Starting /dee2/code/volunteer_pipeline.sh SRR12670171 current disk space = 3055808348160 free memory = 1155741280 SRR12670171 SRAfilesize 9e8ccca0094709468f953b2aae542511 SRR12670171.sra SRR12670171.sra file validated SRR12670171 is paired end SRR12670171 is conventional basespace SRR12670171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5455 37.0 37.0 37.0 37.0 37.0 2 36.44125 37.0 37.0 37.0 37.0 37.0 3 36.6265 37.0 37.0 37.0 37.0 37.0 4 36.7435 37.0 37.0 37.0 37.0 37.0 5 36.597 37.0 37.0 37.0 37.0 37.0 6 36.6835 37.0 37.0 37.0 37.0 37.0 7 36.608 37.0 37.0 37.0 37.0 37.0 8 36.6405 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.5952 37.0 37.0 37.0 37.0 37.0 15-19 36.6068 37.0 37.0 37.0 37.0 37.0 20-24 36.5415 37.0 37.0 37.0 37.0 37.0 25-29 36.56079999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5586 37.0 37.0 37.0 37.0 37.0 35-39 36.511300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.476800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4585 37.0 37.0 37.0 37.0 37.0 50-54 36.453599999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.388200000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3742 37.0 37.0 37.0 37.0 37.0 65-69 36.30669999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3253 37.0 37.0 37.0 37.0 37.0 75-79 36.3682 37.0 37.0 37.0 37.0 37.0 80-84 36.3648 37.0 37.0 37.0 37.0 37.0 85-89 36.313599999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.275600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2559 37.0 37.0 37.0 37.0 37.0 100-104 36.2528 37.0 37.0 37.0 37.0 37.0 105-109 36.253 37.0 37.0 37.0 37.0 37.0 110-114 36.1645 37.0 37.0 37.0 37.0 37.0 115-119 36.201800000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.1105 37.0 37.0 37.0 37.0 37.0 125-129 35.9953 37.0 37.0 37.0 37.0 37.0 130-134 35.9502 37.0 37.0 37.0 37.0 37.0 135-139 35.8973 37.0 37.0 37.0 37.0 37.0 140-144 35.789 37.0 37.0 37.0 37.0 37.0 145-149 35.674 37.0 37.0 37.0 37.0 37.0 150-151 35.459 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 4.0 27 3.0 28 13.0 29 26.0 30 22.0 31 27.0 32 39.0 33 69.0 34 113.0 35 322.0 36 2940.0 37 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.025 9.875 7.025 45.074999999999996 2 19.333834209867266 12.396694214876034 35.512146255947904 32.75732531930879 3 19.175 15.475 27.800000000000004 37.55 4 23.400000000000002 25.2 22.2 29.2 5 24.474999999999998 29.75 24.2 21.575 6 21.55 33.625 24.25 20.575 7 14.75 25.324999999999996 42.5 17.424999999999997 8 18.975 25.8 32.2 23.025000000000002 9 18.025 25.05 34.5 22.425 10-14 19.585 29.470000000000002 27.36 23.585 15-19 20.54 28.51 27.134999999999998 23.815 20-24 19.759999999999998 27.82 28.67 23.75 25-29 20.28 28.24 27.57 23.91 30-34 20.09 28.615000000000002 27.474999999999998 23.82 35-39 20.3 28.52 27.98 23.200000000000003 40-44 20.215 28.525 27.87 23.39 45-49 20.19 27.834999999999997 27.91 24.065 50-54 20.044999999999998 28.115000000000002 27.71 24.13 55-59 20.645 28.28 27.334999999999997 23.74 60-64 20.580000000000002 28.599999999999998 27.855 22.965 65-69 20.145 28.244999999999997 28.610000000000003 23.0 70-74 21.355 28.095 27.57 22.98 75-79 20.885 28.22 27.534999999999997 23.36 80-84 20.794999999999998 28.415000000000003 27.3 23.49 85-89 20.87 28.21 27.694999999999997 23.225 90-94 20.51 28.255000000000003 27.279999999999998 23.955000000000002 95-99 21.265 28.68 26.669999999999998 23.385 100-104 21.375 28.59 26.71 23.325000000000003 105-109 21.21 28.360000000000003 26.674999999999997 23.755000000000003 110-114 21.435000000000002 28.925 26.474999999999998 23.165 115-119 22.264999999999997 28.665000000000003 25.790000000000003 23.28 120-124 21.78 28.305000000000003 26.31 23.605 125-129 21.755 27.68 26.090000000000003 24.474999999999998 130-134 21.6 27.52 26.76 24.12 135-139 22.37 27.955000000000002 25.19 24.485 140-144 22.255 27.384999999999998 26.715 23.645 145-149 22.39 26.44 26.314999999999998 24.855 150-151 22.400000000000002 26.3125 27.3125 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 2.0 25 4.0 26 3.0 27 2.5 28 3.0 29 9.0 30 16.0 31 20.0 32 35.5 33 38.5 34 46.0 35 82.0 36 93.5 37 90.0 38 121.0 39 162.0 40 177.5 41 190.0 42 225.5 43 276.0 44 273.0 45 249.0 46 263.5 47 262.5 48 247.5 49 217.0 50 179.5 51 145.0 52 113.5 53 104.5 54 91.0 55 68.5 56 54.0 57 36.0 58 25.5 59 27.0 60 16.0 61 4.0 62 3.0 63 4.0 64 4.5 65 5.0 66 3.5 67 1.5 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.0 #Duplication Level Percentage of deduplicated Percentage of total 1 81.34375 65.075 2 13.84375 22.15 3 3.5937499999999996 8.625 4 0.9375 3.0 5 0.25 1.0 6 0.03125 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATCTCATTCATGCTAACCATCTCATCACTTCCAATGTTCACTGGCTC 6 0.15 No Hit CTTCCATCTCAATTGGGCAGGTTCCATCATCCACATTGGCAAGGGGGTTA 5 0.125 No Hit CTTATATCCAATCCAGATCCACCAATCCATAAGTACTCAGCAATGATTTT 5 0.125 No Hit CTCTTAATAACCCTCGACTCAATCGACCCCAACTTGCTAGCTTCCTCCAC 5 0.125 No Hit CAGTGCAGCAATGGCTGGATCATCAATGTGTGTCACAAATCTTGGAGCAT 5 0.125 No Hit GCCACGATGTTTGACCATTGATTTGCAAGTTACAGAAGTGATCATGTAAC 5 0.125 No Hit GGGGTCACGCTGTGGTCTCCTCTGTCAAAGCCCTCATGACAGCATTGAGC 5 0.125 No Hit GTCACCAAATCCAATCATGTCATAACCACCCCACTCATCAGCAAATCGAG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCGTTATATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.275 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.4375 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.525 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.8375 0.0 0.0 0.0 0.0 78-79 1.15 0.0 0.0 0.0 0.0 80-81 1.3125 0.0 0.0 0.0 0.0 82-83 1.5 0.0 0.0 0.0 0.0 84-85 1.8625 0.0 0.0 0.0 0.0 86-87 2.2125000000000004 0.0 0.0 0.0 0.0 88-89 2.6624999999999996 0.0 0.0 0.0 0.0 90-91 3.1624999999999996 0.0 0.0 0.0 0.0 92-93 3.75 0.0 0.0 0.0 0.0 94-95 4.35 0.0 0.0 0.0 0.0 96-97 4.8625 0.0 0.0 0.0 0.0 98-99 5.5 0.0 0.0 0.0 0.0 100-101 6.3375 0.0 0.0 0.0 0.0 102-103 7.1125 0.0 0.0 0.0 0.0 104-105 7.85 0.0 0.0 0.0 0.0 106-107 8.55 0.0 0.0 0.0 0.0 108-109 9.025 0.0 0.0 0.0 0.0 110-111 9.8 0.0 0.0 0.0 0.0 112-113 10.8125 0.0 0.0 0.0 0.0 114-115 11.575 0.0 0.0 0.0 0.0 116-117 12.6125 0.0 0.0 0.0 0.0 118-119 13.5375 0.0 0.0 0.0 0.0 120-121 14.399999999999999 0.0 0.0 0.0 0.0 122-123 15.3125 0.0 0.0 0.0 0.0 124-125 16.125 0.0 0.0 0.0 0.0 126-127 17.2375 0.0 0.0 0.0 0.0 128-129 18.5 0.0 0.0 0.0 0.0 130-131 19.5875 0.0 0.0 0.0 0.0 132-133 20.7 0.0 0.0 0.0 0.0 134-135 21.7125 0.0 0.0 0.0 0.0 136-137 22.825 0.0 0.0 0.0 0.0 138-139 24.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGCT 10 0.006830828 145.0 1 >>END_MODULE SRR12670171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.329 37.0 37.0 37.0 37.0 37.0 2 36.1505 37.0 37.0 37.0 37.0 37.0 3 36.242 37.0 37.0 37.0 37.0 37.0 4 36.3855 37.0 37.0 37.0 37.0 37.0 5 36.379 37.0 37.0 37.0 37.0 37.0 6 36.303 37.0 37.0 37.0 37.0 37.0 7 36.4165 37.0 37.0 37.0 37.0 37.0 8 36.3885 37.0 37.0 37.0 37.0 37.0 9 36.399 37.0 37.0 37.0 37.0 37.0 10-14 36.4227 37.0 37.0 37.0 37.0 37.0 15-19 36.4029 37.0 37.0 37.0 37.0 37.0 20-24 36.3582 37.0 37.0 37.0 37.0 37.0 25-29 36.3076 37.0 37.0 37.0 37.0 37.0 30-34 36.2082 37.0 37.0 37.0 37.0 37.0 35-39 36.287400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2731 37.0 37.0 37.0 37.0 37.0 45-49 36.277 37.0 37.0 37.0 37.0 37.0 50-54 36.2102 37.0 37.0 37.0 37.0 37.0 55-59 36.204 37.0 37.0 37.0 37.0 37.0 60-64 36.1465 37.0 37.0 37.0 37.0 37.0 65-69 36.1887 37.0 37.0 37.0 37.0 37.0 70-74 36.1476 37.0 37.0 37.0 37.0 37.0 75-79 36.133799999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0216 37.0 37.0 37.0 37.0 37.0 85-89 36.035399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.037099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9415 37.0 37.0 37.0 37.0 37.0 100-104 35.9023 37.0 37.0 37.0 37.0 37.0 105-109 35.83290000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6986 37.0 37.0 37.0 37.0 37.0 115-119 35.639500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.452999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.2467 37.0 37.0 37.0 32.2 37.0 130-134 34.9083 37.0 37.0 37.0 27.4 37.0 135-139 34.7526 37.0 37.0 37.0 25.0 37.0 140-144 34.408 37.0 37.0 37.0 25.0 37.0 145-149 34.0888 37.0 37.0 37.0 25.0 37.0 150-151 33.86825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 0.0 21 4.0 22 2.0 23 0.0 24 5.0 25 2.0 26 7.0 27 12.0 28 12.0 29 26.0 30 31.0 31 62.0 32 58.0 33 176.0 34 245.0 35 525.0 36 2559.0 37 265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.175 20.325 11.95 28.549999999999997 2 25.75 26.424999999999997 30.875000000000004 16.950000000000003 3 21.5 28.549999999999997 30.875000000000004 19.075 4 23.9 32.5 25.275 18.325 5 26.825 34.9 22.125 16.150000000000002 6 20.150000000000002 39.5 23.150000000000002 17.2 7 20.025000000000002 22.85 37.7 19.425 8 21.05 26.025 28.125 24.8 9 21.85 24.4 29.625 24.125 10-14 23.385 29.475 26.515 20.625 15-19 22.88 29.025000000000002 27.615000000000002 20.48 20-24 23.095 29.04 27.255000000000003 20.61 25-29 22.62 28.74 27.625 21.015 30-34 22.805 27.98 27.865000000000002 21.349999999999998 35-39 22.689999999999998 27.79 28.53 20.990000000000002 40-44 23.34 28.405 27.465 20.79 45-49 23.105 27.24 28.26 21.395 50-54 23.119999999999997 28.33 27.400000000000002 21.15 55-59 23.11 28.235 27.634999999999998 21.02 60-64 23.119999999999997 28.144999999999996 27.63 21.105 65-69 22.509999999999998 27.985 28.084999999999997 21.42 70-74 24.11 28.410000000000004 27.18 20.3 75-79 23.195 27.265 28.665000000000003 20.875 80-84 23.425 28.71 27.16 20.705000000000002 85-89 24.295 27.465 27.794999999999998 20.445 90-94 24.055 27.88 27.435 20.630000000000003 95-99 24.095 27.92 27.62 20.365 100-104 25.385 28.294999999999998 26.584999999999997 19.735 105-109 25.15 27.955000000000002 27.084999999999997 19.81 110-114 26.435 27.83 26.88 18.855 115-119 26.924999999999997 27.279999999999998 25.81 19.985 120-124 27.139999999999997 27.29 26.255 19.314999999999998 125-129 28.410000000000004 27.425 25.424999999999997 18.740000000000002 130-134 28.725 26.790000000000003 26.07 18.415 135-139 29.555 26.815 25.490000000000002 18.14 140-144 30.65 26.365 25.44 17.544999999999998 145-149 32.14 25.509999999999998 25.45 16.900000000000002 150-151 33.9625 25.4875 23.575 16.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 1.0 22 0.0 23 2.5 24 3.0 25 2.0 26 3.0 27 4.5 28 10.5 29 11.5 30 10.5 31 16.0 32 34.5 33 51.0 34 56.0 35 75.0 36 96.0 37 106.0 38 130.0 39 168.0 40 193.5 41 217.5 42 247.5 43 273.5 44 267.5 45 255.5 46 263.5 47 247.5 48 217.5 49 189.0 50 159.0 51 140.5 52 108.5 53 85.5 54 86.0 55 64.0 56 45.0 57 36.0 58 28.0 59 24.0 60 16.0 61 9.5 62 10.0 63 8.0 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 1.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 81.68794767985051 65.575 2 13.48489567113049 21.65 3 3.7060105886016816 8.924999999999999 4 0.8408595453129867 2.7 5 0.24914356898162568 1.0 6 0.03114294612270321 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGGGAGATGGACTTCAAACCCGATCTTTCACATTCATTGATGAGTGTG 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit CCCCACAAAAAACCACTAAAAAGATCAAAACGTTTTTACAAAAAATCCAC 5 0.125 No Hit CGATTACCTAATATCAAGGTTGCTACAGTACTTCTTTGTTGCGCATTTGT 5 0.125 No Hit CAGCAGGATGGAAGCTTTGGCCATTTGCTCATCTTATTACATATGGTGTG 5 0.125 No Hit CAAATATCAGGTCACTATAACCCCAGAAACTAACCTTATATGTTGGTGTA 5 0.125 No Hit AACACCTCATTGCCCTTGCAAAGCAAGAGGGTGTCATTGAAGAGGTATTG 5 0.125 No Hit CAACAACTTCCATAAACAATCTCAAAACACAGAGAAGTTTCTTTGGTTTT 5 0.125 No Hit GGGTGATCGTTGCGATCTTGATCTAGTCTCAGGATGCATGGATCCTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.275 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.4375 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.525 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.8375 0.0 0.0 0.0 0.0 78-79 1.15 0.0 0.0 0.0 0.0 80-81 1.3125 0.0 0.0 0.0 0.0 82-83 1.5 0.0 0.0 0.0 0.0 84-85 1.8625 0.0 0.0 0.0 0.0 86-87 2.2125000000000004 0.0 0.0 0.0 0.0 88-89 2.6624999999999996 0.0 0.0 0.0 0.0 90-91 3.1624999999999996 0.0 0.0 0.0 0.0 92-93 3.75 0.0 0.0 0.0 0.0 94-95 4.3625 0.0 0.0 0.0 0.0 96-97 4.9375 0.0 0.0 0.0 0.0 98-99 5.575 0.0 0.0 0.0 0.0 100-101 6.4125 0.0 0.0 0.0 0.0 102-103 7.2 0.0 0.0 0.0 0.0 104-105 7.949999999999999 0.0 0.0 0.0 0.0 106-107 8.675 0.0 0.0 0.0 0.0 108-109 9.1875 0.0 0.0 0.0 0.0 110-111 10.037500000000001 0.0 0.0 0.0 0.0 112-113 11.0125 0.0 0.0 0.0 0.0 114-115 11.75 0.0 0.0 0.0 0.0 116-117 12.7875 0.0 0.0 0.0 0.0 118-119 13.7 0.0 0.0 0.0 0.0 120-121 14.5875 0.0 0.0 0.0 0.0 122-123 15.5375 0.0 0.0 0.0 0.0 124-125 16.35 0.0 0.0 0.0 0.0 126-127 17.4625 0.0 0.0 0.0 0.0 128-129 18.75 0.0 0.0 0.0 0.0 130-131 19.85 0.0 0.0 0.0 0.0 132-133 20.975 0.0 0.0 0.0 0.0 134-135 21.975 0.0 0.0 0.0 0.0 136-137 23.1 0.0 0.0 0.0 0.0 138-139 24.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGAC 10 0.006830828 145.0 8 AAGAACA 10 0.006830828 145.0 5 GGAATTC 10 0.006830828 145.0 8 >>END_MODULE Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra Read 755084 spots for SRR12670171.sra Written 755084 spots for SRR12670171.sra SRR ids: ['SRR12670171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bng8c2sq SRR12670171.sra spots: 15101680 blocks: [[1, 755084], [755085, 1510168], [1510169, 2265252], [2265253, 3020336], [3020337, 3775420], [3775421, 4530504], [4530505, 5285588], [5285589, 6040672], [6040673, 6795756], [6795757, 7550840], [7550841, 8305924], [8305925, 9061008], [9061009, 9816092], [9816093, 10571176], [10571177, 11326260], [11326261, 12081344], [12081345, 12836428], [12836429, 13591512], [13591513, 14346596], [14346597, 15101680]] SRR12670171 file size 5110511 SRR12670171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670171 SRR12670171_1.fastq SRR12670171_2.fastq Input file: SRR12670171_1.fastq Paired file: SRR12670171_2.fastq trimmed: SRR12670171-trimmed-pair1.fastq, SRR12670171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:10:03 2025 >> started Tue Feb 11 08:10:21 2025 >> done (17.377s) 15101680 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 6206 ( 0.04%) empty read pairs filtered out after trimming by size control 15095415 (99.96%) read pairs available; of these: 4604124 (30.50%) trimmed read pairs available after processing 10491291 (69.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 8 0.00% 21 4 0.00% 22 5 0.00% 23 7 0.00% 24 10 0.00% 25 12 0.00% 26 15 0.00% 27 28 0.00% 28 26 0.00% 29 30 0.00% 30 44 0.00% 31 43 0.00% 32 49 0.00% 33 60 0.00% 34 66 0.00% 35 87 0.00% 36 116 0.00% 37 123 0.00% 38 120 0.00% 39 183 0.00% 40 186 0.00% 41 216 0.00% 42 229 0.00% 43 251 0.00% 44 241 0.00% 45 286 0.00% 46 331 0.00% 47 439 0.00% 48 473 0.00% 49 575 0.00% 50 672 0.00% 51 861 0.01% 52 922 0.01% 53 950 0.01% 54 1126 0.01% 55 1132 0.01% 56 1274 0.01% 57 1467 0.01% 58 1667 0.01% 59 2123 0.01% 60 2507 0.02% 61 2881 0.02% 62 3145 0.02% 63 3568 0.02% 64 3786 0.03% 65 4131 0.03% 66 4456 0.03% 67 4888 0.03% 68 5519 0.04% 69 6364 0.04% 70 7351 0.05% 71 8350 0.06% 72 9729 0.06% 73 10579 0.07% 74 11722 0.08% 75 12704 0.08% 76 13695 0.09% 77 14625 0.10% 78 16090 0.11% 79 17105 0.11% 80 18833 0.12% 81 21241 0.14% 82 23616 0.16% 83 25805 0.17% 84 28137 0.19% 85 30425 0.20% 86 32072 0.21% 87 33436 0.22% 88 35579 0.24% 89 36766 0.24% 90 38894 0.26% 91 41678 0.28% 92 43809 0.29% 93 47243 0.31% 94 49247 0.33% 95 52335 0.35% 96 53664 0.36% 97 55371 0.37% 98 55453 0.37% 99 57550 0.38% 100 58733 0.39% 101 59654 0.40% 102 62515 0.41% 103 63267 0.42% 104 65174 0.43% 105 66771 0.44% 106 68474 0.45% 107 68395 0.45% 108 69057 0.46% 109 69706 0.46% 110 68789 0.46% 111 69564 0.46% 112 70460 0.47% 113 70535 0.47% 114 72803 0.48% 115 74454 0.49% 116 74133 0.49% 117 74528 0.49% 118 74833 0.50% 119 73956 0.49% 120 74412 0.49% 121 74218 0.49% 122 74660 0.49% 123 74965 0.50% 124 75355 0.50% 125 74463 0.49% 126 75771 0.50% 127 75892 0.50% 128 75469 0.50% 129 75026 0.50% 130 74541 0.49% 131 73890 0.49% 132 72702 0.48% 133 73180 0.48% 134 72923 0.48% 135 73457 0.49% 136 73230 0.49% 137 72931 0.48% 138 72863 0.48% 139 73621 0.49% 140 72294 0.48% 141 72031 0.48% 142 71902 0.48% 143 70582 0.47% 144 71661 0.47% 145 71465 0.47% 146 71410 0.47% 147 70805 0.47% 148 71517 0.47% 149 70105 0.46% 150 70165 0.46% 151 10491291 69.50% 15095415 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=17.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=35.34 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.0 sequence=AAAGAAAAGAAAA SRR12670171 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:11:14 Started mapping on | Feb 11 08:11:14 Finished on | Feb 11 08:12:45 Mapping speed, Million of reads per hour | 597.18 Number of input reads | 15095415 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 14264985 Uniquely mapped reads % | 94.50% Average mapped length | 280.30 Number of splices: Total | 13480249 Number of splices: Annotated (sjdb) | 13183125 Number of splices: GT/AG | 13207889 Number of splices: GC/AG | 220754 Number of splices: AT/AC | 8070 Number of splices: Non-canonical | 43536 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340920 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 116981 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489510 489510 489510 N_multimapping 340920 340920 340920 N_noFeature 596788 14048599 688214 N_ambiguous 209972 791 84547 UnstrandedReadsAssigned:13458225 PositiveStrandReadsAssigned:215595 NegativeStrandReadsAssigned:13492224 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=128 echo kmer=123 SRR12670171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670171-trimmed-pair1.fastq SRR12670171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,095,415 reads, 13,574,500 reads pseudoaligned [quant] estimated average fragment length: 200.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR12670171.ke.tsv 34699 SRR12670171.se.tsv 87100 total ==> SRR12670171.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.66 644 26.2231 Potri.005G024800.1.v4.1 1035 835.664 177 15.6853 Potri.004G059700.1.v4.1 961 761.72 10 0.9722 Potri.007G009000.2.v4.1 1416 1216.66 0 0 Potri.003G141000.2.v4.1 2943 2743.66 1014.54 27.3836 Potri.016G087400.1.v4.1 270 114.341 676 437.819 Potri.015G069301.1.v4.1 564 372.621 0 0 Potri.010G195200.1.v4.1 1773 1573.66 71 3.34116 Potri.012G127500.1.v4.1 977 777.695 97 9.23662 ==> SRR12670171.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 128 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12670171 completed mapping pipeline successfully