Starting /dee2/code/volunteer_pipeline.sh SRR12670170 current disk space = 3055762284544 free memory = 1508686604 SRR12670170 SRAfilesize bad99360fde1edff6ddc325bee3ccc52 SRR12670170.sra SRR12670170.sra file validated SRR12670170 is paired end SRR12670170 is conventional basespace SRR12670170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6645 37.0 37.0 37.0 37.0 37.0 2 36.47975 37.0 37.0 37.0 37.0 37.0 3 36.689 37.0 37.0 37.0 37.0 37.0 4 36.6755 37.0 37.0 37.0 37.0 37.0 5 36.6775 37.0 37.0 37.0 37.0 37.0 6 36.693 37.0 37.0 37.0 37.0 37.0 7 36.5585 37.0 37.0 37.0 37.0 37.0 8 36.603 37.0 37.0 37.0 37.0 37.0 9 36.579 37.0 37.0 37.0 37.0 37.0 10-14 36.625299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.583200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5427 37.0 37.0 37.0 37.0 37.0 25-29 36.557900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5043 37.0 37.0 37.0 37.0 37.0 35-39 36.5226 37.0 37.0 37.0 37.0 37.0 40-44 36.4435 37.0 37.0 37.0 37.0 37.0 45-49 36.4447 37.0 37.0 37.0 37.0 37.0 50-54 36.459199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.392199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.331 37.0 37.0 37.0 37.0 37.0 65-69 36.35359999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3387 37.0 37.0 37.0 37.0 37.0 75-79 36.346199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3517 37.0 37.0 37.0 37.0 37.0 85-89 36.36 37.0 37.0 37.0 37.0 37.0 90-94 36.3268 37.0 37.0 37.0 37.0 37.0 95-99 36.290000000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2846 37.0 37.0 37.0 37.0 37.0 105-109 36.25170000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1809 37.0 37.0 37.0 37.0 37.0 115-119 36.2279 37.0 37.0 37.0 37.0 37.0 120-124 36.0786 37.0 37.0 37.0 37.0 37.0 125-129 35.9431 37.0 37.0 37.0 37.0 37.0 130-134 35.8116 37.0 37.0 37.0 37.0 37.0 135-139 35.6434 37.0 37.0 37.0 37.0 37.0 140-144 35.2972 37.0 37.0 37.0 37.0 37.0 145-149 35.023399999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.673249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 2.0 27 5.0 28 11.0 29 16.0 30 26.0 31 27.0 32 44.0 33 106.0 34 154.0 35 351.0 36 2874.0 37 378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.85 11.125 7.425 45.6 2 19.86970684039088 14.257078426459536 35.379604109245804 30.493610623903784 3 18.125 17.349999999999998 25.174999999999997 39.35 4 21.05 22.85 25.25 30.85 5 22.775000000000002 29.599999999999998 25.374999999999996 22.25 6 21.5 34.925 23.3 20.275000000000002 7 15.775 25.35 40.9 17.974999999999998 8 16.625 27.525 31.825 24.025 9 17.25 23.549999999999997 35.8 23.400000000000002 10-14 19.455 28.615000000000002 27.93 24.0 15-19 20.435 28.095 27.060000000000002 24.41 20-24 19.6 27.55 28.98 23.87 25-29 19.475 28.705000000000002 27.575 24.245 30-34 19.66 28.08 28.02 24.240000000000002 35-39 19.97 28.375 26.995 24.66 40-44 20.445 28.765 27.615000000000002 23.175 45-49 20.645 28.375 27.6 23.380000000000003 50-54 20.599999999999998 28.21 27.560000000000002 23.630000000000003 55-59 20.97 27.060000000000002 27.52 24.45 60-64 20.86 28.310000000000002 27.205000000000002 23.625 65-69 20.145 28.005000000000003 28.63 23.22 70-74 20.59 27.57 27.935 23.905 75-79 20.91 28.51 27.315 23.265 80-84 20.72 27.76 27.36 24.16 85-89 20.705000000000002 27.91 27.425 23.96 90-94 21.3 27.860000000000003 27.38 23.46 95-99 20.61 28.044999999999998 26.974999999999998 24.37 100-104 21.12 28.65 26.419999999999998 23.810000000000002 105-109 20.830000000000002 28.044999999999998 27.065 24.060000000000002 110-114 21.51 28.815 26.525 23.150000000000002 115-119 20.665 28.175 26.865 24.295 120-124 21.12 28.435 25.935000000000002 24.51 125-129 21.41 28.199999999999996 26.405 23.985 130-134 21.505 27.775 25.905 24.815 135-139 21.87 27.860000000000003 25.374999999999996 24.895 140-144 21.295 27.250000000000004 26.58 24.875 145-149 21.475 27.065 26.279999999999998 25.180000000000003 150-151 21.7 26.687499999999996 26.700000000000003 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.0 27 3.0 28 3.0 29 8.5 30 16.0 31 19.5 32 20.0 33 31.0 34 47.0 35 56.0 36 81.5 37 105.5 38 126.0 39 152.5 40 188.5 41 223.5 42 244.5 43 248.0 44 236.5 45 253.5 46 271.0 47 262.0 48 237.5 49 217.0 50 188.0 51 155.5 52 137.5 53 103.5 54 79.5 55 70.5 56 61.0 57 51.5 58 32.5 59 17.5 60 13.0 61 9.5 62 8.0 63 5.0 64 2.0 65 1.5 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.25 #Duplication Level Percentage of deduplicated Percentage of total 1 85.10510510510511 70.85000000000001 2 11.05105105105105 18.4 3 2.8228228228228227 7.049999999999999 4 0.7807807807807807 2.6 5 0.18018018018018017 0.75 6 0.0 0.0 7 0.06006006006006006 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTACTTTTTCTACAGCTGCAACAGAATCTCCACCTCCAATAATAGTT 7 0.17500000000000002 No Hit GGCCAACACTGAAGAGAGCAAATTCACGCTTCTTTTCATCAACAAAAGGC 7 0.17500000000000002 No Hit CCACAGCGAATTTTAACGTCTCAACAAACTGATAGTACAACAAAACAATC 5 0.125 No Hit TTTGGATATTCTCCTCGCAGACCTTTAACAATGGCCAGTATCAAGAGCAA 5 0.125 No Hit GGGTAATATCTAGCATCTTCCACTACGTTGACTGCAAGCTTTCGGTTGAT 5 0.125 No Hit ATTTCTTCCTTTGAAGCATAAATAAACTTGCTTGTAAGAGCATATCTGAA 5 0.125 No Hit GGCCCCTTTTGAAACCAAATATTTAATAGTAGGAACAGCGGCTCTAATTC 5 0.125 No Hit GCAAGGTTTACACAAGTGAAGCACAATCGATTAAAGAAATGGTGATATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.95 0.0 0.0 0.0 0.0 82-83 1.125 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.8875 0.0 0.0 0.0 0.0 88-89 2.25 0.0 0.0 0.0 0.0 90-91 2.75 0.0 0.0 0.0 0.0 92-93 3.425 0.0 0.0 0.0 0.0 94-95 3.875 0.0 0.0 0.0 0.0 96-97 4.475 0.0 0.0 0.0 0.0 98-99 5.3375 0.0 0.0 0.0 0.0 100-101 5.8375 0.0 0.0 0.0 0.0 102-103 6.5875 0.0 0.0 0.0 0.0 104-105 7.1875 0.0 0.0 0.0 0.0 106-107 8.075 0.0 0.0 0.0 0.0 108-109 8.8625 0.0 0.0 0.0 0.0 110-111 9.7 0.0 0.0 0.0 0.0 112-113 10.725 0.0 0.0 0.0 0.0 114-115 11.45 0.0 0.0 0.0 0.0 116-117 12.3 0.0 0.0 0.0 0.0 118-119 13.1625 0.0 0.0 0.0 0.0 120-121 14.3125 0.0 0.0 0.0 0.0 122-123 15.5125 0.0 0.0 0.0 0.0 124-125 16.612499999999997 0.0 0.0 0.0 0.0 126-127 17.625 0.0 0.0 0.0 0.0 128-129 18.6875 0.0 0.0 0.0 0.0 130-131 19.7125 0.0 0.0 0.0 0.0 132-133 20.525 0.0 0.0 0.0 0.0 134-135 21.175 0.0 0.0 0.0 0.0 136-137 22.1875 0.0 0.0 0.0 0.0 138-139 23.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGTCG 10 0.006830828 145.0 3 GTGTCCC 10 0.006830828 145.0 9 CAGTCGA 10 0.006830828 145.0 4 GAAGTGC 10 0.006830828 145.0 8 GTCGACG 10 0.006830828 145.0 6 ACTCACT 10 0.006830828 145.0 8 AAGACTC 10 0.006830828 145.0 5 AGTGTCC 10 0.006830828 145.0 8 GACGAAC 10 0.006830828 145.0 9 CGACGAA 10 0.006830828 145.0 8 TCCAAGA 10 0.006830828 145.0 2 CTCACTA 10 0.006830828 145.0 9 GACTCAC 10 0.006830828 145.0 7 CCAAGAC 20 3.5877043E-4 108.75 3 >>END_MODULE SRR12670170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3635 37.0 37.0 37.0 37.0 37.0 2 36.2035 37.0 37.0 37.0 37.0 37.0 3 36.2905 37.0 37.0 37.0 37.0 37.0 4 36.31 37.0 37.0 37.0 37.0 37.0 5 36.329 37.0 37.0 37.0 37.0 37.0 6 36.3945 37.0 37.0 37.0 37.0 37.0 7 36.241 37.0 37.0 37.0 37.0 37.0 8 36.354 37.0 37.0 37.0 37.0 37.0 9 36.3965 37.0 37.0 37.0 37.0 37.0 10-14 36.3551 37.0 37.0 37.0 37.0 37.0 15-19 36.392700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3313 37.0 37.0 37.0 37.0 37.0 25-29 36.2938 37.0 37.0 37.0 37.0 37.0 30-34 36.2481 37.0 37.0 37.0 37.0 37.0 35-39 36.2362 37.0 37.0 37.0 37.0 37.0 40-44 36.2548 37.0 37.0 37.0 37.0 37.0 45-49 36.1871 37.0 37.0 37.0 37.0 37.0 50-54 36.16969999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1334 37.0 37.0 37.0 37.0 37.0 60-64 36.1382 37.0 37.0 37.0 37.0 37.0 65-69 36.088 37.0 37.0 37.0 37.0 37.0 70-74 36.056599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0813 37.0 37.0 37.0 37.0 37.0 80-84 36.0683 37.0 37.0 37.0 37.0 37.0 85-89 36.025600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0302 37.0 37.0 37.0 37.0 37.0 95-99 35.9877 37.0 37.0 37.0 37.0 37.0 100-104 35.947199999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9047 37.0 37.0 37.0 37.0 37.0 110-114 35.8985 37.0 37.0 37.0 37.0 37.0 115-119 35.8327 37.0 37.0 37.0 37.0 37.0 120-124 35.6791 37.0 37.0 37.0 37.0 37.0 125-129 35.566199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.3807 37.0 37.0 37.0 34.6 37.0 135-139 35.2977 37.0 37.0 37.0 37.0 37.0 140-144 34.999900000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.6705 37.0 37.0 37.0 25.0 37.0 150-151 34.20675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 2.0 25 8.0 26 10.0 27 7.0 28 11.0 29 15.0 30 28.0 31 34.0 32 68.0 33 120.0 34 210.0 35 576.0 36 2620.0 37 277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.075 21.125 11.85 30.95 2 26.6 26.525 31.15 15.725 3 21.6 27.6 30.45 20.349999999999998 4 24.45 34.875 22.15 18.525 5 24.025 36.6 22.5 16.875 6 19.325 39.5 23.849999999999998 17.325 7 19.8 23.925 37.574999999999996 18.7 8 21.6 26.6 27.55 24.25 9 22.1 25.224999999999998 30.15 22.525000000000002 10-14 23.425 28.754999999999995 26.47 21.349999999999998 15-19 22.505 28.615000000000002 28.27 20.61 20-24 22.805 28.849999999999998 27.665 20.68 25-29 22.895 28.585 27.775 20.745 30-34 22.314999999999998 28.015 28.76 20.91 35-39 23.044999999999998 28.16 27.839999999999996 20.955 40-44 22.62 27.76 28.49 21.13 45-49 23.165 27.27 28.17 21.395 50-54 22.994999999999997 28.1 27.72 21.185000000000002 55-59 23.84 27.68 27.805000000000003 20.674999999999997 60-64 23.605 27.815 27.87 20.71 65-69 23.905 27.115000000000002 28.535 20.445 70-74 23.830000000000002 27.900000000000002 27.57 20.7 75-79 23.84 27.565 27.639999999999997 20.955 80-84 23.91 28.444999999999997 26.865 20.78 85-89 24.135 27.26 27.6 21.005 90-94 24.285 28.595 27.189999999999998 19.93 95-99 25.245 27.755000000000003 26.665 20.335 100-104 25.31 28.51 26.150000000000002 20.03 105-109 25.330000000000002 27.665 26.8 20.205000000000002 110-114 25.635 28.625 26.055 19.685 115-119 26.22 28.34 25.835 19.605 120-124 26.979999999999997 28.475 25.674999999999997 18.87 125-129 27.435 28.035 25.53 19.0 130-134 27.205000000000002 27.755000000000003 25.595000000000002 19.445 135-139 28.035 27.315 25.629999999999995 19.02 140-144 28.225 26.915 26.179999999999996 18.68 145-149 29.515 27.134999999999998 25.155 18.195 150-151 29.95 27.775 24.587500000000002 17.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 0.5 27 1.5 28 2.5 29 5.0 30 14.5 31 19.5 32 24.0 33 29.0 34 42.0 35 67.0 36 82.0 37 100.0 38 130.5 39 172.5 40 214.0 41 237.0 42 268.5 43 302.5 44 309.0 45 286.0 46 257.5 47 229.0 48 206.5 49 188.5 50 157.0 51 131.0 52 111.0 53 91.5 54 74.0 55 60.5 56 48.0 57 36.5 58 23.5 59 18.0 60 17.5 61 9.5 62 4.5 63 2.5 64 3.0 65 3.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 1.0 96 1.5 97 0.5 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.375 #Duplication Level Percentage of deduplicated Percentage of total 1 85.57721139430285 71.35000000000001 2 10.914542728635682 18.2 3 2.368815592203898 5.925 4 0.7196401799100449 2.4 5 0.2698650674662669 1.125 6 0.05997001499250374 0.3 7 0.02998500749625187 0.17500000000000002 8 0.0 0.0 9 0.02998500749625187 0.22499999999999998 >10 0.02998500749625187 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GTTGTTTACTGCAAATCTTGCAACTATTCTGGGGTTGATACCCTCTTGGG 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit GGAAGATAAGCTTGATTTGGCGACCACACTACTTGAGAAGGCCAAGGCAA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GTGGCTAATTCGGATGTTAAAGTCAAAGAAATCAGGTACATATTTTGTCA 5 0.125 No Hit GTCTATGGCAAAGAAGAGTGTGGGTGACTTGACTGCTGCTGAATTGAAAG 5 0.125 No Hit ATTGCAAACGCTACGATCTTTGGTATGCATATGCAAAAACTATAGGGGAG 5 0.125 No Hit CAATGGCAACCTTTAGCTTGCTTCCCACACCCACCATCCAAAAGCACCAC 5 0.125 No Hit GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 5 0.125 No Hit CTTCAAGAGAATTCCAAAGATTGCATTTATGTTTTTGACAAAGGGGCCAT 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit GTGCTTTATATCCTTTAAGCACAGTACCTCAGCAGGTGCTCATTGTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.9624999999999999 0.0 0.0 0.0 0.0 82-83 1.15 0.0 0.0 0.0 0.0 84-85 1.5 0.0 0.0 0.0 0.0 86-87 1.9124999999999999 0.0 0.0 0.0 0.0 88-89 2.2625 0.0 0.0 0.0 0.0 90-91 2.75 0.0 0.0 0.0 0.0 92-93 3.425 0.0 0.0 0.0 0.0 94-95 3.875 0.0 0.0 0.0 0.0 96-97 4.4625 0.0 0.0 0.0 0.0 98-99 5.3375 0.0 0.0 0.0 0.0 100-101 5.8625 0.0 0.0 0.0 0.0 102-103 6.637499999999999 0.0 0.0 0.0 0.0 104-105 7.25 0.0 0.0 0.0 0.0 106-107 8.175 0.0 0.0 0.0 0.0 108-109 8.962499999999999 0.0 0.0 0.0 0.0 110-111 9.774999999999999 0.0 0.0 0.0 0.0 112-113 10.775 0.0 0.0 0.0 0.0 114-115 11.5 0.0 0.0 0.0 0.0 116-117 12.325 0.0 0.0 0.0 0.0 118-119 13.2125 0.0 0.0 0.0 0.0 120-121 14.3625 0.0 0.0 0.0 0.0 122-123 15.55 0.0 0.0 0.0 0.0 124-125 16.637500000000003 0.0 0.0 0.0 0.0 126-127 17.6625 0.0 0.0 0.0 0.0 128-129 18.7125 0.0 0.0 0.0 0.0 130-131 19.7375 0.0 0.0 0.0 0.0 132-133 20.549999999999997 0.0 0.0 0.0 0.0 134-135 21.225 0.0 0.0 0.0 0.0 136-137 22.25 0.0 0.0 0.0 0.0 138-139 23.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGCT 10 0.006830828 145.0 7 GGACAGC 10 0.006830828 145.0 9 CTGGCTT 10 0.006830828 145.0 8 TCAGCTG 10 0.006830828 145.0 4 AAGGACA 10 0.006830828 145.0 7 AGCTGGC 10 0.006830828 145.0 6 TTAAAGA 10 0.006830828 145.0 145 CAGCTGG 10 0.006830828 145.0 5 >>END_MODULE Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564044 spots for SRR12670170.sra Written 564044 spots for SRR12670170.sra Read 564047 spots for SRR12670170.sra Written 564047 spots for SRR12670170.sra SRR ids: ['SRR12670170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r_qepp85 SRR12670170.sra spots: 11280883 blocks: [[1, 564044], [564045, 1128088], [1128089, 1692132], [1692133, 2256176], [2256177, 2820220], [2820221, 3384264], [3384265, 3948308], [3948309, 4512352], [4512353, 5076396], [5076397, 5640440], [5640441, 6204484], [6204485, 6768528], [6768529, 7332572], [7332573, 7896616], [7896617, 8460660], [8460661, 9024704], [9024705, 9588748], [9588749, 10152792], [10152793, 10716836], [10716837, 11280883]] SRR12670170 file size 3812037 SRR12670170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670170 SRR12670170_1.fastq SRR12670170_2.fastq Input file: SRR12670170_1.fastq Paired file: SRR12670170_2.fastq trimmed: SRR12670170-trimmed-pair1.fastq, SRR12670170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:36:52 2025 >> started Tue Feb 11 08:37:08 2025 >> done (16.199s) 11280883 read pairs processed; of these: 54 ( 0.00%) short read pairs filtered out after trimming by size control 6352 ( 0.06%) empty read pairs filtered out after trimming by size control 11274477 (99.94%) read pairs available; of these: 3116027 (27.64%) trimmed read pairs available after processing 8158450 (72.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 5 0.00% 23 8 0.00% 24 9 0.00% 25 13 0.00% 26 19 0.00% 27 29 0.00% 28 23 0.00% 29 19 0.00% 30 33 0.00% 31 33 0.00% 32 35 0.00% 33 43 0.00% 34 49 0.00% 35 39 0.00% 36 52 0.00% 37 74 0.00% 38 113 0.00% 39 105 0.00% 40 110 0.00% 41 115 0.00% 42 144 0.00% 43 151 0.00% 44 140 0.00% 45 178 0.00% 46 179 0.00% 47 242 0.00% 48 292 0.00% 49 354 0.00% 50 423 0.00% 51 471 0.00% 52 548 0.00% 53 537 0.00% 54 618 0.01% 55 586 0.01% 56 727 0.01% 57 795 0.01% 58 992 0.01% 59 1140 0.01% 60 1368 0.01% 61 1655 0.01% 62 1858 0.02% 63 2123 0.02% 64 2267 0.02% 65 2526 0.02% 66 2708 0.02% 67 3065 0.03% 68 3445 0.03% 69 3646 0.03% 70 4434 0.04% 71 5026 0.04% 72 5737 0.05% 73 6523 0.06% 74 7136 0.06% 75 7776 0.07% 76 8404 0.07% 77 9044 0.08% 78 9820 0.09% 79 11112 0.10% 80 11712 0.10% 81 13280 0.12% 82 14970 0.13% 83 16074 0.14% 84 17905 0.16% 85 19508 0.17% 86 20494 0.18% 87 21112 0.19% 88 22573 0.20% 89 23000 0.20% 90 24740 0.22% 91 26557 0.24% 92 27605 0.24% 93 29695 0.26% 94 31773 0.28% 95 33433 0.30% 96 35024 0.31% 97 35931 0.32% 98 36140 0.32% 99 36927 0.33% 100 38132 0.34% 101 37778 0.34% 102 39192 0.35% 103 40872 0.36% 104 42332 0.38% 105 43488 0.39% 106 44625 0.40% 107 45284 0.40% 108 45247 0.40% 109 45481 0.40% 110 45302 0.40% 111 46673 0.41% 112 47301 0.42% 113 47778 0.42% 114 49082 0.44% 115 49597 0.44% 116 50996 0.45% 117 50431 0.45% 118 51116 0.45% 119 50550 0.45% 120 51105 0.45% 121 51075 0.45% 122 51370 0.46% 123 51621 0.46% 124 51889 0.46% 125 51699 0.46% 126 53057 0.47% 127 52466 0.47% 128 51717 0.46% 129 51411 0.46% 130 51832 0.46% 131 51114 0.45% 132 50813 0.45% 133 51235 0.45% 134 50511 0.45% 135 51492 0.46% 136 51617 0.46% 137 51880 0.46% 138 51763 0.46% 139 52707 0.47% 140 51170 0.45% 141 51347 0.46% 142 51614 0.46% 143 50766 0.45% 144 51595 0.46% 145 51101 0.45% 146 51503 0.46% 147 50990 0.45% 148 52440 0.47% 149 50648 0.45% 150 51633 0.46% 151 8158450 72.36% 11274477 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=2.1 sequence=CTGCCGCACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=34.98 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.9 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTTGAACCATACAGCCTCGCCGAACTTGACACCGTTGCGGGACAAGAGCTCGGGGAAGACGCATCCAAGAGC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=48.17 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12670170 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:37:51 Started mapping on | Feb 11 08:37:51 Finished on | Feb 11 08:39:26 Mapping speed, Million of reads per hour | 427.24 Number of input reads | 11274477 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 10476761 Uniquely mapped reads % | 92.92% Average mapped length | 282.66 Number of splices: Total | 10114732 Number of splices: Annotated (sjdb) | 9856754 Number of splices: GT/AG | 9919018 Number of splices: GC/AG | 146432 Number of splices: AT/AC | 7063 Number of splices: Non-canonical | 42219 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322133 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 64342 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475583 475583 475583 N_multimapping 322133 322133 322133 N_noFeature 342607 10261328 421335 N_ambiguous 213769 636 76756 UnstrandedReadsAssigned:9920385 PositiveStrandReadsAssigned:214797 NegativeStrandReadsAssigned:9978670 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=134 echo kmer=129 SRR12670170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670170-trimmed-pair1.fastq SRR12670170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,274,477 reads, 9,916,473 reads pseudoaligned [quant] estimated average fragment length: 209.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR12670170.ke.tsv 34699 SRR12670170.se.tsv 87100 total ==> SRR12670170.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.26 768.606 35.375 Potri.005G024800.1.v4.1 1035 826.26 300 30.2341 Potri.004G059700.1.v4.1 961 752.307 1 0.110687 Potri.007G009000.2.v4.1 1416 1207.26 0 0 Potri.003G141000.2.v4.1 2943 2734.26 709 21.5923 Potri.016G087400.1.v4.1 270 110.45 819 617.461 Potri.015G069301.1.v4.1 564 364.029 0 0 Potri.010G195200.1.v4.1 1773 1564.26 181.916 9.68399 Potri.012G127500.1.v4.1 977 768.281 46 4.98575 ==> SRR12670170.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 152 Potri.001G212900.v4.1 398 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12670170 completed mapping pipeline successfully