Starting /dee2/code/volunteer_pipeline.sh SRR12670173 current disk space = 3055708966912 free memory = 1415203252 SRR12670173 SRAfilesize 3230bfc301d55702334e0cea99475bfa SRR12670173.sra SRR12670173.sra file validated SRR12670173 is paired end SRR12670173 is conventional basespace SRR12670173 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670173_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6315 37.0 37.0 37.0 37.0 37.0 2 36.4145 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.667 37.0 37.0 37.0 37.0 37.0 5 36.6645 37.0 37.0 37.0 37.0 37.0 6 36.6495 37.0 37.0 37.0 37.0 37.0 7 36.4415 37.0 37.0 37.0 37.0 37.0 8 36.626 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.6056 37.0 37.0 37.0 37.0 37.0 15-19 36.5938 37.0 37.0 37.0 37.0 37.0 20-24 36.4959 37.0 37.0 37.0 37.0 37.0 25-29 36.5136 37.0 37.0 37.0 37.0 37.0 30-34 36.4533 37.0 37.0 37.0 37.0 37.0 35-39 36.5186 37.0 37.0 37.0 37.0 37.0 40-44 36.4354 37.0 37.0 37.0 37.0 37.0 45-49 36.4404 37.0 37.0 37.0 37.0 37.0 50-54 36.4027 37.0 37.0 37.0 37.0 37.0 55-59 36.3673 37.0 37.0 37.0 37.0 37.0 60-64 36.3513 37.0 37.0 37.0 37.0 37.0 65-69 36.302099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3017 37.0 37.0 37.0 37.0 37.0 75-79 36.34160000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3433 37.0 37.0 37.0 37.0 37.0 85-89 36.2906 37.0 37.0 37.0 37.0 37.0 90-94 36.2547 37.0 37.0 37.0 37.0 37.0 95-99 36.2616 37.0 37.0 37.0 37.0 37.0 100-104 36.215199999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1545 37.0 37.0 37.0 37.0 37.0 110-114 36.1867 37.0 37.0 37.0 37.0 37.0 115-119 36.1262 37.0 37.0 37.0 37.0 37.0 120-124 36.0644 37.0 37.0 37.0 37.0 37.0 125-129 35.9393 37.0 37.0 37.0 37.0 37.0 130-134 35.7485 37.0 37.0 37.0 37.0 37.0 135-139 35.64739999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.436099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.2554 37.0 37.0 37.0 34.6 37.0 150-151 34.997 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 4.0 26 3.0 27 5.0 28 13.0 29 19.0 30 32.0 31 34.0 32 45.0 33 75.0 34 140.0 35 380.0 36 2920.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75 11.375 5.0 39.875 2 17.737079779227297 13.748118414450577 38.25890617160061 30.255895634721526 3 17.25 16.375 29.7 36.675000000000004 4 22.625 25.75 24.625 27.0 5 22.95 31.95 23.400000000000002 21.7 6 20.875 34.675 22.95 21.5 7 14.7 28.15 40.35 16.8 8 18.325 25.45 32.275 23.95 9 17.724999999999998 22.05 36.65 23.575 10-14 19.830000000000002 29.64 27.47 23.06 15-19 20.165 28.04 27.544999999999998 24.25 20-24 19.775000000000002 28.27 27.915 24.04 25-29 20.544999999999998 28.63 27.284999999999997 23.54 30-34 19.77 28.084999999999997 28.345 23.799999999999997 35-39 20.095 27.965 27.994999999999997 23.945 40-44 19.875 28.26 28.09 23.775 45-49 20.630000000000003 28.000000000000004 27.935 23.435 50-54 20.064999999999998 28.050000000000004 28.03 23.855 55-59 20.515 27.79 28.18 23.515 60-64 19.97 27.705000000000002 28.744999999999997 23.580000000000002 65-69 20.32 28.144999999999996 27.615000000000002 23.919999999999998 70-74 20.91 28.49 27.395000000000003 23.205000000000002 75-79 20.44 28.185 28.03 23.345 80-84 20.355 29.03 27.105 23.51 85-89 20.73 28.78 27.01 23.48 90-94 21.365000000000002 28.24 27.07 23.325000000000003 95-99 21.51 28.549999999999997 26.91 23.03 100-104 20.985 29.13 26.605 23.28 105-109 21.075 29.404999999999998 26.235000000000003 23.285 110-114 21.404999999999998 28.52 26.5 23.575 115-119 21.740000000000002 28.310000000000002 26.334999999999997 23.615 120-124 21.015 29.53 26.375 23.080000000000002 125-129 22.375 28.04 25.72 23.865 130-134 21.22 28.68 25.82 24.279999999999998 135-139 21.285 28.04 26.22 24.455 140-144 22.37 28.585 25.474999999999998 23.57 145-149 21.545 27.065 26.0 25.39 150-151 21.625 27.6 26.125 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 3.5 26 4.0 27 4.5 28 5.0 29 9.0 30 22.0 31 28.5 32 34.0 33 45.5 34 47.5 35 61.5 36 78.5 37 92.5 38 126.5 39 170.5 40 185.5 41 199.0 42 238.0 43 250.5 44 272.0 45 288.0 46 275.5 47 245.0 48 222.0 49 215.0 50 172.5 51 136.5 52 111.0 53 100.0 54 92.5 55 71.0 56 58.5 57 44.5 58 28.0 59 16.0 60 13.5 61 8.0 62 2.0 63 2.5 64 2.0 65 2.5 66 4.5 67 3.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 83.30785692448792 68.125 2 12.595536533170284 20.599999999999998 3 2.996025680220116 7.35 4 0.8865790278202385 2.9000000000000004 5 0.12228676245796392 0.5 6 0.06114338122898196 0.3 7 0.0 0.0 8 0.0 0.0 9 0.03057169061449098 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCCGAAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 10 (97% over 37bp) CCTTTGATCTGGCCTCTTAGATCCAAATGAATTGCTCCAAATTGAGTCAT 6 0.15 No Hit GCCAAATCTTATTACAATAATGAACCGGGAAATACAGAGTAATAGAACTC 6 0.15 No Hit CCCAGGAAAGTAAGGATTGTAGTGCAAACCCTCTCGGATCGAAACACCAG 5 0.125 No Hit AACGACACTTCAGCAGCCAGCACCTTGAGAGGATGAAGCAAATGCCTGAT 5 0.125 No Hit GTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGA 5 0.125 No Hit GTTCAAACCATGAGGACTTTCAATGATTAGAAGACTCAAAATTGTCCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.42500000000000004 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.725 0.0 0.0 0.0 0.0 78-79 0.8375 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.4625 0.0 0.0 0.0 0.0 84-85 1.725 0.0 0.0 0.0 0.0 86-87 2.1624999999999996 0.0 0.0 0.0 0.0 88-89 2.6375 0.0 0.0 0.0 0.0 90-91 3.45 0.0 0.0 0.0 0.0 92-93 4.0 0.0 0.0 0.0 0.0 94-95 4.65 0.0 0.0 0.0 0.0 96-97 5.1375 0.0 0.0 0.0 0.0 98-99 5.875 0.0 0.0 0.0 0.0 100-101 6.7 0.0 0.0 0.0 0.0 102-103 7.7125 0.0 0.0 0.0 0.0 104-105 8.4625 0.0 0.0 0.0 0.0 106-107 9.225 0.0 0.0 0.0 0.0 108-109 10.0 0.0 0.0 0.0 0.0 110-111 10.9125 0.0 0.0 0.0 0.0 112-113 11.7875 0.0 0.0 0.0 0.0 114-115 12.825 0.0 0.0 0.0 0.0 116-117 13.6875 0.0 0.0 0.0 0.0 118-119 14.6375 0.0 0.0 0.0 0.0 120-121 15.675 0.0 0.0 0.0 0.0 122-123 16.925 0.0 0.0 0.0 0.0 124-125 17.725 0.0 0.0 0.0 0.0 126-127 18.625 0.0 0.0 0.0 0.0 128-129 19.450000000000003 0.0 0.0 0.0 0.0 130-131 20.2375 0.0 0.0 0.0 0.0 132-133 21.1375 0.0 0.0 0.0 0.0 134-135 22.1875 0.0 0.0 0.0 0.0 136-137 23.375 0.0 0.0 0.0 0.0 138-139 24.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACTGG 10 0.006830828 145.0 8 CATTCAA 10 0.006830828 145.0 1 TCAAACA 10 0.006830828 145.0 4 GATAGAT 10 0.006830828 145.0 145 TCGTATG 35 0.0033124194 62.14286 145 TCTCGTA 35 0.0035366106 20.714287 140-144 GAAATCT 40 0.0076550315 18.125 135-139 CGAAATC 40 0.0076550315 18.125 135-139 CTCGTAT 40 0.0076550315 18.125 140-144 AAAAAAA 115 0.0025531333 10.086957 105-109 >>END_MODULE SRR12670173 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670173_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15 37.0 37.0 37.0 37.0 37.0 2 36.199 37.0 37.0 37.0 37.0 37.0 3 36.1955 37.0 37.0 37.0 37.0 37.0 4 36.2845 37.0 37.0 37.0 37.0 37.0 5 36.3705 37.0 37.0 37.0 37.0 37.0 6 36.256 37.0 37.0 37.0 37.0 37.0 7 36.3205 37.0 37.0 37.0 37.0 37.0 8 36.2815 37.0 37.0 37.0 37.0 37.0 9 36.3735 37.0 37.0 37.0 37.0 37.0 10-14 36.2909 37.0 37.0 37.0 37.0 37.0 15-19 36.3274 37.0 37.0 37.0 37.0 37.0 20-24 36.24229999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2504 37.0 37.0 37.0 37.0 37.0 30-34 36.14549999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1313 37.0 37.0 37.0 37.0 37.0 40-44 36.1391 37.0 37.0 37.0 37.0 37.0 45-49 36.1364 37.0 37.0 37.0 37.0 37.0 50-54 36.064800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.013400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0848 37.0 37.0 37.0 37.0 37.0 65-69 35.9899 37.0 37.0 37.0 37.0 37.0 70-74 35.968399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9408 37.0 37.0 37.0 37.0 37.0 80-84 35.8983 37.0 37.0 37.0 37.0 37.0 85-89 35.9054 37.0 37.0 37.0 37.0 37.0 90-94 35.863099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9062 37.0 37.0 37.0 37.0 37.0 100-104 35.8001 37.0 37.0 37.0 37.0 37.0 105-109 35.6896 37.0 37.0 37.0 37.0 37.0 110-114 35.637100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7253 37.0 37.0 37.0 37.0 37.0 120-124 35.478899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4134 37.0 37.0 37.0 37.0 37.0 130-134 35.1545 37.0 37.0 37.0 29.8 37.0 135-139 34.989 37.0 37.0 37.0 25.0 37.0 140-144 34.757799999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.34949999999999 37.0 37.0 37.0 25.0 37.0 150-151 33.99275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 4.0 23 4.0 24 5.0 25 10.0 26 10.0 27 13.0 28 13.0 29 13.0 30 23.0 31 49.0 32 70.0 33 137.0 34 283.0 35 617.0 36 2491.0 37 246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.05 24.25 8.4 25.3 2 26.400000000000002 27.800000000000004 30.575000000000003 15.225 3 21.275 28.749999999999996 31.65 18.325 4 24.025 33.85 24.4 17.724999999999998 5 25.35 37.025000000000006 21.375 16.25 6 21.2 40.175 21.575 17.05 7 21.375 21.55 39.775 17.299999999999997 8 20.674999999999997 25.55 29.799999999999997 23.974999999999998 9 22.175 24.875 29.075 23.875 10-14 23.810000000000002 29.255 26.395000000000003 20.54 15-19 23.150000000000002 27.944999999999997 28.01 20.895 20-24 23.28 28.075 28.244999999999997 20.4 25-29 23.26 28.63 28.095 20.015 30-34 22.845 28.46 27.334999999999997 21.36 35-39 22.725 28.955 27.76 20.560000000000002 40-44 23.165 28.215 28.455000000000002 20.165 45-49 23.69 27.785 28.610000000000003 19.915 50-54 22.655 28.42 28.565 20.36 55-59 23.175 27.6 27.905 21.32 60-64 23.45 28.175 28.505000000000003 19.869999999999997 65-69 23.87 28.189999999999998 27.450000000000003 20.49 70-74 23.27 27.92 27.650000000000002 21.16 75-79 23.885 28.035 27.939999999999998 20.14 80-84 23.855 28.46 27.284999999999997 20.4 85-89 23.86 28.22 27.095000000000002 20.825 90-94 23.5 28.605000000000004 27.279999999999998 20.615 95-99 24.29 28.78 26.58 20.349999999999998 100-104 24.67 27.794999999999998 27.3 20.235 105-109 25.240000000000002 28.7 26.655 19.405 110-114 25.825 29.020000000000003 25.445 19.71 115-119 25.814999999999998 28.285 26.275 19.625 120-124 26.515 28.249999999999996 26.375 18.86 125-129 27.88 27.825 26.075 18.22 130-134 28.13 27.650000000000002 25.919999999999998 18.3 135-139 28.33 27.639999999999997 26.32 17.71 140-144 30.214999999999996 27.150000000000002 25.245 17.39 145-149 30.855 27.075 24.635 17.435000000000002 150-151 31.837500000000002 25.637500000000003 24.9875 17.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 2.5 25 2.0 26 2.5 27 4.5 28 7.0 29 9.0 30 16.5 31 24.5 32 34.5 33 47.5 34 56.5 35 77.5 36 94.5 37 106.5 38 133.0 39 174.5 40 208.0 41 212.5 42 221.0 43 251.5 44 286.5 45 306.0 46 280.5 47 252.0 48 236.0 49 202.0 50 159.0 51 112.0 52 102.0 53 89.5 54 61.5 55 51.0 56 42.5 57 35.5 58 25.5 59 17.5 60 11.0 61 5.5 62 2.5 63 0.5 64 1.0 65 1.5 66 2.0 67 1.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.5 96 0.5 97 1.0 98 2.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 83.4904226208574 68.65 2 12.557008209182122 20.65 3 3.0100334448160537 7.425 4 0.7905138339920948 2.6 5 0.09121313469139557 0.375 6 0.060808756460930376 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTTCTTCCCTGCTCCTTACATTTTCTTTACTTTAAAACTTTTATATTT 6 0.15 No Hit GTCAACTCAGTACCTTTGCTTCCCAAAATCTTGGAGCTGGTGGGGCTTGG 6 0.15 No Hit GCCATTAAGGCTTATGTGGGCTCTTGTTACTTGAGTTGACGGTAAATTGA 5 0.125 No Hit GCGAATGAACAAGCAGCTAGATTTGCTAATGGAGGAGCATATCCTCCAGA 5 0.125 No Hit GTTCTATTTGTTCCATGAGGGCTAGCATTCAGTTCATTGTCCCTTCTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.3875 0.0 0.0 0.0 0.0 72-73 0.42500000000000004 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.725 0.0 0.0 0.0 0.0 78-79 0.8375 0.0 0.0 0.0 0.0 80-81 1.0375 0.0 0.0 0.0 0.0 82-83 1.55 0.0 0.0 0.0 0.0 84-85 1.825 0.0 0.0 0.0 0.0 86-87 2.2625 0.0 0.0 0.0 0.0 88-89 2.7249999999999996 0.0 0.0 0.0 0.0 90-91 3.5125 0.0 0.0 0.0 0.0 92-93 4.05 0.0 0.0 0.0 0.0 94-95 4.7 0.0 0.0 0.0 0.0 96-97 5.199999999999999 0.0 0.0 0.0 0.0 98-99 5.925 0.0 0.0 0.0 0.0 100-101 6.7875 0.0 0.0 0.0 0.0 102-103 7.8125 0.0 0.0 0.0 0.0 104-105 8.575 0.0 0.0 0.0 0.0 106-107 9.325 0.0 0.0 0.0 0.0 108-109 10.125 0.0 0.0 0.0 0.0 110-111 11.024999999999999 0.0 0.0 0.0 0.0 112-113 11.8875 0.0 0.0 0.0 0.0 114-115 12.9125 0.0 0.0 0.0 0.0 116-117 13.7625 0.0 0.0 0.0 0.0 118-119 14.6875 0.0 0.0 0.0 0.0 120-121 15.725 0.0 0.0 0.0 0.0 122-123 16.95 0.0 0.0 0.0 0.0 124-125 17.725 0.0 0.0 0.0 0.0 126-127 18.65 0.0 0.0 0.0 0.0 128-129 19.487499999999997 0.0 0.0 0.0 0.0 130-131 20.2875 0.0 0.0 0.0 0.0 132-133 21.175 0.0 0.0 0.0 0.0 134-135 22.1625 0.0 0.0 0.0 0.0 136-137 23.35 0.0 0.0 0.0 0.0 138-139 24.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGACC 10 0.006830828 145.0 1 CCCGGGA 10 0.006830828 145.0 7 TAGCTGC 10 0.006830828 145.0 9 CCCCGGG 10 0.006830828 145.0 6 CGGGAGT 10 0.006830828 145.0 9 CCGGGAG 10 0.006830828 145.0 8 AGACCCC 10 0.006830828 145.0 3 GACCCCG 10 0.006830828 145.0 4 TTTATTT 10 0.006830828 145.0 145 GAGACCC 10 0.006830828 145.0 2 TTTTTTT 130 4.8405236E-5 11.153846 80-84 >>END_MODULE Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894861 spots for SRR12670173.sra Written 894861 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra Read 894850 spots for SRR12670173.sra Written 894850 spots for SRR12670173.sra SRR ids: ['SRR12670173.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pgoh0mja SRR12670173.sra spots: 17897011 blocks: [[1, 894850], [894851, 1789700], [1789701, 2684550], [2684551, 3579400], [3579401, 4474250], [4474251, 5369100], [5369101, 6263950], [6263951, 7158800], [7158801, 8053650], [8053651, 8948500], [8948501, 9843350], [9843351, 10738200], [10738201, 11633050], [11633051, 12527900], [12527901, 13422750], [13422751, 14317600], [14317601, 15212450], [15212451, 16107300], [16107301, 17002150], [17002151, 17897011]] SRR12670173 file size 6060486 SRR12670173 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670173 SRR12670173_1.fastq SRR12670173_2.fastq Input file: SRR12670173_1.fastq Paired file: SRR12670173_2.fastq trimmed: SRR12670173-trimmed-pair1.fastq, SRR12670173-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:27:48 2025 >> started Tue Feb 11 08:28:07 2025 >> done (19.035s) 17897011 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 44982 ( 0.25%) empty read pairs filtered out after trimming by size control 17851924 (99.75%) read pairs available; of these: 5063800 (28.37%) trimmed read pairs available after processing 12788124 (71.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 3 0.00% 20 21 0.00% 21 17 0.00% 22 32 0.00% 23 17 0.00% 24 40 0.00% 25 44 0.00% 26 53 0.00% 27 52 0.00% 28 54 0.00% 29 68 0.00% 30 70 0.00% 31 111 0.00% 32 93 0.00% 33 109 0.00% 34 120 0.00% 35 131 0.00% 36 129 0.00% 37 164 0.00% 38 197 0.00% 39 213 0.00% 40 261 0.00% 41 271 0.00% 42 307 0.00% 43 347 0.00% 44 360 0.00% 45 375 0.00% 46 392 0.00% 47 461 0.00% 48 557 0.00% 49 727 0.00% 50 839 0.00% 51 904 0.01% 52 986 0.01% 53 1002 0.01% 54 1045 0.01% 55 1369 0.01% 56 1372 0.01% 57 1541 0.01% 58 1864 0.01% 59 2201 0.01% 60 2712 0.02% 61 2971 0.02% 62 3377 0.02% 63 3729 0.02% 64 4049 0.02% 65 4438 0.02% 66 4832 0.03% 67 5470 0.03% 68 5937 0.03% 69 7079 0.04% 70 7949 0.04% 71 9173 0.05% 72 10327 0.06% 73 11739 0.07% 74 12924 0.07% 75 13486 0.08% 76 15032 0.08% 77 15990 0.09% 78 17309 0.10% 79 18919 0.11% 80 20526 0.11% 81 23589 0.13% 82 25347 0.14% 83 28074 0.16% 84 30622 0.17% 85 32933 0.18% 86 33661 0.19% 87 35801 0.20% 88 37561 0.21% 89 38643 0.22% 90 41836 0.23% 91 44169 0.25% 92 46788 0.26% 93 50073 0.28% 94 52877 0.30% 95 55668 0.31% 96 56777 0.32% 97 57694 0.32% 98 58775 0.33% 99 60469 0.34% 100 61828 0.35% 101 63152 0.35% 102 65588 0.37% 103 67331 0.38% 104 69637 0.39% 105 71160 0.40% 106 72568 0.41% 107 72321 0.41% 108 73121 0.41% 109 73923 0.41% 110 73797 0.41% 111 74546 0.42% 112 76641 0.43% 113 77689 0.44% 114 79165 0.44% 115 79836 0.45% 116 81117 0.45% 117 81745 0.46% 118 81374 0.46% 119 80819 0.45% 120 81222 0.45% 121 81583 0.46% 122 81815 0.46% 123 82157 0.46% 124 84002 0.47% 125 82998 0.46% 126 84685 0.47% 127 84028 0.47% 128 83769 0.47% 129 84434 0.47% 130 83677 0.47% 131 82048 0.46% 132 82144 0.46% 133 83201 0.47% 134 82783 0.46% 135 83193 0.47% 136 83582 0.47% 137 82888 0.46% 138 83089 0.47% 139 83806 0.47% 140 81936 0.46% 141 81782 0.46% 142 81869 0.46% 143 81867 0.46% 144 81971 0.46% 145 82191 0.46% 146 81939 0.46% 147 81301 0.46% 148 81459 0.46% 149 79884 0.45% 150 80881 0.45% 151 12788124 71.63% 17851924 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=169.94 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=0.73 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=33.37 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=12.3 sequence=AAAGAAAAGAAAA SRR12670173 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:28:47 Started mapping on | Feb 11 08:28:48 Finished on | Feb 11 08:30:35 Mapping speed, Million of reads per hour | 600.63 Number of input reads | 17851924 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 16670920 Uniquely mapped reads % | 93.38% Average mapped length | 281.57 Number of splices: Total | 15530098 Number of splices: Annotated (sjdb) | 15147598 Number of splices: GT/AG | 15205943 Number of splices: GC/AG | 248540 Number of splices: AT/AC | 10290 Number of splices: Non-canonical | 65325 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429235 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 65475 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751769 751769 751769 N_multimapping 429235 429235 429235 N_noFeature 747680 16432836 857899 N_ambiguous 231768 921 103365 UnstrandedReadsAssigned:15691472 PositiveStrandReadsAssigned:237163 NegativeStrandReadsAssigned:15709656 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=132 echo kmer=127 SRR12670173 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670173-trimmed-pair1.fastq SRR12670173-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,851,924 reads, 15,757,922 reads pseudoaligned [quant] estimated average fragment length: 204.71 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12670173.ke.tsv 34699 SRR12670173.se.tsv 87100 total ==> SRR12670173.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.29 643 23.5155 Potri.005G024800.1.v4.1 1035 831.29 289 23.0672 Potri.004G059700.1.v4.1 961 757.362 8 0.700868 Potri.007G009000.2.v4.1 1416 1212.29 0 0 Potri.003G141000.2.v4.1 2943 2739.29 1131.01 27.3955 Potri.016G087400.1.v4.1 270 112.196 801 473.7 Potri.015G069301.1.v4.1 564 367.832 0 0 Potri.010G195200.1.v4.1 1773 1569.29 62 2.62143 Potri.012G127500.1.v4.1 977 773.324 70 6.00601 ==> SRR12670173.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 500 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12670173 completed mapping pipeline successfully