGAGTGTG 6 0.15 No Hit ATTGCATGTTCTTTTTTTTGTGTGTGTTTTGAGAGATAAGTGTGTTGTTG 5 0.125 No Hit CCTGTTTTAGGATATGTTCCAAGGTAACTGGATTTATGCGCTCGAGTATT 5 0.125 No Hit GCAAGCATAAGTTATCCCTTCGTCCACACAAATCATATTCGTTGCGCAAA 5 0.125 No Hit GGCTAACCATTTTGGCTCAATGAAACCTCCTGTGCCTTCGGGGTCTGAAA 5 0.125 No Hit CGTCAGAGTATTCATGTCAAATGATGCCATCTCCATCTCCTCCATGTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.2125 0.0 0.0 0.0 0.0 64-65 0.32499999999999996 0.0 0.0 0.0 0.0 66-67 0.3625 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5874999999999999 0.0 0.0 0.0 0.0 72-73 0.7749999999999999 0.0 0.0 0.0 0.0 74-75 1.0125 0.0 0.0 0.0 0.0 76-77 1.25 0.0 0.0 0.0 0.0 78-79 1.475 0.0 0.0 0.0 0.0 80-81 1.725 0.0 0.0 0.0 0.0 82-83 2.075 0.0 0.0 0.0 0.0 84-85 2.475 0.0 0.0 0.0 0.0 86-87 2.95 0.0 0.0 0.0 0.0 88-89 3.3875 0.0 0.0 0.0 0.0 90-91 3.8625 0.0 0.0 0.0 0.0 92-93 4.4875 0.0 0.0 0.0 0.0 94-95 5.4125 0.0 0.0 0.0 0.0 96-97 6.125 0.0 0.0 0.0 0.0 98-99 6.9125 0.0 0.0 0.0 0.0 100-101 7.75 0.0 0.0 0.0 0.0 102-103 8.4625 0.0 0.0 0.0 0.0 104-105 9.4125 0.0 0.0 0.0 0.0 106-107 10.337499999999999 0.0 0.0 0.0 0.0 108-109 11.525 0.0 0.0 0.0 0.0 110-111 12.35 0.0 0.0 0.0 0.0 112-113 13.1875 0.0 0.0 0.0 0.0 114-115 14.287500000000001 0.0 0.0 0.0 0.0 116-117 15.55 0.0 0.0 0.0 0.0 118-119 16.65 0.0 0.0 0.0 0.0 120-121 17.6 0.0 0.0 0.0 0.0 122-123 18.4375 0.0 0.0 0.0 0.0 124-125 19.1125 0.0 0.0 0.0 0.0 126-127 20.1875 0.0 0.0 0.0 0.0 128-129 21.3875 0.0 0.0 0.0 0.0 130-131 22.3375 0.0 0.0 0.0 0.0 132-133 23.1875 0.0 0.0 0.0 0.0 134-135 24.05 0.0 0.0 0.0 0.0 136-137 25.1875 0.0 0.0 0.0 0.0 138-139 26.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAATG 10 0.006830828 145.0 8 GCCAGAT 10 0.006830828 145.0 1 GATTTAA 10 0.006830828 145.0 5 TTTAATC 10 0.006830828 145.0 7 ATTTAAT 10 0.006830828 145.0 6 >>END_MODULE SRR12670164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3145 37.0 37.0 37.0 37.0 37.0 2 36.151 37.0 37.0 37.0 37.0 37.0 3 36.1465 37.0 37.0 37.0 37.0 37.0 4 36.3105 37.0 37.0 37.0 37.0 37.0 5 36.3195 37.0 37.0 37.0 37.0 37.0 6 36.2775 37.0 37.0 37.0 37.0 37.0 7 36.228 37.0 37.0 37.0 37.0 37.0 8 36.248 37.0 37.0 37.0 37.0 37.0 9 36.1835 37.0 37.0 37.0 37.0 37.0 10-14 36.2306 37.0 37.0 37.0 37.0 37.0 15-19 36.2262 37.0 37.0 37.0 37.0 37.0 20-24 36.1319 37.0 37.0 37.0 37.0 37.0 25-29 36.1558 37.0 37.0 37.0 37.0 37.0 30-34 36.1297 37.0 37.0 37.0 37.0 37.0 35-39 36.025800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0574 37.0 37.0 37.0 37.0 37.0 45-49 36.0404 37.0 37.0 37.0 37.0 37.0 50-54 35.9872 37.0 37.0 37.0 37.0 37.0 55-59 35.9716 37.0 37.0 37.0 37.0 37.0 60-64 35.9582 37.0 37.0 37.0 37.0 37.0 65-69 35.9234 37.0 37.0 37.0 37.0 37.0 70-74 35.9297 37.0 37.0 37.0 37.0 37.0 75-79 35.832100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.791000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8104 37.0 37.0 37.0 37.0 37.0 90-94 35.8601 37.0 37.0 37.0 37.0 37.0 95-99 35.7976 37.0 37.0 37.0 37.0 37.0 100-104 35.7323 37.0 37.0 37.0 37.0 37.0 105-109 35.657 37.0 37.0 37.0 37.0 37.0 110-114 35.425 37.0 37.0 37.0 37.0 37.0 115-119 35.4776 37.0 37.0 37.0 37.0 37.0 120-124 35.2417 37.0 37.0 37.0 32.2 37.0 125-129 35.0841 37.0 37.0 37.0 29.8 37.0 130-134 34.7441 37.0 37.0 37.0 25.0 37.0 135-139 34.4813 37.0 37.0 37.0 25.0 37.0 140-144 34.19840000000001 37.0 37.0 37.0 25.0 37.0 145-149 33.9294 37.0 37.0 37.0 25.0 37.0 150-151 33.610749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 6.0 13 8.0 14 4.0 15 2.0 16 3.0 17 2.0 18 0.0 19 2.0 20 3.0 21 4.0 22 7.0 23 4.0 24 7.0 25 8.0 26 12.0 27 11.0 28 17.0 29 21.0 30 26.0 31 67.0 32 77.0 33 135.0 34 269.0 35 580.0 36 2474.0 37 251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.575 23.525 8.475000000000001 26.424999999999997 2 25.775 26.650000000000002 31.125000000000004 16.45 3 20.65 27.05 33.4 18.9 4 23.825 34.8 22.525000000000002 18.85 5 25.5 37.15 20.775 16.575 6 21.05 38.4 22.275 18.275 7 19.5 24.7 36.825 18.975 8 19.875 26.525 28.749999999999996 24.85 9 23.400000000000002 25.924999999999997 28.725 21.95 10-14 23.535 29.38 26.14 20.945 15-19 22.945 27.425 28.42 21.21 20-24 23.21 28.444999999999997 27.63 20.715 25-29 22.935 28.360000000000003 27.595 21.11 30-34 22.770000000000003 28.205000000000002 28.425 20.599999999999998 35-39 22.915 27.925 28.110000000000003 21.05 40-44 22.785 28.689999999999998 27.36 21.165 45-49 22.825 28.285 28.165000000000003 20.724999999999998 50-54 22.955000000000002 28.88 27.0 21.165 55-59 23.215 28.139999999999997 27.985 20.66 60-64 22.745 28.720000000000002 27.48 21.055 65-69 22.845 27.450000000000003 28.435 21.27 70-74 23.705000000000002 28.34 27.229999999999997 20.724999999999998 75-79 22.765 29.56 26.755000000000003 20.919999999999998 80-84 23.77 28.335 26.650000000000002 21.245 85-89 24.865000000000002 28.09 26.58 20.465 90-94 24.91 28.444999999999997 25.979999999999997 20.665 95-99 25.1 28.675 25.83 20.395 100-104 24.75 28.825 26.055 20.369999999999997 105-109 26.05 28.83 25.66 19.46 110-114 26.555 28.1 26.040000000000003 19.305 115-119 27.029999999999998 28.68 25.490000000000002 18.8 120-124 27.865000000000002 27.584999999999997 25.715 18.834999999999997 125-129 28.205000000000002 28.12 25.28 18.395 130-134 28.804999999999996 27.52 25.290000000000003 18.385 135-139 29.87 27.49 25.085 17.555 140-144 30.15 26.51 25.665 17.675 145-149 32.81 26.029999999999998 24.805 16.355 150-151 32.95 25.2 25.112499999999997 16.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.5 14 0.5 15 1.5 16 1.5 17 1.5 18 2.0 19 2.0 20 1.5 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 3.5 27 5.0 28 6.0 29 5.5 30 8.0 31 18.5 32 31.5 33 44.5 34 56.5 35 66.0 36 80.5 37 112.0 38 139.0 39 153.0 40 192.5 41 231.0 42 242.5 43 273.5 44 286.5 45 269.0 46 257.5 47 233.5 48 212.5 49 201.5 50 171.0 51 141.5 52 124.5 53 99.0 54 68.5 55 56.0 56 47.0 57 35.0 58 32.5 59 18.0 60 7.5 61 6.0 62 6.0 63 5.5 64 2.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 1.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 1.0 87 1.0 88 0.5 89 0.0 90 1.0 91 1.5 92 1.0 93 1.5 94 1.0 95 0.0 96 0.0 97 0.5 98 2.0 99 2.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.425 #Duplication Level Percentage of deduplicated Percentage of total 1 83.59114346375492 68.89999999999999 2 12.738853503184714 21.0 3 2.820746132848044 6.9750000000000005 4 0.6369426751592357 2.1 5 0.09099181073703368 0.375 6 0.060661207158022444 0.3 7 0.060661207158022444 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGTGTATTTAACTTATAATCAGTAAGAAATAATAATGATTTCCGTCTT 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit TTCCCTTACTATTATTGATAGTGGAATTGGTATGACCAAGTCTGATTTGG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GACAGGCAGCTGTGGTTCGCATCGAAACAAAGCCTGTCTTACTTGGATGG 5 0.125 No Hit GATGGAAAGACCTTTGGATGATTTGGTTACTTTCCCTGCTTTCTTTACAT 5 0.125 No Hit AAAGTGATGCGCCTCTTCATCTATGCATTAATTAATTATAATACGAACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.2125 0.0 0.0 0.0 0.0 64-65 0.32499999999999996 0.0 0.0 0.0 0.0 66-67 0.3625 0.0 0.0 0.0 0.0 68-69 0.525 0.0 0.0 0.0 0.0 70-71 0.6125 0.0 0.0 0.0 0.0 72-73 0.8 0.0 0.0 0.0 0.0 74-75 1.025 0.0 0.0 0.0 0.0 76-77 1.25 0.0 0.0 0.0 0.0 78-79 1.4875 0.0 0.0 0.0 0.0 80-81 1.75 0.0 0.0 0.0 0.0 82-83 2.1 0.0 0.0 0.0 0.0 84-85 2.5 0.0 0.0 0.0 0.0 86-87 2.975 0.0 0.0 0.0 0.0 88-89 3.4375 0.0 0.0 0.0 0.0 90-91 3.8875 0.0 0.0 0.0 0.0 92-93 4.5625 0.0 0.0 0.0 0.0 94-95 5.4875 0.0 0.0 0.0 0.0 96-97 6.2 0.0 0.0 0.0 0.0 98-99 6.975 0.0 0.0 0.0 0.0 100-101 7.7875 0.0 0.0 0.0 0.0 102-103 8.5125 0.0 0.0 0.0 0.0 104-105 9.525 0.0 0.0 0.0 0.0 106-107 10.587499999999999 0.0 0.0 0.0 0.0 108-109 11.775 0.0 0.0 0.0 0.0 110-111 12.625 0.0 0.0 0.0 0.0 112-113 13.4625 0.0 0.0 0.0 0.0 114-115 14.5625 0.0 0.0 0.0 0.0 116-117 15.825 0.0 0.0 0.0 0.0 118-119 16.950000000000003 0.0 0.0 0.0 0.0 120-121 17.875 0.0 0.0 0.0 0.0 122-123 18.7125 0.0 0.0 0.0 0.0 124-125 19.35 0.0 0.0 0.0 0.0 126-127 20.4625 0.0 0.0 0.0 0.0 128-129 21.7125 0.0 0.0 0.0 0.0 130-131 22.700000000000003 0.0 0.0 0.0 0.0 132-133 23.5625 0.0 0.0 0.0 0.0 134-135 24.425 0.0 0.0 0.0 0.0 136-137 25.5375 0.0 0.0 0.0 0.0 138-139 26.674999999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 330 2.8141134E-4 6.1515155 130-134 >>END_MODULE Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642677 spots for SRR12670164.sra Written 642677 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra Read 642674 spots for SRR12670164.sra Written 642674 spots for SRR12670164.sra SRR ids: ['SRR12670164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55auvhru SRR12670164.sra spots: 12853483 blocks: [[1, 642674], [642675, 1285348], [1285349, 1928022], [1928023, 2570696], [2570697, 3213370], [3213371, 3856044], [3856045, 4498718], [4498719, 5141392], [5141393, 5784066], [5784067, 6426740], [6426741, 7069414], [7069415, 7712088], [7712089, 8354762], [8354763, 8997436], [8997437, 9640110], [9640111, 10282784], [10282785, 10925458], [10925459, 11568132], [11568133, 12210806], [12210807, 12853483]] SRR12670164 file size 4346475 SRR12670164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670164 SRR12670164_1.fastq SRR12670164_2.fastq Input file: SRR12670164_1.fastq Paired file: SRR12670164_2.fastq trimmed: SRR12670164-trimmed-pair1.fastq, SRR12670164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:09:34 2025 >> started Tue Feb 11 08:09:50 2025 >> done (15.336s) 12853483 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 13859 ( 0.11%) empty read pairs filtered out after trimming by size control 12839512 (99.89%) read pairs available; of these: 4015258 (31.27%) trimmed read pairs available after processing 8824254 (68.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 6 0.00% 20 18 0.00% 21 17 0.00% 22 36 0.00% 23 53 0.00% 24 43 0.00% 25 79 0.00% 26 75 0.00% 27 101 0.00% 28 99 0.00% 29 108 0.00% 30 105 0.00% 31 111 0.00% 32 130 0.00% 33 146 0.00% 34 118 0.00% 35 149 0.00% 36 174 0.00% 37 197 0.00% 38 230 0.00% 39 259 0.00% 40 260 0.00% 41 316 0.00% 42 314 0.00% 43 293 0.00% 44 323 0.00% 45 408 0.00% 46 402 0.00% 47 470 0.00% 48 609 0.00% 49 651 0.01% 50 812 0.01% 51 885 0.01% 52 945 0.01% 53 962 0.01% 54 1066 0.01% 55 1134 0.01% 56 1270 0.01% 57 1474 0.01% 58 1719 0.01% 59 1925 0.01% 60 2434 0.02% 61 2751 0.02% 62 3009 0.02% 63 3298 0.03% 64 3519 0.03% 65 3659 0.03% 66 4158 0.03% 67 4633 0.04% 68 5178 0.04% 69 5919 0.05% 70 6989 0.05% 71 7872 0.06% 72 8877 0.07% 73 10127 0.08% 74 10743 0.08% 75 11211 0.09% 76 12119 0.09% 77 13088 0.10% 78 14261 0.11% 79 15697 0.12% 80 17284 0.13% 81 19218 0.15% 82 21751 0.17% 83 23329 0.18% 84 25384 0.20% 85 27053 0.21% 86 27896 0.22% 87 29049 0.23% 88 30778 0.24% 89 31744 0.25% 90 34650 0.27% 91 36820 0.29% 92 38887 0.30% 93 41635 0.32% 94 43460 0.34% 95 45183 0.35% 96 46964 0.37% 97 47890 0.37% 98 47245 0.37% 99 48776 0.38% 100 50623 0.39% 101 50914 0.40% 102 54580 0.43% 103 55346 0.43% 104 57024 0.44% 105 59122 0.46% 106 59119 0.46% 107 58657 0.46% 108 58719 0.46% 109 58217 0.45% 110 58260 0.45% 111 59689 0.46% 112 61436 0.48% 113 62006 0.48% 114 63613 0.50% 115 64941 0.51% 116 64089 0.50% 117 64996 0.51% 118 64525 0.50% 119 63579 0.50% 120 64285 0.50% 121 64044 0.50% 122 64232 0.50% 123 65763 0.51% 124 65929 0.51% 125 66165 0.52% 126 66924 0.52% 127 66392 0.52% 128 64880 0.51% 129 63985 0.50% 130 63601 0.50% 131 63525 0.49% 132 63088 0.49% 133 64617 0.50% 134 63787 0.50% 135 65029 0.51% 136 63980 0.50% 137 63911 0.50% 138 63156 0.49% 139 63658 0.50% 140 62555 0.49% 141 61850 0.48% 142 62154 0.48% 143 61954 0.48% 144 62568 0.49% 145 62563 0.49% 146 61853 0.48% 147 61526 0.48% 148 63040 0.49% 149 60430 0.47% 150 61317 0.48% 151 8824254 68.73% 12839512 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.73 prefix-fanout=1.9 sequence=GCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.18 sequence-density-rank=22 fanout-score=14.53 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=14.5 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACGACTTAGGATCTCGTATGCCGTCTTCTGCTTGA criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=1.24 prefix-fanout=2.0 sequence=CTGACAAGACCCAGTGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=14.22 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.3 sequence=AGCTCAAAAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTTGCCGGAAAGGC SRR12670164 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:10:36 Started mapping on | Feb 11 08:10:36 Finished on | Feb 11 08:12:40 Mapping speed, Million of reads per hour | 372.76 Number of input reads | 12839512 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 11634517 Uniquely mapped reads % | 90.61% Average mapped length | 278.04 Number of splices: Total | 10802744 Number of splices: Annotated (sjdb) | 10519087 Number of splices: GT/AG | 10564258 Number of splices: GC/AG | 171528 Number of splices: AT/AC | 6782 Number of splices: Non-canonical | 60176 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.06% Deletion average length | 3.05 Insertion rate per base | 0.04% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 434648 % of reads mapped to multiple loci | 3.39% Number of reads mapped to too many loci | 52501 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.39% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770347 770347 770347 N_multimapping 434648 434648 434648 N_noFeature 408942 11453180 489091 N_ambiguous 191652 737 90008 UnstrandedReadsAssigned:11033923 PositiveStrandReadsAssigned:180600 NegativeStrandReadsAssigned:11055418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=128 echo kmer=123 SRR12670164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670164-trimmed-pair1.fastq SRR12670164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,839,512 reads, 10,849,785 reads pseudoaligned [quant] estimated average fragment length: 198.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR12670164.ke.tsv 34699 SRR12670164.se.tsv 87100 total ==> SRR12670164.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.07 725 36.5088 Potri.005G024800.1.v4.1 1035 837.074 382 41.8262 Potri.004G059700.1.v4.1 961 763.121 2 0.240207 Potri.007G009000.2.v4.1 1416 1218.07 0 0 Potri.003G141000.2.v4.1 2943 2745.07 603 20.1332 Potri.016G087400.1.v4.1 270 114.975 539.795 430.303 Potri.015G069301.1.v4.1 564 374.691 0 0 Potri.010G195200.1.v4.1 1773 1575.07 327 19.0281 Potri.012G127500.1.v4.1 977 779.098 78 9.17596 ==> SRR12670164.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 156 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 107 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670164 completed mapping pipeline successfully