Starting /dee2/code/volunteer_pipeline.sh SRR12670167 current disk space = 3055764414464 free memory = 1512933472 SRR12670167 SRAfilesize 652694ce46ca3c1a0b83e77565bf9273 SRR12670167.sra SRR12670167.sra file validated SRR12670167 is paired end SRR12670167 is conventional basespace SRR12670167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6285 37.0 37.0 37.0 37.0 37.0 2 36.43425 37.0 37.0 37.0 37.0 37.0 3 36.647 37.0 37.0 37.0 37.0 37.0 4 36.6395 37.0 37.0 37.0 37.0 37.0 5 36.6625 37.0 37.0 37.0 37.0 37.0 6 36.6285 37.0 37.0 37.0 37.0 37.0 7 36.6165 37.0 37.0 37.0 37.0 37.0 8 36.626 37.0 37.0 37.0 37.0 37.0 9 36.6625 37.0 37.0 37.0 37.0 37.0 10-14 36.6143 37.0 37.0 37.0 37.0 37.0 15-19 36.5928 37.0 37.0 37.0 37.0 37.0 20-24 36.5185 37.0 37.0 37.0 37.0 37.0 25-29 36.5305 37.0 37.0 37.0 37.0 37.0 30-34 36.4693 37.0 37.0 37.0 37.0 37.0 35-39 36.4589 37.0 37.0 37.0 37.0 37.0 40-44 36.44969999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.408699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4115 37.0 37.0 37.0 37.0 37.0 55-59 36.3735 37.0 37.0 37.0 37.0 37.0 60-64 36.357600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3623 37.0 37.0 37.0 37.0 37.0 70-74 36.3236 37.0 37.0 37.0 37.0 37.0 75-79 36.3094 37.0 37.0 37.0 37.0 37.0 80-84 36.246 37.0 37.0 37.0 37.0 37.0 85-89 36.279399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2562 37.0 37.0 37.0 37.0 37.0 95-99 36.1509 37.0 37.0 37.0 37.0 37.0 100-104 36.2299 37.0 37.0 37.0 37.0 37.0 105-109 36.1833 37.0 37.0 37.0 37.0 37.0 110-114 36.1066 37.0 37.0 37.0 37.0 37.0 115-119 36.0769 37.0 37.0 37.0 37.0 37.0 120-124 36.017399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.8147 37.0 37.0 37.0 37.0 37.0 130-134 35.766 37.0 37.0 37.0 37.0 37.0 135-139 35.4971 37.0 37.0 37.0 37.0 37.0 140-144 35.181200000000004 37.0 37.0 37.0 32.2 37.0 145-149 34.9995 37.0 37.0 37.0 27.4 37.0 150-151 34.627250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 4.0 25 2.0 26 3.0 27 11.0 28 8.0 29 17.0 30 19.0 31 35.0 32 61.0 33 102.0 34 162.0 35 366.0 36 2867.0 37 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.775 12.025 5.2749999999999995 35.925000000000004 2 19.148936170212767 11.739674593241551 38.47309136420526 30.638297872340424 3 16.25 18.0 28.975 36.775000000000006 4 21.875 26.25 25.4 26.474999999999998 5 23.3 31.15 25.650000000000002 19.900000000000002 6 20.599999999999998 33.800000000000004 24.275 21.325 7 14.549999999999999 25.0 44.2 16.25 8 15.875 25.7 33.025 25.4 9 18.175 23.549999999999997 34.849999999999994 23.425 10-14 19.875 29.709999999999997 27.63 22.785 15-19 20.625 28.165000000000003 27.395000000000003 23.815 20-24 20.13 28.775000000000002 27.425 23.669999999999998 25-29 19.88 28.73 27.639999999999997 23.75 30-34 20.18 28.265 27.62 23.935000000000002 35-39 20.085 28.835 27.595 23.485 40-44 19.915 28.64 28.42 23.025000000000002 45-49 20.64 28.815 27.169999999999998 23.375 50-54 20.345 28.34 27.6 23.715 55-59 20.395 28.599999999999998 27.495000000000005 23.51 60-64 20.505000000000003 28.720000000000002 27.425 23.35 65-69 20.685000000000002 28.74 27.35 23.225 70-74 20.685000000000002 28.32 27.529999999999998 23.465 75-79 20.06 28.975 27.205000000000002 23.76 80-84 20.66 28.544999999999998 27.825 22.97 85-89 21.085 28.945 27.505000000000003 22.465 90-94 20.765 28.799999999999997 26.88 23.555 95-99 21.18 28.64 27.61 22.57 100-104 21.275 28.555000000000003 27.105 23.064999999999998 105-109 21.25 29.020000000000003 26.515 23.215 110-114 21.42 28.685 26.455000000000002 23.44 115-119 21.645 28.09 26.995 23.27 120-124 21.51 28.444999999999997 26.72 23.325000000000003 125-129 21.335 28.449999999999996 25.974999999999998 24.240000000000002 130-134 21.325 27.985 25.845000000000002 24.845 135-139 21.52 28.79 25.835 23.855 140-144 21.740000000000002 27.750000000000004 26.025 24.485 145-149 22.075 27.700000000000003 26.245 23.98 150-151 21.7875 27.0 26.3 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.5 23 3.0 24 3.0 25 4.0 26 4.5 27 5.5 28 11.5 29 18.5 30 27.0 31 30.5 32 34.0 33 43.5 34 48.0 35 71.5 36 97.0 37 118.0 38 131.5 39 154.5 40 173.5 41 183.0 42 218.0 43 235.5 44 261.5 45 282.0 46 267.0 47 247.5 48 218.5 49 201.0 50 193.5 51 172.5 52 131.0 53 99.5 54 80.5 55 60.0 56 46.5 57 29.5 58 26.5 59 22.5 60 13.0 61 7.0 62 3.5 63 3.5 64 3.0 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.55838767042087 71.325 2 12.89270895080024 21.75 3 2.133965619442798 5.4 4 0.26674570243034973 0.8999999999999999 5 0.14819205690574985 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGGTGTTATGCGAACCAGTCTGCCAAAGGGATCATCAGAATCCGATGAG 5 0.125 No Hit GTTGGAATTGAGGAAGTGGGCTTTGTCAGGAATGGAATGGAATTTGAAAA 5 0.125 No Hit CCTGGACCTGGTGGTATGAATGGCACTCCCAGTGTCACAACCCCTAGGAC 5 0.125 No Hit CCATAGTCATAAAACTACGCAAGAGCATGGCTTTAGTCTAGTAAAATTCC 5 0.125 No Hit ATTCATCAGTGTTGTAGATAGGGCTGTAGCCATCCACATTAGCACCATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.5875 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.9624999999999999 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.9500000000000002 0.0 0.0 0.0 0.0 88-89 2.4125 0.0 0.0 0.0 0.0 90-91 2.8 0.0 0.0 0.0 0.0 92-93 3.325 0.0 0.0 0.0 0.0 94-95 3.9375 0.0 0.0 0.0 0.0 96-97 4.5 0.0 0.0 0.0 0.0 98-99 5.2875 0.0 0.0 0.0 0.0 100-101 6.112500000000001 0.0 0.0 0.0 0.0 102-103 6.9 0.0 0.0 0.0 0.0 104-105 7.4875 0.0 0.0 0.0 0.0 106-107 8.325 0.0 0.0 0.0 0.0 108-109 9.149999999999999 0.0 0.0 0.0 0.0 110-111 9.8625 0.0 0.0 0.0 0.0 112-113 10.6375 0.0 0.0 0.0 0.0 114-115 11.525 0.0 0.0 0.0 0.0 116-117 12.5 0.0 0.0 0.0 0.0 118-119 13.15 0.0 0.0 0.0 0.0 120-121 14.225 0.0 0.0 0.0 0.0 122-123 15.212499999999999 0.0 0.0 0.0 0.0 124-125 16.2875 0.0 0.0 0.0 0.0 126-127 17.325 0.0 0.0 0.0 0.0 128-129 18.2875 0.0 0.0 0.0 0.0 130-131 19.0875 0.0 0.0 0.0 0.0 132-133 19.9 0.0 0.0 0.0 0.0 134-135 20.8125 0.0 0.0 0.0 0.0 136-137 21.7 0.0 0.0 0.0 0.0 138-139 22.862499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGA 10 0.006830828 145.0 6 >>END_MODULE SRR12670167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.353 37.0 37.0 37.0 37.0 37.0 2 36.419 37.0 37.0 37.0 37.0 37.0 3 36.212 37.0 37.0 37.0 37.0 37.0 4 36.2865 37.0 37.0 37.0 37.0 37.0 5 36.347 37.0 37.0 37.0 37.0 37.0 6 36.334 37.0 37.0 37.0 37.0 37.0 7 36.35 37.0 37.0 37.0 37.0 37.0 8 36.417 37.0 37.0 37.0 37.0 37.0 9 36.374 37.0 37.0 37.0 37.0 37.0 10-14 36.4265 37.0 37.0 37.0 37.0 37.0 15-19 36.394000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3747 37.0 37.0 37.0 37.0 37.0 25-29 36.297399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.2589 37.0 37.0 37.0 37.0 37.0 35-39 36.222699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2459 37.0 37.0 37.0 37.0 37.0 45-49 36.2447 37.0 37.0 37.0 37.0 37.0 50-54 36.224399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1207 37.0 37.0 37.0 37.0 37.0 60-64 36.1419 37.0 37.0 37.0 37.0 37.0 65-69 36.111399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.03660000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1106 37.0 37.0 37.0 37.0 37.0 80-84 36.0827 37.0 37.0 37.0 37.0 37.0 85-89 36.0355 37.0 37.0 37.0 37.0 37.0 90-94 36.045 37.0 37.0 37.0 37.0 37.0 95-99 35.9305 37.0 37.0 37.0 37.0 37.0 100-104 35.8562 37.0 37.0 37.0 37.0 37.0 105-109 35.838 37.0 37.0 37.0 37.0 37.0 110-114 35.811099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.8418 37.0 37.0 37.0 37.0 37.0 120-124 35.647999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5529 37.0 37.0 37.0 37.0 37.0 130-134 35.3417 37.0 37.0 37.0 34.6 37.0 135-139 35.322199999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.150099999999995 37.0 37.0 37.0 29.8 37.0 145-149 34.706 37.0 37.0 37.0 25.0 37.0 150-151 34.306 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 1.0 17 3.0 18 1.0 19 1.0 20 0.0 21 1.0 22 4.0 23 4.0 24 5.0 25 8.0 26 4.0 27 7.0 28 11.0 29 25.0 30 25.0 31 31.0 32 65.0 33 108.0 34 211.0 35 588.0 36 2592.0 37 302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 23.474999999999998 7.35 23.724999999999998 2 24.474999999999998 27.125 31.4 17.0 3 19.8 27.950000000000003 34.125 18.125 4 22.400000000000002 35.625 24.275 17.7 5 24.825 37.3 21.15 16.725 6 21.349999999999998 40.5 21.725 16.425 7 20.549999999999997 22.975 36.75 19.725 8 20.674999999999997 25.15 29.849999999999998 24.325 9 21.375 24.7 30.349999999999998 23.575 10-14 23.515 28.694999999999997 26.735 21.055 15-19 23.200000000000003 28.025 27.694999999999997 21.08 20-24 22.8 29.304999999999996 27.750000000000004 20.145 25-29 22.900000000000002 28.12 27.87 21.11 30-34 22.575 28.000000000000004 28.860000000000003 20.565 35-39 22.34 28.48 27.655 21.525 40-44 22.57 28.599999999999998 28.194999999999997 20.635 45-49 22.74 28.665000000000003 28.055000000000003 20.54 50-54 23.32 27.54 28.04 21.099999999999998 55-59 22.95 27.87 27.88 21.3 60-64 23.169999999999998 27.805000000000003 28.494999999999997 20.53 65-69 23.849999999999998 27.395000000000003 27.994999999999997 20.76 70-74 23.405 28.24 27.560000000000002 20.794999999999998 75-79 23.200000000000003 27.91 27.98 20.91 80-84 23.435 28.255000000000003 27.229999999999997 21.08 85-89 23.16 28.535 27.47 20.835 90-94 23.645 27.67 27.46 21.224999999999998 95-99 23.995 28.355000000000004 27.345000000000002 20.305 100-104 24.474999999999998 28.325 26.779999999999998 20.419999999999998 105-109 24.92 28.494999999999997 26.545 20.04 110-114 25.224999999999998 28.115000000000002 26.35 20.31 115-119 25.064999999999998 28.64 26.674999999999997 19.62 120-124 26.39 28.015 26.345000000000002 19.25 125-129 26.490000000000002 27.98 25.900000000000002 19.63 130-134 26.979999999999997 27.779999999999998 26.68 18.56 135-139 27.245 26.950000000000003 26.455000000000002 19.35 140-144 27.52 27.43 26.484999999999996 18.565 145-149 28.83 26.979999999999997 25.505 18.685 150-151 29.2 26.4625 26.2875 18.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.5 22 3.0 23 2.5 24 2.0 25 1.0 26 1.0 27 3.5 28 5.0 29 9.0 30 16.5 31 19.5 32 27.5 33 36.5 34 47.5 35 64.5 36 82.0 37 119.0 38 140.0 39 174.5 40 220.0 41 232.0 42 267.0 43 286.5 44 265.0 45 269.5 46 270.5 47 239.0 48 223.0 49 203.5 50 166.5 51 134.0 52 100.0 53 73.5 54 73.0 55 61.0 56 37.5 57 32.5 58 28.0 59 15.0 60 10.0 61 9.0 62 7.0 63 6.5 64 3.0 65 1.0 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.2 #Duplication Level Percentage of deduplicated Percentage of total 1 84.59026128266032 71.22500000000001 2 12.707838479809977 21.4 3 2.197149643705463 5.55 4 0.35629453681710216 1.2 5 0.14845605700712589 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAATCAATCAATGGAGTCCATAGGTGTCCTGATGACCTGCCCACCATTTG 5 0.125 No Hit CCTTATGGAACTGGTGGTGGCATGAACCTCAGGGATGGGTTAGATGCATC 5 0.125 No Hit GGATTTCCTCGAAATTACCAAGGTTGTTCTTGTTGCAAAAGATTTTGGAG 5 0.125 No Hit GGTACTTCTACATGGACAATTCAACCGATCTATTATAATCCTCTTTGACG 5 0.125 No Hit CAACTGGAAGATGCAATTGAAAATGAGGACTTCCAAGAGGCTGCAAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.4375 0.0 0.0 0.0 0.0 86-87 1.9249999999999998 0.0 0.0 0.0 0.0 88-89 2.3875 0.0 0.0 0.0 0.0 90-91 2.7750000000000004 0.0 0.0 0.0 0.0 92-93 3.3 0.0 0.0 0.0 0.0 94-95 3.9125 0.0 0.0 0.0 0.0 96-97 4.475 0.0 0.0 0.0 0.0 98-99 5.2875 0.0 0.0 0.0 0.0 100-101 6.112500000000001 0.0 0.0 0.0 0.0 102-103 6.9 0.0 0.0 0.0 0.0 104-105 7.525 0.0 0.0 0.0 0.0 106-107 8.4 0.0 0.0 0.0 0.0 108-109 9.2 0.0 0.0 0.0 0.0 110-111 9.9125 0.0 0.0 0.0 0.0 112-113 10.7125 0.0 0.0 0.0 0.0 114-115 11.6375 0.0 0.0 0.0 0.0 116-117 12.600000000000001 0.0 0.0 0.0 0.0 118-119 13.25 0.0 0.0 0.0 0.0 120-121 14.35 0.0 0.0 0.0 0.0 122-123 15.337499999999999 0.0 0.0 0.0 0.0 124-125 16.450000000000003 0.0 0.0 0.0 0.0 126-127 17.5 0.0 0.0 0.0 0.0 128-129 18.4625 0.0 0.0 0.0 0.0 130-131 19.225 0.0 0.0 0.0 0.0 132-133 20.0125 0.0 0.0 0.0 0.0 134-135 20.9125 0.0 0.0 0.0 0.0 136-137 21.7875 0.0 0.0 0.0 0.0 138-139 22.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACATC 10 0.006830828 145.0 1 >>END_MODULE Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra Read 592739 spots for SRR12670167.sra Written 592739 spots for SRR12670167.sra Read 592730 spots for SRR12670167.sra Written 592730 spots for SRR12670167.sra SRR ids: ['SRR12670167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zlojedws SRR12670167.sra spots: 11854609 blocks: [[1, 592730], [592731, 1185460], [1185461, 1778190], [1778191, 2370920], [2370921, 2963650], [2963651, 3556380], [3556381, 4149110], [4149111, 4741840], [4741841, 5334570], [5334571, 5927300], [5927301, 6520030], [6520031, 7112760], [7112761, 7705490], [7705491, 8298220], [8298221, 8890950], [8890951, 9483680], [9483681, 10076410], [10076411, 10669140], [10669141, 11261870], [11261871, 11854609]] SRR12670167 file size 4007014 SRR12670167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670167 SRR12670167_1.fastq SRR12670167_2.fastq Input file: SRR12670167_1.fastq Paired file: SRR12670167_2.fastq trimmed: SRR12670167-trimmed-pair1.fastq, SRR12670167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:37:27 2025 >> started Tue Feb 11 08:37:43 2025 >> done (15.524s) 11854609 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 2696 ( 0.02%) empty read pairs filtered out after trimming by size control 11851849 (99.98%) read pairs available; of these: 3123022 (26.35%) trimmed read pairs available after processing 8728827 (73.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 16 0.00% 21 13 0.00% 22 18 0.00% 23 24 0.00% 24 42 0.00% 25 36 0.00% 26 55 0.00% 27 63 0.00% 28 61 0.00% 29 56 0.00% 30 76 0.00% 31 74 0.00% 32 91 0.00% 33 76 0.00% 34 72 0.00% 35 100 0.00% 36 107 0.00% 37 123 0.00% 38 118 0.00% 39 140 0.00% 40 162 0.00% 41 200 0.00% 42 179 0.00% 43 154 0.00% 44 170 0.00% 45 204 0.00% 46 284 0.00% 47 262 0.00% 48 348 0.00% 49 383 0.00% 50 431 0.00% 51 512 0.00% 52 508 0.00% 53 530 0.00% 54 653 0.01% 55 665 0.01% 56 768 0.01% 57 843 0.01% 58 1055 0.01% 59 1214 0.01% 60 1375 0.01% 61 1651 0.01% 62 1799 0.02% 63 2102 0.02% 64 2178 0.02% 65 2272 0.02% 66 2461 0.02% 67 2996 0.03% 68 3104 0.03% 69 3678 0.03% 70 4248 0.04% 71 4856 0.04% 72 5669 0.05% 73 6208 0.05% 74 6720 0.06% 75 7161 0.06% 76 7856 0.07% 77 8298 0.07% 78 8814 0.07% 79 10184 0.09% 80 11227 0.09% 81 12538 0.11% 82 14341 0.12% 83 15359 0.13% 84 16951 0.14% 85 17950 0.15% 86 19191 0.16% 87 19659 0.17% 88 20797 0.18% 89 22078 0.19% 90 23468 0.20% 91 25444 0.21% 92 26952 0.23% 93 29402 0.25% 94 31162 0.26% 95 32622 0.28% 96 33230 0.28% 97 33679 0.28% 98 34118 0.29% 99 35282 0.30% 100 36763 0.31% 101 37424 0.32% 102 39724 0.34% 103 41262 0.35% 104 43309 0.37% 105 43593 0.37% 106 44426 0.37% 107 44711 0.38% 108 44415 0.37% 109 44591 0.38% 110 45518 0.38% 111 45558 0.38% 112 47191 0.40% 113 48626 0.41% 114 49413 0.42% 115 50579 0.43% 116 50965 0.43% 117 51184 0.43% 118 50962 0.43% 119 50921 0.43% 120 50823 0.43% 121 50976 0.43% 122 52078 0.44% 123 52127 0.44% 124 53873 0.45% 125 53526 0.45% 126 54279 0.46% 127 53554 0.45% 128 53142 0.45% 129 52766 0.45% 130 52688 0.44% 131 52339 0.44% 132 52216 0.44% 133 53385 0.45% 134 54006 0.46% 135 53521 0.45% 136 53741 0.45% 137 53768 0.45% 138 52785 0.45% 139 52911 0.45% 140 52270 0.44% 141 52639 0.44% 142 52058 0.44% 143 52153 0.44% 144 52445 0.44% 145 52492 0.44% 146 52403 0.44% 147 51786 0.44% 148 52269 0.44% 149 51313 0.43% 150 51571 0.44% 151 8728827 73.65% 11851849 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=232.13 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.59 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.16 sequence-density-rank=12 fanout-score=31.93 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.6 sequence=AAGAAAAGAAAA SRR12670167 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:38:22 Started mapping on | Feb 11 08:38:23 Finished on | Feb 11 08:39:39 Mapping speed, Million of reads per hour | 561.40 Number of input reads | 11851849 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 10989331 Uniquely mapped reads % | 92.72% Average mapped length | 283.31 Number of splices: Total | 10254242 Number of splices: Annotated (sjdb) | 10002936 Number of splices: GT/AG | 10042830 Number of splices: GC/AG | 167525 Number of splices: AT/AC | 7118 Number of splices: Non-canonical | 36769 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278027 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 77225 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 584491 584491 584491 N_multimapping 278027 278027 278027 N_noFeature 466389 10833550 536644 N_ambiguous 151033 642 65187 UnstrandedReadsAssigned:10371909 PositiveStrandReadsAssigned:155139 NegativeStrandReadsAssigned:10387500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR12670167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670167-trimmed-pair1.fastq SRR12670167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,851,849 reads, 10,466,762 reads pseudoaligned [quant] estimated average fragment length: 215.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR12670167.ke.tsv 34699 SRR12670167.se.tsv 87100 total ==> SRR12670167.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.78 436 24.0006 Potri.005G024800.1.v4.1 1035 820.783 143 17.2993 Potri.004G059700.1.v4.1 961 746.894 12 1.5953 Potri.007G009000.2.v4.1 1416 1201.78 0 0 Potri.003G141000.2.v4.1 2943 2728.78 544 19.7947 Potri.016G087400.1.v4.1 270 111.092 431 385.225 Potri.015G069301.1.v4.1 564 361.143 0 0 Potri.010G195200.1.v4.1 1773 1558.78 71 4.52264 Potri.012G127500.1.v4.1 977 762.851 99 12.8859 ==> SRR12670167.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 378 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12670167 completed mapping pipeline successfully