Starting /dee2/code/volunteer_pipeline.sh SRR12670174 current disk space = 3055789948928 free memory = 1470993424 SRR12670174 SRAfilesize e1cfca8bb911066e01fb26d0682d31db SRR12670174.sra SRR12670174.sra file validated SRR12670174 is paired end SRR12670174 is conventional basespace SRR12670174 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670174_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6085 37.0 37.0 37.0 37.0 37.0 2 36.42225 37.0 37.0 37.0 37.0 37.0 3 36.6275 37.0 37.0 37.0 37.0 37.0 4 36.5865 37.0 37.0 37.0 37.0 37.0 5 36.629 37.0 37.0 37.0 37.0 37.0 6 36.6395 37.0 37.0 37.0 37.0 37.0 7 36.501 37.0 37.0 37.0 37.0 37.0 8 36.589 37.0 37.0 37.0 37.0 37.0 9 36.607 37.0 37.0 37.0 37.0 37.0 10-14 36.556400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5718 37.0 37.0 37.0 37.0 37.0 20-24 36.495099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.490700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.487700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4495 37.0 37.0 37.0 37.0 37.0 40-44 36.400999999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.373000000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3851 37.0 37.0 37.0 37.0 37.0 55-59 36.3791 37.0 37.0 37.0 37.0 37.0 60-64 36.3418 37.0 37.0 37.0 37.0 37.0 65-69 36.3096 37.0 37.0 37.0 37.0 37.0 70-74 36.27290000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.267900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.26039999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2238 37.0 37.0 37.0 37.0 37.0 90-94 36.2069 37.0 37.0 37.0 37.0 37.0 95-99 36.1036 37.0 37.0 37.0 37.0 37.0 100-104 36.1489 37.0 37.0 37.0 37.0 37.0 105-109 36.135 37.0 37.0 37.0 37.0 37.0 110-114 36.067099999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1035 37.0 37.0 37.0 37.0 37.0 120-124 36.0274 37.0 37.0 37.0 37.0 37.0 125-129 35.87570000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.8412 37.0 37.0 37.0 37.0 37.0 135-139 35.6989 37.0 37.0 37.0 37.0 37.0 140-144 35.509899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.328500000000005 37.0 37.0 37.0 37.0 37.0 150-151 34.9865 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 0.0 24 1.0 25 1.0 26 6.0 27 13.0 28 14.0 29 24.0 30 24.0 31 39.0 32 46.0 33 80.0 34 138.0 35 320.0 36 2978.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 10.674999999999999 5.2 49.625 2 17.66474567777499 13.831120020045102 39.914808318717114 28.589325983462793 3 16.875 15.45 28.349999999999998 39.324999999999996 4 23.175 23.75 23.275000000000002 29.799999999999997 5 23.95 30.8 24.525 20.724999999999998 6 20.275000000000002 32.975 26.224999999999998 20.525 7 15.875 25.174999999999997 41.375 17.575 8 18.025 26.075 32.775 23.125 9 17.349999999999998 23.075000000000003 35.975 23.599999999999998 10-14 19.400000000000002 28.96 28.125 23.515 15-19 20.685000000000002 27.805000000000003 27.98 23.53 20-24 20.09 27.72 28.249999999999996 23.94 25-29 20.549999999999997 28.720000000000002 26.875 23.855 30-34 20.76 27.925 27.355 23.96 35-39 19.96 28.405 27.67 23.965 40-44 19.88 28.4 28.015 23.705000000000002 45-49 20.715 27.915 27.605 23.765 50-54 20.235 28.655 27.634999999999998 23.474999999999998 55-59 20.29 28.144999999999996 27.685 23.880000000000003 60-64 20.095 28.189999999999998 28.000000000000004 23.715 65-69 20.32 28.02 27.72 23.94 70-74 20.165 28.065 27.775 23.995 75-79 20.380000000000003 27.67 27.41 24.54 80-84 20.335 27.765 28.28 23.62 85-89 20.995 28.970000000000002 26.39 23.645 90-94 20.695 27.560000000000002 27.805000000000003 23.94 95-99 21.11 28.07 26.979999999999997 23.84 100-104 20.8 29.01 26.955000000000002 23.235 105-109 21.11 28.83 26.419999999999998 23.64 110-114 21.805 28.360000000000003 26.369999999999997 23.465 115-119 21.105 28.294999999999998 26.46 24.14 120-124 21.555 28.235 26.57 23.64 125-129 20.985 28.17 26.255 24.59 130-134 21.185000000000002 27.905 26.125 24.785 135-139 21.790000000000003 27.715 26.235000000000003 24.26 140-144 21.759999999999998 26.765 26.56 24.915000000000003 145-149 21.759999999999998 27.125 26.32 24.795 150-151 21.25 26.900000000000002 27.1375 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 0.0 26 1.0 27 3.5 28 6.0 29 7.0 30 13.0 31 22.0 32 36.5 33 41.5 34 44.5 35 62.0 36 75.5 37 98.5 38 114.5 39 141.0 40 183.0 41 207.5 42 225.5 43 262.0 44 282.0 45 265.0 46 264.0 47 287.5 48 256.0 49 198.5 50 184.5 51 150.0 52 115.0 53 96.5 54 76.0 55 67.5 56 59.0 57 46.5 58 38.5 59 28.0 60 14.0 61 5.0 62 3.5 63 5.0 64 3.5 65 1.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.35 #Duplication Level Percentage of deduplicated Percentage of total 1 82.54456054087277 67.15 2 13.460356484326983 21.9 3 2.796558082360172 6.825 4 0.9834050399508296 3.2 5 0.18438844499078058 0.75 6 0.0 0.0 7 0.030731407498463426 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACAC 7 0.17500000000000002 No Hit TCTCACTAGATCCTCCAGTTGACTTTCCATTCAAACGATCCTTTAAAAGT 5 0.125 No Hit GTCCAGCTTTCGTTCGATGAGGTATGTTTCAATGCCTCCTTTGGCTAATG 5 0.125 No Hit GTTTTCTTGGCCGAGTCTTTCTTTATAACCTTGCTTGGGTACTTCTTGAT 5 0.125 No Hit GTGTCTGAGTACTTGTCAACCTGTATCTGCGTCGTTATTGTCTTCTTGGC 5 0.125 No Hit GTTTAACATGGAGCTTGGTTCCACTGAGGGAGCTACCACCAAGGCCTTTG 5 0.125 No Hit GGAGTCTTTGCTGGCTTTTCATCTTCACTATCTTCCTCGCTCTCTGAGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.45 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.9624999999999999 0.0 0.0 0.0 0.0 82-83 1.175 0.0 0.0 0.0 0.0 84-85 1.4625 0.0 0.0 0.0 0.0 86-87 1.8625 0.0 0.0 0.0 0.0 88-89 2.275 0.0 0.0 0.0 0.0 90-91 2.625 0.0 0.0 0.0 0.0 92-93 3.1 0.0 0.0 0.0 0.0 94-95 3.6125 0.0 0.0 0.0 0.0 96-97 4.125 0.0 0.0 0.0 0.0 98-99 4.862500000000001 0.0 0.0 0.0 0.0 100-101 5.8 0.0 0.0 0.0 0.0 102-103 6.8125 0.0 0.0 0.0 0.0 104-105 7.7250000000000005 0.0 0.0 0.0 0.0 106-107 8.850000000000001 0.0 0.0 0.0 0.0 108-109 9.8625 0.0 0.0 0.0 0.0 110-111 10.6125 0.0 0.0 0.0 0.0 112-113 11.575 0.0 0.0 0.0 0.0 114-115 12.7375 0.0 0.0 0.0 0.0 116-117 13.7 0.0 0.0 0.0 0.0 118-119 14.5375 0.0 0.0 0.0 0.0 120-121 15.4 0.0 0.0 0.0 0.0 122-123 16.2 0.0 0.0 0.0 0.0 124-125 16.975 0.0 0.0 0.0 0.0 126-127 17.8875 0.0 0.0 0.0 0.0 128-129 19.025 0.0 0.0 0.0 0.0 130-131 20.075 0.0 0.0 0.0 0.0 132-133 21.2 0.0 0.0 0.0 0.0 134-135 22.3125 0.0 0.0 0.0 0.0 136-137 23.450000000000003 0.0 0.0 0.0 0.0 138-139 24.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATAGTA 10 0.006830828 145.0 3 AGTGTCA 10 0.006830828 145.0 4 CTCATTT 10 0.006830828 145.0 1 CTATCCT 60 0.004491891 14.500001 135-139 GGGGGGG 165 5.380233E-4 8.787879 140-144 >>END_MODULE SRR12670174 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670174_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4515 37.0 37.0 37.0 37.0 37.0 2 36.3575 37.0 37.0 37.0 37.0 37.0 3 36.3665 37.0 37.0 37.0 37.0 37.0 4 36.413 37.0 37.0 37.0 37.0 37.0 5 36.3855 37.0 37.0 37.0 37.0 37.0 6 36.422 37.0 37.0 37.0 37.0 37.0 7 36.3885 37.0 37.0 37.0 37.0 37.0 8 36.398 37.0 37.0 37.0 37.0 37.0 9 36.418 37.0 37.0 37.0 37.0 37.0 10-14 36.4043 37.0 37.0 37.0 37.0 37.0 15-19 36.4188 37.0 37.0 37.0 37.0 37.0 20-24 36.326499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3515 37.0 37.0 37.0 37.0 37.0 30-34 36.247 37.0 37.0 37.0 37.0 37.0 35-39 36.260000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.229699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.2547 37.0 37.0 37.0 37.0 37.0 50-54 36.2309 37.0 37.0 37.0 37.0 37.0 55-59 36.1844 37.0 37.0 37.0 37.0 37.0 60-64 36.1626 37.0 37.0 37.0 37.0 37.0 65-69 36.1826 37.0 37.0 37.0 37.0 37.0 70-74 36.1459 37.0 37.0 37.0 37.0 37.0 75-79 36.1778 37.0 37.0 37.0 37.0 37.0 80-84 36.0809 37.0 37.0 37.0 37.0 37.0 85-89 36.052499999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0828 37.0 37.0 37.0 37.0 37.0 95-99 36.0133 37.0 37.0 37.0 37.0 37.0 100-104 35.9661 37.0 37.0 37.0 37.0 37.0 105-109 35.855799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.776700000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.8817 37.0 37.0 37.0 37.0 37.0 120-124 35.6626 37.0 37.0 37.0 37.0 37.0 125-129 35.4815 37.0 37.0 37.0 37.0 37.0 130-134 35.251099999999994 37.0 37.0 37.0 32.2 37.0 135-139 35.1091 37.0 37.0 37.0 29.8 37.0 140-144 34.8054 37.0 37.0 37.0 25.0 37.0 145-149 34.353699999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.09125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 0.0 16 2.0 17 0.0 18 1.0 19 1.0 20 1.0 21 3.0 22 4.0 23 2.0 24 6.0 25 3.0 26 7.0 27 12.0 28 11.0 29 22.0 30 36.0 31 36.0 32 62.0 33 104.0 34 221.0 35 536.0 36 2577.0 37 348.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85 19.8 9.6 33.75 2 24.349999999999998 26.924999999999997 34.150000000000006 14.575 3 20.349999999999998 27.650000000000002 31.45 20.549999999999997 4 23.474999999999998 33.725 23.825 18.975 5 24.575 36.75 22.400000000000002 16.275000000000002 6 19.8 38.375 22.0 19.825 7 20.549999999999997 20.375 38.324999999999996 20.75 8 19.900000000000002 26.875 29.275000000000002 23.95 9 21.85 24.7 30.275000000000002 23.175 10-14 23.325000000000003 29.415000000000003 26.08 21.18 15-19 23.0 28.945 27.21 20.845 20-24 22.919999999999998 28.785 27.35 20.945 25-29 22.505 28.555000000000003 28.17 20.77 30-34 22.8 28.42 28.065 20.715 35-39 23.625 27.845 27.495000000000005 21.035 40-44 22.67 27.675 28.54 21.115000000000002 45-49 22.685 28.62 28.17 20.525 50-54 22.75 28.134999999999998 27.994999999999997 21.12 55-59 23.35 27.105 27.839999999999996 21.705 60-64 22.884999999999998 28.294999999999998 27.97 20.849999999999998 65-69 23.599999999999998 28.095 27.08 21.224999999999998 70-74 23.53 28.725 27.275 20.47 75-79 23.695 27.965 27.38 20.96 80-84 23.52 27.584999999999997 27.525 21.37 85-89 23.919999999999998 27.845 27.075 21.16 90-94 23.635 28.7 27.005000000000003 20.66 95-99 24.635 28.34 26.82 20.205000000000002 100-104 24.485 28.46 26.245 20.810000000000002 105-109 25.535000000000004 27.855 26.665 19.945 110-114 25.290000000000003 28.165000000000003 26.985 19.56 115-119 26.235000000000003 27.834999999999997 26.52 19.41 120-124 26.165 28.144999999999996 26.155 19.535 125-129 27.169999999999998 27.88 26.169999999999998 18.78 130-134 27.865000000000002 27.29 26.479999999999997 18.365000000000002 135-139 28.349999999999998 27.3 25.94 18.41 140-144 29.265 26.68 25.555 18.5 145-149 30.099999999999998 25.465 26.155 18.279999999999998 150-151 31.825 25.387500000000003 25.85 16.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 1.5 26 2.5 27 7.5 28 9.0 29 14.0 30 17.5 31 19.0 32 33.5 33 40.5 34 47.0 35 58.0 36 76.5 37 99.5 38 128.5 39 161.5 40 197.0 41 219.5 42 244.5 43 263.5 44 275.5 45 302.5 46 277.0 47 249.5 48 234.0 49 200.5 50 163.0 51 131.0 52 116.5 53 100.5 54 73.5 55 58.0 56 48.0 57 29.0 58 22.0 59 19.5 60 13.5 61 11.5 62 11.0 63 5.0 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.475 #Duplication Level Percentage of deduplicated Percentage of total 1 82.75544645596808 67.425 2 13.378336913163547 21.8 3 2.700214789812826 6.6000000000000005 4 0.859159251304081 2.8000000000000003 5 0.18410555385087451 0.75 6 0.09205277692543726 0.44999999999999996 7 0.03068425897514575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit TTTGTACCTGGGAACCCTCCAGTAGATTATCAAGGGGCTAGGGATGTGAA 6 0.15 No Hit AATCCTTCCAGTGTGAACTTGTCTTTGCCAAGATGGGAATTAACCCAATC 5 0.125 No Hit GGGAAACCAGTTAGTCGGGAACCAAAATCAAGGCTATGGCATCACTAGCA 5 0.125 No Hit CGAATCACAGCCAGCAAGTCTAGTCCGAAGCTCCAAAACCGCAACCTCCG 5 0.125 No Hit GCCACAGAGAGCAAAGAGAGGGGAGGAGAAACCCTAAGCCGCAGCGACAA 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.037500000000000006 0.0 0.025 0.0 0.0 56-57 0.05 0.0 0.025 0.0 0.0 58-59 0.05 0.0 0.025 0.0 0.0 60-61 0.07500000000000001 0.0 0.025 0.0 0.0 62-63 0.1125 0.0 0.025 0.0 0.0 64-65 0.15 0.0 0.025 0.0 0.0 66-67 0.16249999999999998 0.0 0.025 0.0 0.0 68-69 0.275 0.0 0.025 0.0 0.0 70-71 0.3375 0.0 0.025 0.0 0.0 72-73 0.45 0.0 0.025 0.0 0.0 74-75 0.5125 0.0 0.025 0.0 0.0 76-77 0.6375 0.0 0.025 0.0 0.0 78-79 0.7375 0.0 0.025 0.0 0.0 80-81 0.9624999999999999 0.0 0.025 0.0 0.0 82-83 1.175 0.0 0.025 0.0 0.0 84-85 1.4625 0.0 0.025 0.0 0.0 86-87 1.8625 0.0 0.025 0.0 0.0 88-89 2.275 0.0 0.025 0.0 0.0 90-91 2.625 0.0 0.025 0.0 0.0 92-93 3.1 0.0 0.025 0.0 0.0 94-95 3.6125 0.0 0.025 0.0 0.0 96-97 4.15 0.0 0.025 0.0 0.0 98-99 4.887499999999999 0.0 0.025 0.0 0.0 100-101 5.825 0.0 0.025 0.0 0.0 102-103 6.8625 0.0 0.025 0.0 0.0 104-105 7.762499999999999 0.0 0.025 0.0 0.0 106-107 8.875 0.0 0.025 0.0 0.0 108-109 9.9 0.0 0.025 0.0 0.0 110-111 10.65 0.0 0.025 0.0 0.0 112-113 11.6 0.0 0.025 0.0 0.0 114-115 12.775 0.0 0.025 0.0 0.0 116-117 13.7625 0.0 0.025 0.0 0.0 118-119 14.6625 0.0 0.025 0.0 0.0 120-121 15.525 0.0 0.025 0.0 0.0 122-123 16.3375 0.0 0.025 0.0 0.0 124-125 17.125 0.0 0.025 0.0 0.0 126-127 18.0375 0.0 0.025 0.0 0.0 128-129 19.25 0.0 0.025 0.0 0.0 130-131 20.3125 0.0 0.025 0.0 0.0 132-133 21.45 0.0 0.025 0.0 0.0 134-135 22.575 0.0 0.025 0.0 0.0 136-137 23.725 0.0 0.025 0.0 0.0 138-139 25.137500000000003 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACAC 10 0.006830828 145.0 1 GGGGGGG 90 0.0048656333 16.11111 145 >>END_MODULE Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609178 spots for SRR12670174.sra Written 609178 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra Read 609171 spots for SRR12670174.sra Written 609171 spots for SRR12670174.sra SRR ids: ['SRR12670174.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytmt8dki SRR12670174.sra spots: 12183427 blocks: [[1, 609171], [609172, 1218342], [1218343, 1827513], [1827514, 2436684], [2436685, 3045855], [3045856, 3655026], [3655027, 4264197], [4264198, 4873368], [4873369, 5482539], [5482540, 6091710], [6091711, 6700881], [6700882, 7310052], [7310053, 7919223], [7919224, 8528394], [8528395, 9137565], [9137566, 9746736], [9746737, 10355907], [10355908, 10965078], [10965079, 11574249], [11574250, 12183427]] SRR12670174 file size 4118761 SRR12670174 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670174 SRR12670174_1.fastq SRR12670174_2.fastq Input file: SRR12670174_1.fastq Paired file: SRR12670174_2.fastq trimmed: SRR12670174-trimmed-pair1.fastq, SRR12670174-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:45:12 2025 >> started Tue Feb 11 08:45:27 2025 >> done (15.062s) 12183427 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 2606 ( 0.02%) empty read pairs filtered out after trimming by size control 12180748 (99.98%) read pairs available; of these: 3715332 (30.50%) trimmed read pairs available after processing 8465416 (69.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 14 0.00% 21 13 0.00% 22 6 0.00% 23 17 0.00% 24 21 0.00% 25 13 0.00% 26 19 0.00% 27 33 0.00% 28 49 0.00% 29 36 0.00% 30 37 0.00% 31 37 0.00% 32 41 0.00% 33 60 0.00% 34 66 0.00% 35 80 0.00% 36 97 0.00% 37 92 0.00% 38 121 0.00% 39 123 0.00% 40 112 0.00% 41 170 0.00% 42 171 0.00% 43 177 0.00% 44 179 0.00% 45 204 0.00% 46 208 0.00% 47 261 0.00% 48 300 0.00% 49 404 0.00% 50 447 0.00% 51 541 0.00% 52 600 0.00% 53 626 0.01% 54 709 0.01% 55 819 0.01% 56 791 0.01% 57 925 0.01% 58 1046 0.01% 59 1269 0.01% 60 1490 0.01% 61 1760 0.01% 62 1923 0.02% 63 2150 0.02% 64 2419 0.02% 65 2731 0.02% 66 2882 0.02% 67 3203 0.03% 68 3720 0.03% 69 4197 0.03% 70 4868 0.04% 71 5613 0.05% 72 6411 0.05% 73 7126 0.06% 74 7806 0.06% 75 8635 0.07% 76 9348 0.08% 77 10008 0.08% 78 11154 0.09% 79 12334 0.10% 80 13159 0.11% 81 15117 0.12% 82 16561 0.14% 83 18211 0.15% 84 19955 0.16% 85 21942 0.18% 86 23110 0.19% 87 24105 0.20% 88 26071 0.21% 89 26471 0.22% 90 28691 0.24% 91 30783 0.25% 92 32075 0.26% 93 34470 0.28% 94 36551 0.30% 95 39043 0.32% 96 40269 0.33% 97 41550 0.34% 98 42350 0.35% 99 42968 0.35% 100 45429 0.37% 101 46073 0.38% 102 47697 0.39% 103 49277 0.40% 104 50918 0.42% 105 51925 0.43% 106 53493 0.44% 107 53583 0.44% 108 54079 0.44% 109 55072 0.45% 110 54868 0.45% 111 55434 0.46% 112 56976 0.47% 113 56987 0.47% 114 58385 0.48% 115 59910 0.49% 116 60475 0.50% 117 61162 0.50% 118 61138 0.50% 119 61272 0.50% 120 61479 0.50% 121 62120 0.51% 122 62784 0.52% 123 61979 0.51% 124 62575 0.51% 125 62261 0.51% 126 63918 0.52% 127 62857 0.52% 128 63025 0.52% 129 62353 0.51% 130 62655 0.51% 131 62109 0.51% 132 61399 0.50% 133 62371 0.51% 134 61856 0.51% 135 62287 0.51% 136 62465 0.51% 137 62289 0.51% 138 62682 0.51% 139 63415 0.52% 140 61743 0.51% 141 62270 0.51% 142 61937 0.51% 143 61368 0.50% 144 62067 0.51% 145 60713 0.50% 146 61726 0.51% 147 61472 0.50% 148 62167 0.51% 149 61016 0.50% 150 61644 0.51% 151 8465416 69.50% 12180748 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=18.09 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.3 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTAG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=42.16 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12670174 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:46:13 Started mapping on | Feb 11 08:46:14 Finished on | Feb 11 08:47:36 Mapping speed, Million of reads per hour | 534.76 Number of input reads | 12180748 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 11602808 Uniquely mapped reads % | 95.26% Average mapped length | 281.09 Number of splices: Total | 10975658 Number of splices: Annotated (sjdb) | 10718954 Number of splices: GT/AG | 10754720 Number of splices: GC/AG | 168601 Number of splices: AT/AC | 7402 Number of splices: Non-canonical | 44935 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271352 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 29531 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306588 306588 306588 N_multimapping 271352 271352 271352 N_noFeature 474621 11405603 563636 N_ambiguous 168770 624 60212 UnstrandedReadsAssigned:10959417 PositiveStrandReadsAssigned:196581 NegativeStrandReadsAssigned:10978960 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=130 echo kmer=125 SRR12670174 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670174-trimmed-pair1.fastq SRR12670174-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,180,748 reads, 10,947,064 reads pseudoaligned [quant] estimated average fragment length: 198.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12670174.ke.tsv 34699 SRR12670174.se.tsv 87100 total ==> SRR12670174.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.6 526 24.6124 Potri.005G024800.1.v4.1 1035 837.6 145 14.7474 Potri.004G059700.1.v4.1 961 763.65 0 0 Potri.007G009000.2.v4.1 1416 1218.6 0 0 Potri.003G141000.2.v4.1 2943 2745.6 664.453 20.6163 Potri.016G087400.1.v4.1 270 111.555 786 600.229 Potri.015G069301.1.v4.1 564 372.856 0 0 Potri.010G195200.1.v4.1 1773 1575.6 144 7.78574 Potri.012G127500.1.v4.1 977 779.635 197 21.5257 ==> SRR12670174.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 139 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12670174 completed mapping pipeline successfully