Starting /dee2/code/volunteer_pipeline.sh SRR12670175 current disk space = 3055771525120 free memory = 1477660672 SRR12670175 SRAfilesize 8783e3c9c0d12f45355570303d10f1d7 SRR12670175.sra SRR12670175.sra file validated SRR12670175 is paired end SRR12670175 is conventional basespace SRR12670175 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670175_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.559 37.0 37.0 37.0 37.0 37.0 2 36.413 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.5865 37.0 37.0 37.0 37.0 37.0 5 36.5955 37.0 37.0 37.0 37.0 37.0 6 36.5645 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.556 37.0 37.0 37.0 37.0 37.0 9 36.5925 37.0 37.0 37.0 37.0 37.0 10-14 36.61450000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.576 37.0 37.0 37.0 37.0 37.0 20-24 36.5348 37.0 37.0 37.0 37.0 37.0 25-29 36.493500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.437 37.0 37.0 37.0 37.0 37.0 35-39 36.434 37.0 37.0 37.0 37.0 37.0 40-44 36.442899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3951 37.0 37.0 37.0 37.0 37.0 50-54 36.3995 37.0 37.0 37.0 37.0 37.0 55-59 36.3478 37.0 37.0 37.0 37.0 37.0 60-64 36.3128 37.0 37.0 37.0 37.0 37.0 65-69 36.3106 37.0 37.0 37.0 37.0 37.0 70-74 36.29939999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.25 37.0 37.0 37.0 37.0 37.0 80-84 36.2779 37.0 37.0 37.0 37.0 37.0 85-89 36.227500000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2497 37.0 37.0 37.0 37.0 37.0 95-99 36.1956 37.0 37.0 37.0 37.0 37.0 100-104 36.2535 37.0 37.0 37.0 37.0 37.0 105-109 36.191199999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1246 37.0 37.0 37.0 37.0 37.0 115-119 36.113800000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.967 37.0 37.0 37.0 37.0 37.0 125-129 35.885400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.7515 37.0 37.0 37.0 37.0 37.0 135-139 35.64050000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3549 37.0 37.0 37.0 37.0 37.0 145-149 35.159000000000006 37.0 37.0 37.0 32.2 37.0 150-151 35.246 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 0.0 24 2.0 25 4.0 26 5.0 27 8.0 28 11.0 29 25.0 30 17.0 31 42.0 32 53.0 33 77.0 34 168.0 35 358.0 36 2824.0 37 404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.55 12.049999999999999 6.825 38.574999999999996 2 19.934804413239718 11.835506519558676 36.233701103309926 31.995987963891675 3 17.375 16.675 28.425 37.525 4 21.5 26.950000000000003 22.85 28.7 5 23.25 31.175000000000004 25.474999999999998 20.1 6 21.025 33.7 23.575 21.7 7 15.45 26.150000000000002 41.375 17.025000000000002 8 18.425 25.4 33.35 22.825 9 18.224999999999998 22.35 35.725 23.7 10-14 19.735 30.385 27.08 22.8 15-19 20.695 28.285 27.275 23.745 20-24 20.84 27.155 28.54 23.465 25-29 20.54 28.23 27.6 23.630000000000003 30-34 20.655 28.33 27.71 23.305 35-39 20.465 27.834999999999997 27.284999999999997 24.415 40-44 20.995 28.055000000000003 27.450000000000003 23.5 45-49 21.05 27.905 27.305 23.74 50-54 20.695 27.900000000000002 27.76 23.645 55-59 20.895 27.6 27.685 23.82 60-64 20.695 27.66 28.294999999999998 23.35 65-69 20.49 27.845 27.58 24.085 70-74 20.82 28.175 27.215 23.79 75-79 20.990000000000002 27.900000000000002 26.96 24.15 80-84 21.19 28.16 27.685 22.965 85-89 21.475 28.055000000000003 27.315 23.155 90-94 21.475 27.975 26.97 23.580000000000002 95-99 21.385 28.07 26.495 24.05 100-104 21.4 28.59 26.56 23.45 105-109 21.905 28.860000000000003 25.66 23.575 110-114 21.845 28.38 25.96 23.815 115-119 21.165 28.754999999999995 25.805 24.275 120-124 21.665 28.985 25.655 23.695 125-129 21.525 28.075 26.0 24.4 130-134 21.490000000000002 27.43 26.14 24.94 135-139 22.025 27.38 25.665 24.93 140-144 21.5 27.58 26.115 24.805 145-149 22.564999999999998 26.435 26.555 24.445 150-151 22.825 26.275 25.924999999999997 24.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 2.0 23 2.0 24 2.0 25 0.5 26 3.5 27 6.5 28 8.5 29 12.5 30 15.0 31 18.0 32 23.0 33 27.0 34 35.0 35 53.0 36 70.5 37 94.0 38 113.0 39 136.0 40 174.5 41 207.5 42 237.5 43 251.0 44 279.5 45 270.0 46 257.5 47 267.5 48 245.0 49 242.0 50 216.0 51 151.0 52 102.5 53 90.0 54 87.0 55 76.0 56 59.5 57 41.5 58 30.0 59 26.5 60 19.5 61 10.5 62 5.5 63 4.0 64 4.0 65 4.0 66 4.5 67 2.0 68 2.5 69 2.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 81.59034653465346 65.925 2 14.201732673267326 22.95 3 3.217821782178218 7.8 4 0.8663366336633664 2.8000000000000003 5 0.09282178217821782 0.375 6 0.03094059405940594 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCATGTTATCGCTTGTGTTGGCCGAAACCCAGCTGAAGTCTAGCCCTT 6 0.15 No Hit CACTGTTGACATGCTCTAATGGCAAATTCTCATGTTGACTCGGTGGAAAC 5 0.125 No Hit TTCTATGGTGTGACAGTGCTAGGAGGCGTCCTGGACTCTGGTGGAGGAGT 5 0.125 No Hit GTCCAAACATGTAACAAATTAAGTCGTGCATCATCAACAACAGCAGCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.23750000000000002 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.5125 0.0 0.0 0.0 0.0 72-73 0.6375 0.0 0.0 0.0 0.0 74-75 1.025 0.0 0.0 0.0 0.0 76-77 1.2875 0.0 0.0 0.0 0.0 78-79 1.5875 0.0 0.0 0.0 0.0 80-81 1.7375 0.0 0.0 0.0 0.0 82-83 2.0625 0.0 0.0 0.0 0.0 84-85 2.4124999999999996 0.0 0.0 0.0 0.0 86-87 2.9 0.0 0.0 0.0 0.0 88-89 3.4124999999999996 0.0 0.0 0.0 0.0 90-91 3.95 0.0 0.0 0.0 0.0 92-93 4.5875 0.0 0.0 0.0 0.0 94-95 5.4375 0.0 0.0 0.0 0.0 96-97 6.2625 0.0 0.0 0.0 0.0 98-99 7.4 0.0 0.0 0.0 0.0 100-101 8.45 0.0 0.0 0.0 0.0 102-103 9.225 0.0 0.0 0.0 0.0 104-105 10.275 0.0 0.0 0.0 0.0 106-107 11.175 0.0 0.0 0.0 0.0 108-109 12.2875 0.0 0.0 0.0 0.0 110-111 13.575 0.0 0.0 0.0 0.0 112-113 14.475 0.0 0.0 0.0 0.0 114-115 15.3375 0.0 0.0 0.0 0.0 116-117 16.275 0.0 0.0 0.0 0.0 118-119 17.7875 0.0 0.0 0.0 0.0 120-121 18.700000000000003 0.0 0.0 0.0 0.0 122-123 19.625 0.0 0.0 0.0 0.0 124-125 20.6125 0.0 0.0 0.0 0.0 126-127 21.575000000000003 0.0 0.0 0.0 0.0 128-129 22.4375 0.0 0.0 0.0 0.0 130-131 23.225 0.0 0.0 0.0 0.0 132-133 24.05 0.0 0.0 0.0 0.0 134-135 24.9 0.0 0.0 0.0 0.0 136-137 25.9125 0.0 0.0 0.0 0.0 138-139 26.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAG 10 0.006830828 145.0 8 >>END_MODULE SRR12670175 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670175_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.259 37.0 37.0 37.0 37.0 37.0 2 35.9855 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.1225 37.0 37.0 37.0 37.0 37.0 5 36.257 37.0 37.0 37.0 37.0 37.0 6 36.2365 37.0 37.0 37.0 37.0 37.0 7 36.156 37.0 37.0 37.0 37.0 37.0 8 36.248 37.0 37.0 37.0 37.0 37.0 9 36.233 37.0 37.0 37.0 37.0 37.0 10-14 36.254900000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.2601 37.0 37.0 37.0 37.0 37.0 20-24 36.203700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.172900000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.1667 37.0 37.0 37.0 37.0 37.0 35-39 36.095800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1377 37.0 37.0 37.0 37.0 37.0 45-49 36.052499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0505 37.0 37.0 37.0 37.0 37.0 55-59 36.007400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9474 37.0 37.0 37.0 37.0 37.0 65-69 35.9409 37.0 37.0 37.0 37.0 37.0 70-74 35.9396 37.0 37.0 37.0 37.0 37.0 75-79 35.9303 37.0 37.0 37.0 37.0 37.0 80-84 35.8443 37.0 37.0 37.0 37.0 37.0 85-89 35.84589999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.7727 37.0 37.0 37.0 37.0 37.0 95-99 35.8086 37.0 37.0 37.0 37.0 37.0 100-104 35.7223 37.0 37.0 37.0 37.0 37.0 105-109 35.631800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.485200000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.414 37.0 37.0 37.0 37.0 37.0 120-124 35.203199999999995 37.0 37.0 37.0 29.8 37.0 125-129 34.882999999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.5854 37.0 37.0 37.0 25.0 37.0 135-139 34.1289 37.0 37.0 37.0 25.0 37.0 140-144 33.8358 37.0 37.0 37.0 25.0 37.0 145-149 33.3702 37.0 37.0 37.0 13.8 37.0 150-151 33.134 37.0 37.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 4.0 15 3.0 16 3.0 17 3.0 18 2.0 19 1.0 20 1.0 21 2.0 22 5.0 23 3.0 24 5.0 25 7.0 26 8.0 27 11.0 28 23.0 29 25.0 30 36.0 31 59.0 32 85.0 33 217.0 34 293.0 35 637.0 36 2330.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.525 23.925 9.15 25.4 2 26.900000000000002 25.35 30.675 17.075000000000003 3 20.549999999999997 27.575 32.725 19.15 4 22.325 35.525 23.325000000000003 18.825 5 24.2 36.4 20.849999999999998 18.55 6 20.9 40.45 21.425 17.224999999999998 7 20.724999999999998 22.35 37.3 19.625 8 21.65 25.624999999999996 28.525 24.2 9 23.075000000000003 24.05 29.299999999999997 23.575 10-14 23.1 28.794999999999998 26.640000000000004 21.465 15-19 23.56 28.675 27.1 20.665 20-24 23.3 28.349999999999998 27.77 20.580000000000002 25-29 22.365 28.794999999999998 27.555000000000003 21.285 30-34 23.06 28.025 27.215 21.7 35-39 22.955000000000002 28.28 27.42 21.345 40-44 22.93 27.560000000000002 28.375 21.135 45-49 22.89 28.615000000000002 27.715 20.78 50-54 23.29 27.91 27.584999999999997 21.215 55-59 23.119999999999997 27.16 28.285 21.435000000000002 60-64 23.265 28.645 27.27 20.82 65-69 24.175 27.575 27.29 20.96 70-74 23.415 28.43 27.205000000000002 20.95 75-79 23.66 27.67 27.33 21.34 80-84 23.125 27.944999999999997 27.415 21.515 85-89 24.285 27.544999999999998 27.339999999999996 20.830000000000002 90-94 24.3 28.67 26.674999999999997 20.355 95-99 25.230000000000004 28.525 25.6 20.645 100-104 25.46 28.27 26.045 20.225 105-109 26.31 28.32 25.319999999999997 20.05 110-114 26.424999999999997 28.025 26.5 19.05 115-119 27.29 28.255000000000003 25.005 19.45 120-124 27.87 27.74 25.490000000000002 18.9 125-129 28.42 27.029999999999998 25.929999999999996 18.62 130-134 29.755 25.77 25.605 18.87 135-139 29.585 26.88 26.055 17.48 140-144 31.005 25.905 25.215 17.875 145-149 32.72 25.185000000000002 24.68 17.415 150-151 33.6125 24.275 24.9 17.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 2.5 22 1.5 23 2.0 24 1.0 25 0.5 26 1.0 27 4.5 28 5.5 29 3.5 30 13.5 31 23.5 32 31.5 33 34.5 34 35.5 35 53.0 36 88.0 37 108.5 38 134.5 39 176.0 40 193.0 41 223.0 42 240.0 43 246.5 44 261.5 45 259.0 46 280.0 47 282.0 48 246.5 49 205.5 50 154.5 51 124.0 52 108.5 53 96.0 54 91.5 55 68.5 56 39.0 57 42.0 58 34.5 59 18.5 60 14.5 61 7.0 62 7.0 63 5.0 64 2.0 65 1.0 66 0.0 67 1.5 68 1.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.0 86 1.0 87 1.5 88 1.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.95 #Duplication Level Percentage of deduplicated Percentage of total 1 81.90240889437923 66.3 2 13.897467572575664 22.5 3 3.3353922174181596 8.1 4 0.6794317479925881 2.1999999999999997 5 0.0926497838171711 0.375 6 0.030883261272390366 0.15 7 0.030883261272390366 0.17500000000000002 8 0.030883261272390366 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGCAATTCTACTTACAGGAAGTCTTTCATAGATGACTCAATAAAAATAGC 6 0.15 No Hit ATCAAGCAAAGCTTAAACACTAATTAATCATGGCAACCAGCTCAGTTATG 5 0.125 No Hit GTCTCCACTGTACCTGATCAAAGACCAGCAATGCAAGAGGTTGTAAGGAT 5 0.125 No Hit ATTCAAATCCAGTGGTCATGATGGGCCTTAGTATTGTTGTTGTGTTTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.2125 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.4875 0.0 0.0 0.0 0.0 72-73 0.6125 0.0 0.0 0.0 0.0 74-75 1.0125 0.0 0.0 0.0 0.0 76-77 1.2875 0.0 0.0 0.0 0.0 78-79 1.5875 0.0 0.0 0.0 0.0 80-81 1.7375 0.0 0.0 0.0 0.0 82-83 2.075 0.0 0.0 0.0 0.0 84-85 2.4375 0.0 0.0 0.0 0.0 86-87 2.925 0.0 0.0 0.0 0.0 88-89 3.45 0.0 0.0 0.0 0.0 90-91 4.025 0.0 0.0 0.0 0.0 92-93 4.6625 0.0 0.0 0.0 0.0 94-95 5.512499999999999 0.0 0.0 0.0 0.0 96-97 6.325 0.0 0.0 0.0 0.0 98-99 7.475 0.0 0.0 0.0 0.0 100-101 8.5125 0.0 0.0 0.0 0.0 102-103 9.3875 0.0 0.0 0.0 0.0 104-105 10.475 0.0 0.0 0.0 0.0 106-107 11.375 0.0 0.0 0.0 0.0 108-109 12.4875 0.0 0.0 0.0 0.0 110-111 13.775 0.0 0.0 0.0 0.0 112-113 14.675 0.0 0.0 0.0 0.0 114-115 15.5375 0.0 0.0 0.0 0.0 116-117 16.525 0.0 0.0 0.0 0.0 118-119 18.1375 0.0 0.0 0.0 0.0 120-121 19.025 0.0 0.0 0.0 0.0 122-123 19.9875 0.0 0.0 0.0 0.0 124-125 20.9875 0.0 0.0 0.0 0.0 126-127 21.950000000000003 0.0 0.0 0.0 0.0 128-129 22.8625 0.0 0.0 0.0 0.0 130-131 23.675 0.0 0.0 0.0 0.0 132-133 24.5625 0.0 0.0 0.0 0.0 134-135 25.4375 0.0 0.0 0.0 0.0 136-137 26.487499999999997 0.0 0.0 0.0 0.0 138-139 27.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTGA 10 0.006830828 145.0 6 >>END_MODULE Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632342 spots for SRR12670175.sra Written 632342 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra Read 632326 spots for SRR12670175.sra Written 632326 spots for SRR12670175.sra SRR ids: ['SRR12670175.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__sha6c64 SRR12670175.sra spots: 12646536 blocks: [[1, 632326], [632327, 1264652], [1264653, 1896978], [1896979, 2529304], [2529305, 3161630], [3161631, 3793956], [3793957, 4426282], [4426283, 5058608], [5058609, 5690934], [5690935, 6323260], [6323261, 6955586], [6955587, 7587912], [7587913, 8220238], [8220239, 8852564], [8852565, 9484890], [9484891, 10117216], [10117217, 10749542], [10749543, 11381868], [11381869, 12014194], [12014195, 12646536]] SRR12670175 file size 4276145 SRR12670175 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670175 SRR12670175_1.fastq SRR12670175_2.fastq Input file: SRR12670175_1.fastq Paired file: SRR12670175_2.fastq trimmed: SRR12670175-trimmed-pair1.fastq, SRR12670175-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:44:15 2025 >> started Tue Feb 11 08:44:30 2025 >> done (14.488s) 12646536 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 17001 ( 0.13%) empty read pairs filtered out after trimming by size control 12629443 (99.86%) read pairs available; of these: 3929497 (31.11%) trimmed read pairs available after processing 8699946 (68.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 14 0.00% 21 17 0.00% 22 26 0.00% 23 40 0.00% 24 40 0.00% 25 54 0.00% 26 42 0.00% 27 54 0.00% 28 79 0.00% 29 95 0.00% 30 73 0.00% 31 118 0.00% 32 108 0.00% 33 114 0.00% 34 128 0.00% 35 149 0.00% 36 134 0.00% 37 155 0.00% 38 215 0.00% 39 245 0.00% 40 247 0.00% 41 273 0.00% 42 314 0.00% 43 274 0.00% 44 341 0.00% 45 368 0.00% 46 405 0.00% 47 487 0.00% 48 595 0.00% 49 713 0.01% 50 845 0.01% 51 974 0.01% 52 1021 0.01% 53 1063 0.01% 54 1164 0.01% 55 1163 0.01% 56 1430 0.01% 57 1550 0.01% 58 1810 0.01% 59 2137 0.02% 60 2681 0.02% 61 2974 0.02% 62 3301 0.03% 63 3491 0.03% 64 3678 0.03% 65 4174 0.03% 66 4543 0.04% 67 5160 0.04% 68 5600 0.04% 69 6230 0.05% 70 7343 0.06% 71 8358 0.07% 72 9638 0.08% 73 10260 0.08% 74 11613 0.09% 75 12137 0.10% 76 12980 0.10% 77 14067 0.11% 78 14844 0.12% 79 16764 0.13% 80 18331 0.15% 81 20656 0.16% 82 23006 0.18% 83 24858 0.20% 84 26472 0.21% 85 28045 0.22% 86 29272 0.23% 87 30305 0.24% 88 31849 0.25% 89 32694 0.26% 90 35373 0.28% 91 38049 0.30% 92 40132 0.32% 93 42272 0.33% 94 44638 0.35% 95 46806 0.37% 96 47770 0.38% 97 48337 0.38% 98 48207 0.38% 99 49204 0.39% 100 50773 0.40% 101 52118 0.41% 102 54291 0.43% 103 55291 0.44% 104 57856 0.46% 105 58205 0.46% 106 58134 0.46% 107 58152 0.46% 108 57186 0.45% 109 58339 0.46% 110 57690 0.46% 111 58390 0.46% 112 60823 0.48% 113 60769 0.48% 114 62280 0.49% 115 62380 0.49% 116 63093 0.50% 117 62689 0.50% 118 62462 0.49% 119 61367 0.49% 120 61377 0.49% 121 61533 0.49% 122 62735 0.50% 123 62136 0.49% 124 63496 0.50% 125 63291 0.50% 126 63480 0.50% 127 62173 0.49% 128 61966 0.49% 129 60528 0.48% 130 60599 0.48% 131 59685 0.47% 132 59824 0.47% 133 60531 0.48% 134 60837 0.48% 135 60968 0.48% 136 61724 0.49% 137 60805 0.48% 138 60058 0.48% 139 60371 0.48% 140 59254 0.47% 141 58310 0.46% 142 58278 0.46% 143 58519 0.46% 144 58939 0.47% 145 59336 0.47% 146 58927 0.47% 147 58086 0.46% 148 59178 0.47% 149 57963 0.46% 150 57102 0.45% 151 8699946 68.89% 12629443 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.71 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTGTAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=31.79 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.4 sequence=ACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=29 prefix-density=1.26 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=33.62 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.3 sequence=AAAGAAAAGAAAA SRR12670175 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:45:12 Started mapping on | Feb 11 08:45:13 Finished on | Feb 11 08:46:49 Mapping speed, Million of reads per hour | 473.60 Number of input reads | 12629443 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 11739981 Uniquely mapped reads % | 92.96% Average mapped length | 278.87 Number of splices: Total | 10966347 Number of splices: Annotated (sjdb) | 10701434 Number of splices: GT/AG | 10740529 Number of splices: GC/AG | 172929 Number of splices: AT/AC | 7222 Number of splices: Non-canonical | 45667 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297175 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 53814 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 592287 592287 592287 N_multimapping 297175 297175 297175 N_noFeature 442393 11543981 527538 N_ambiguous 189543 660 78272 UnstrandedReadsAssigned:11108045 PositiveStrandReadsAssigned:195340 NegativeStrandReadsAssigned:11134171 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=127 echo kmer=123 SRR12670175 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670175-trimmed-pair1.fastq SRR12670175-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,629,443 reads, 11,157,815 reads pseudoaligned [quant] estimated average fragment length: 198.036 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR12670175.ke.tsv 34699 SRR12670175.se.tsv 87100 total ==> SRR12670175.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.96 622 28.6437 Potri.005G024800.1.v4.1 1035 837.964 147 14.7107 Potri.004G059700.1.v4.1 961 764.021 6 0.658546 Potri.007G009000.2.v4.1 1416 1218.96 0 0 Potri.003G141000.2.v4.1 2943 2745.96 659.408 20.1372 Potri.016G087400.1.v4.1 270 114.69 414 302.703 Potri.015G069301.1.v4.1 564 373.807 0 0 Potri.010G195200.1.v4.1 1773 1575.96 22 1.17062 Potri.012G127500.1.v4.1 977 779.987 88 9.46096 ==> SRR12670175.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 219 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670175 completed mapping pipeline successfully