Starting /dee2/code/volunteer_pipeline.sh SRR12670181 current disk space = 3055179968512 free memory = 1487576592 SRR12670181 SRAfilesize d2180339ee2718169e757a2ef19a8040 SRR12670181.sra SRR12670181.sra file validated SRR12670181 is paired end SRR12670181 is conventional basespace SRR12670181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6285 37.0 37.0 37.0 37.0 37.0 2 36.51125 37.0 37.0 37.0 37.0 37.0 3 36.6925 37.0 37.0 37.0 37.0 37.0 4 36.635 37.0 37.0 37.0 37.0 37.0 5 36.648 37.0 37.0 37.0 37.0 37.0 6 36.6815 37.0 37.0 37.0 37.0 37.0 7 36.577 37.0 37.0 37.0 37.0 37.0 8 36.664 37.0 37.0 37.0 37.0 37.0 9 36.6225 37.0 37.0 37.0 37.0 37.0 10-14 36.62570000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5951 37.0 37.0 37.0 37.0 37.0 20-24 36.5514 37.0 37.0 37.0 37.0 37.0 25-29 36.5401 37.0 37.0 37.0 37.0 37.0 30-34 36.5153 37.0 37.0 37.0 37.0 37.0 35-39 36.4864 37.0 37.0 37.0 37.0 37.0 40-44 36.4833 37.0 37.0 37.0 37.0 37.0 45-49 36.439099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4021 37.0 37.0 37.0 37.0 37.0 55-59 36.4104 37.0 37.0 37.0 37.0 37.0 60-64 36.3788 37.0 37.0 37.0 37.0 37.0 65-69 36.34499999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.333299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3043 37.0 37.0 37.0 37.0 37.0 80-84 36.2766 37.0 37.0 37.0 37.0 37.0 85-89 36.2361 37.0 37.0 37.0 37.0 37.0 90-94 36.2821 37.0 37.0 37.0 37.0 37.0 95-99 36.2417 37.0 37.0 37.0 37.0 37.0 100-104 36.233599999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.2391 37.0 37.0 37.0 37.0 37.0 110-114 36.1217 37.0 37.0 37.0 37.0 37.0 115-119 36.153999999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0277 37.0 37.0 37.0 37.0 37.0 125-129 35.918099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.770199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5803 37.0 37.0 37.0 37.0 37.0 140-144 35.308299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.092 37.0 37.0 37.0 29.8 37.0 150-151 34.809 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 1.0 24 0.0 25 5.0 26 6.0 27 2.0 28 8.0 29 16.0 30 29.0 31 33.0 32 45.0 33 102.0 34 162.0 35 340.0 36 2876.0 37 373.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.725 11.5 5.825 40.949999999999996 2 18.682694715752568 13.298271975957926 37.039819684447785 30.979213623841723 3 17.775 15.825 29.325000000000003 37.075 4 22.275 27.0 22.925 27.800000000000004 5 23.3 30.65 23.5 22.55 6 21.375 33.525 24.925 20.175 7 14.325 27.775 41.349999999999994 16.55 8 18.75 22.900000000000002 33.650000000000006 24.7 9 18.525 23.075000000000003 35.525 22.875 10-14 20.03 29.935000000000002 26.93 23.105 15-19 20.325 27.855 28.09 23.73 20-24 20.685000000000002 28.134999999999998 27.925 23.255 25-29 20.474999999999998 28.34 27.725 23.46 30-34 20.44 28.43 27.825 23.305 35-39 20.82 27.644999999999996 27.455000000000002 24.08 40-44 20.845 29.235 26.935 22.985 45-49 20.495 28.38 27.845 23.28 50-54 20.01 28.910000000000004 27.325 23.755000000000003 55-59 20.585 27.865000000000002 28.015 23.535 60-64 20.435 27.955000000000002 28.144999999999996 23.465 65-69 21.310000000000002 28.005000000000003 27.284999999999997 23.400000000000002 70-74 20.75 28.925 27.005000000000003 23.32 75-79 21.005 28.7 27.1 23.195 80-84 20.635 28.144999999999996 27.815 23.405 85-89 21.29 28.050000000000004 27.365000000000002 23.294999999999998 90-94 20.535 28.860000000000003 27.235 23.369999999999997 95-99 21.12 28.51 27.055 23.315 100-104 21.52 28.715000000000003 26.314999999999998 23.45 105-109 21.634999999999998 28.29 26.645000000000003 23.43 110-114 21.575 28.634999999999998 26.950000000000003 22.84 115-119 21.01 29.095 25.645 24.25 120-124 21.665 28.255000000000003 25.885 24.195 125-129 22.02 28.33 25.869999999999997 23.78 130-134 21.59 27.99 26.125 24.295 135-139 21.85 28.084999999999997 26.27 23.794999999999998 140-144 22.2 27.765 25.874999999999996 24.16 145-149 22.18 28.155 25.095 24.57 150-151 21.825 27.1 26.174999999999997 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 1.0 24 1.0 25 1.5 26 3.5 27 4.0 28 3.5 29 10.0 30 19.0 31 20.5 32 26.0 33 35.5 34 40.0 35 58.0 36 79.5 37 102.5 38 136.5 39 156.5 40 187.0 41 233.0 42 251.0 43 243.0 44 239.5 45 272.0 46 286.0 47 253.0 48 241.0 49 220.0 50 175.0 51 145.0 52 129.0 53 106.0 54 73.5 55 57.5 56 51.5 57 36.5 58 27.5 59 26.5 60 20.5 61 10.0 62 1.5 63 1.5 64 1.5 65 3.0 66 3.0 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.45 #Duplication Level Percentage of deduplicated Percentage of total 1 82.19766728054022 66.95 2 13.720073664825048 22.35 3 3.3456108041743398 8.175 4 0.5831798649478207 1.9 5 0.1534683855125844 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGAATTTTGGTAGATCTTAAAAGAGAGAGAAAGGCTTGGAAGCGAAAGA 5 0.125 No Hit CTACAGTTCAAACAATTAGCAAAAGTACCTAGTAGCGGTACTTTGTGGAG 5 0.125 No Hit CCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTG 5 0.125 No Hit GTCCTTCTTCAAAGCATTACGTAACTTCAATTCCCGTTGTTTAACTTCTT 5 0.125 No Hit GGTTGCTTGACATCCGGGTGATGGGCATCGATCAACAATCTTGACAGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2125 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.5375000000000001 0.0 0.0 0.0 0.0 74-75 0.6625 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 1.075 0.0 0.0 0.0 0.0 80-81 1.3875000000000002 0.0 0.0 0.0 0.0 82-83 1.6375 0.0 0.0 0.0 0.0 84-85 1.8875000000000002 0.0 0.0 0.0 0.0 86-87 2.275 0.0 0.0 0.0 0.0 88-89 2.7249999999999996 0.0 0.0 0.0 0.0 90-91 3.1875 0.0 0.0 0.0 0.0 92-93 3.7375 0.0 0.0 0.0 0.0 94-95 4.3125 0.0 0.0 0.0 0.0 96-97 5.15 0.0 0.0 0.0 0.0 98-99 5.825 0.0 0.0 0.0 0.0 100-101 6.4625 0.0 0.0 0.0 0.0 102-103 7.1375 0.0 0.0 0.0 0.0 104-105 8.225000000000001 0.0 0.0 0.0 0.0 106-107 9.3125 0.0 0.0 0.0 0.0 108-109 10.175 0.0 0.0 0.0 0.0 110-111 11.2 0.0 0.0 0.0 0.0 112-113 12.075 0.0 0.0 0.0 0.0 114-115 12.7875 0.0 0.0 0.0 0.0 116-117 13.6375 0.0 0.0 0.0 0.0 118-119 14.675 0.025 0.0 0.0 0.0 120-121 15.774999999999999 0.025 0.0 0.0 0.0 122-123 16.825 0.025 0.0 0.0 0.0 124-125 18.075 0.025 0.0 0.0 0.0 126-127 19.2 0.025 0.0 0.0 0.0 128-129 20.2 0.025 0.0 0.0 0.0 130-131 21.112499999999997 0.025 0.0 0.0 0.0 132-133 22.35 0.025 0.0 0.0 0.0 134-135 23.675 0.025 0.0 0.0 0.0 136-137 24.9 0.025 0.0 0.0 0.0 138-139 26.1 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGTCT 75 0.0012377208 13.533334 130-134 CTCCAGT 75 0.0012377208 13.533334 140-144 TCCAGTC 80 0.0020131238 12.6875 140-144 GAGCACA 80 0.0020131238 12.6875 125-129 CTGAACT 80 0.0020131238 12.6875 135-139 ACGTCTG 85 0.0031733946 11.941176 130-134 AGCACAC 85 0.0031733946 11.941176 125-129 TGAACTC 85 0.0031733946 11.941176 135-139 CGGAAGA 90 0.0048656333 11.277777 120-124 GGAAGAG 95 0.007278115 10.684211 120-124 >>END_MODULE SRR12670181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.326 37.0 37.0 37.0 37.0 37.0 2 36.1085 37.0 37.0 37.0 37.0 37.0 3 36.1145 37.0 37.0 37.0 37.0 37.0 4 36.197 37.0 37.0 37.0 37.0 37.0 5 36.2245 37.0 37.0 37.0 37.0 37.0 6 36.11 37.0 37.0 37.0 37.0 37.0 7 36.21 37.0 37.0 37.0 37.0 37.0 8 36.311 37.0 37.0 37.0 37.0 37.0 9 36.182 37.0 37.0 37.0 37.0 37.0 10-14 36.243700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.262299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.209900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2225 37.0 37.0 37.0 37.0 37.0 30-34 36.208299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1503 37.0 37.0 37.0 37.0 37.0 40-44 36.1449 37.0 37.0 37.0 37.0 37.0 45-49 36.1312 37.0 37.0 37.0 37.0 37.0 50-54 36.0818 37.0 37.0 37.0 37.0 37.0 55-59 36.0677 37.0 37.0 37.0 37.0 37.0 60-64 36.0502 37.0 37.0 37.0 37.0 37.0 65-69 35.9798 37.0 37.0 37.0 37.0 37.0 70-74 35.97260000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.959500000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.9485 37.0 37.0 37.0 37.0 37.0 85-89 35.8059 37.0 37.0 37.0 37.0 37.0 90-94 35.8505 37.0 37.0 37.0 37.0 37.0 95-99 35.837 37.0 37.0 37.0 37.0 37.0 100-104 35.7001 37.0 37.0 37.0 37.0 37.0 105-109 35.6947 37.0 37.0 37.0 37.0 37.0 110-114 35.6426 37.0 37.0 37.0 37.0 37.0 115-119 35.6904 37.0 37.0 37.0 37.0 37.0 120-124 35.4982 37.0 37.0 37.0 37.0 37.0 125-129 35.3953 37.0 37.0 37.0 37.0 37.0 130-134 35.1716 37.0 37.0 37.0 32.2 37.0 135-139 35.0343 37.0 37.0 37.0 25.0 37.0 140-144 34.730599999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.4264 37.0 37.0 37.0 25.0 37.0 150-151 33.878 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 2.0 16 3.0 17 2.0 18 0.0 19 2.0 20 0.0 21 2.0 22 2.0 23 5.0 24 8.0 25 4.0 26 6.0 27 13.0 28 13.0 29 25.0 30 31.0 31 44.0 32 69.0 33 115.0 34 250.0 35 641.0 36 2547.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.275 22.55 10.225 26.950000000000003 2 27.900000000000002 26.025 31.474999999999998 14.6 3 19.975 28.249999999999996 32.800000000000004 18.975 4 23.95 33.175 23.825 19.05 5 24.375 37.45 22.175 16.0 6 20.25 38.6 21.95 19.2 7 20.45 21.775 38.925 18.85 8 21.25 25.3 28.7 24.75 9 22.25 23.724999999999998 31.8 22.225 10-14 23.26 29.005 26.915 20.82 15-19 23.64 27.85 27.889999999999997 20.62 20-24 23.189999999999998 28.494999999999997 27.900000000000002 20.415 25-29 23.200000000000003 28.24 28.04 20.52 30-34 22.74 28.515 28.025 20.72 35-39 23.445 27.88 27.515 21.16 40-44 23.645 27.815 28.345 20.195 45-49 23.105 27.93 28.355000000000004 20.61 50-54 23.465 27.555000000000003 27.750000000000004 21.23 55-59 23.055 27.889999999999997 28.59 20.465 60-64 22.55 28.24 28.17 21.04 65-69 23.315 28.095 27.515 21.075 70-74 23.505000000000003 27.76 27.534999999999997 21.2 75-79 23.48 28.194999999999997 27.705000000000002 20.62 80-84 23.695 27.93 27.13 21.245 85-89 24.065 28.165000000000003 27.865000000000002 19.905 90-94 23.755000000000003 28.005000000000003 27.295 20.945 95-99 24.725 28.360000000000003 26.61 20.305 100-104 24.785 28.04 27.24 19.935 105-109 25.39 27.815 26.97 19.825 110-114 25.545 27.525 26.87 20.06 115-119 25.95 28.12 26.1 19.830000000000002 120-124 26.515 27.77 26.275 19.439999999999998 125-129 27.445000000000004 27.955000000000002 25.795 18.805 130-134 28.535 27.04 25.619999999999997 18.805 135-139 29.095 26.855 26.325 17.724999999999998 140-144 29.365000000000002 26.775 25.735000000000003 18.125 145-149 30.195 26.229999999999997 25.3 18.275 150-151 31.3 26.85 25.45 16.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 4.5 28 6.5 29 9.5 30 10.5 31 16.5 32 28.5 33 39.0 34 49.0 35 68.0 36 88.5 37 110.0 38 138.0 39 173.5 40 204.5 41 210.0 42 244.5 43 283.0 44 293.0 45 280.5 46 267.5 47 265.5 48 244.5 49 208.5 50 156.5 51 116.5 52 108.0 53 98.0 54 68.5 55 41.5 56 29.5 57 26.0 58 23.0 59 20.0 60 15.0 61 10.0 62 5.5 63 3.5 64 3.0 65 2.5 66 1.0 67 1.5 68 1.5 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.65 #Duplication Level Percentage of deduplicated Percentage of total 1 82.51684017146357 67.375 2 13.59461114513166 22.2 3 3.1230863441518677 7.6499999999999995 4 0.5205143906919779 1.7000000000000002 5 0.15309246785058175 0.625 6 0.09185548071034905 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit GTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGAC 5 0.125 No Hit CTGAAATCACCATTACAAGTAGCAAGTGAGGGTTCGCCTTAGGTTTTGGC 5 0.125 No Hit CATTGACATTGTTGAGACTGTCTACCGGGGGGCAAGGAAGGGTCGTGGTC 5 0.125 No Hit GGGGAGAGTTGTTGCCGTCGTTGCTTTCTCAGGTTTTGTTACTGATGAAG 5 0.125 No Hit GTAGCTTCTGCCATTTCCGGGACTGCCACTTACTACAACGTTTATGTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2125 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.5625 0.0 0.0 0.0 0.0 74-75 0.6875 0.0 0.0 0.0 0.0 76-77 0.9375 0.0 0.0 0.0 0.0 78-79 1.125 0.0 0.0 0.0 0.0 80-81 1.4375 0.0 0.0 0.0 0.0 82-83 1.6875 0.0 0.0 0.0 0.0 84-85 1.9375 0.0 0.0 0.0 0.0 86-87 2.325 0.0 0.0 0.0 0.0 88-89 2.7750000000000004 0.0 0.0 0.0 0.0 90-91 3.2375 0.0 0.0 0.0 0.0 92-93 3.7874999999999996 0.0 0.0 0.0 0.0 94-95 4.3625 0.0 0.0 0.0 0.0 96-97 5.199999999999999 0.0 0.0 0.0 0.0 98-99 5.875 0.0 0.0 0.0 0.0 100-101 6.525 0.0 0.0 0.0 0.0 102-103 7.2375 0.0 0.0 0.0 0.0 104-105 8.3375 0.0 0.0 0.0125 0.0 106-107 9.4625 0.0 0.0 0.025 0.0 108-109 10.3 0.0 0.0 0.025 0.0 110-111 11.325 0.0 0.0 0.025 0.0 112-113 12.2 0.0 0.0 0.025 0.0 114-115 12.9 0.0 0.0 0.025 0.0 116-117 13.7375 0.0 0.0 0.025 0.0 118-119 14.774999999999999 0.0 0.0 0.025 0.0 120-121 15.875 0.0 0.0 0.025 0.0 122-123 17.0 0.0 0.0 0.025 0.0 124-125 18.237499999999997 0.0 0.0 0.025 0.0 126-127 19.3625 0.0 0.0 0.025 0.0 128-129 20.3125 0.0 0.0 0.025 0.0 130-131 21.2125 0.0 0.0 0.025 0.0 132-133 22.4 0.0 0.0 0.025 0.0 134-135 23.725 0.0 0.0 0.025 0.0 136-137 24.9375 0.0 0.0 0.025 0.0 138-139 26.1375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTTC 10 0.006830828 145.0 5 TAGGGAA 60 0.004491891 14.500001 135-139 TCGTGTA 70 7.343502E-4 14.5 130-134 CGTGTAG 70 7.343502E-4 14.5 130-134 AAAGAGT 70 7.343502E-4 14.5 140-144 GAAAGAG 65 0.0076375785 13.384615 140-144 AGCGTCG 80 0.0020131238 12.6875 125-129 GAGCGTC 85 0.0031733946 11.941176 125-129 >>END_MODULE Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra Read 550484 spots for SRR12670181.sra Written 550484 spots for SRR12670181.sra SRR ids: ['SRR12670181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ep72lfc9 SRR12670181.sra spots: 11009680 blocks: [[1, 550484], [550485, 1100968], [1100969, 1651452], [1651453, 2201936], [2201937, 2752420], [2752421, 3302904], [3302905, 3853388], [3853389, 4403872], [4403873, 4954356], [4954357, 5504840], [5504841, 6055324], [6055325, 6605808], [6605809, 7156292], [7156293, 7706776], [7706777, 8257260], [8257261, 8807744], [8807745, 9358228], [9358229, 9908712], [9908713, 10459196], [10459197, 11009680]] SRR12670181 file size 3719870 SRR12670181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670181 SRR12670181_1.fastq SRR12670181_2.fastq Input file: SRR12670181_1.fastq Paired file: SRR12670181_2.fastq trimmed: SRR12670181-trimmed-pair1.fastq, SRR12670181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:13:56 2025 >> started Tue Feb 11 09:14:08 2025 >> done (12.060s) 11009680 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 3597 ( 0.03%) empty read pairs filtered out after trimming by size control 11006037 (99.97%) read pairs available; of these: 3217335 (29.23%) trimmed read pairs available after processing 7788702 (70.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 6 0.00% 21 10 0.00% 22 7 0.00% 23 11 0.00% 24 20 0.00% 25 29 0.00% 26 30 0.00% 27 42 0.00% 28 33 0.00% 29 59 0.00% 30 44 0.00% 31 53 0.00% 32 47 0.00% 33 78 0.00% 34 80 0.00% 35 79 0.00% 36 80 0.00% 37 120 0.00% 38 147 0.00% 39 130 0.00% 40 165 0.00% 41 182 0.00% 42 175 0.00% 43 218 0.00% 44 183 0.00% 45 176 0.00% 46 206 0.00% 47 292 0.00% 48 349 0.00% 49 405 0.00% 50 462 0.00% 51 504 0.00% 52 609 0.01% 53 585 0.01% 54 689 0.01% 55 700 0.01% 56 838 0.01% 57 906 0.01% 58 1067 0.01% 59 1277 0.01% 60 1529 0.01% 61 1734 0.02% 62 1956 0.02% 63 2220 0.02% 64 2353 0.02% 65 2461 0.02% 66 2675 0.02% 67 3072 0.03% 68 3243 0.03% 69 3856 0.04% 70 4793 0.04% 71 5310 0.05% 72 5923 0.05% 73 6770 0.06% 74 7432 0.07% 75 8052 0.07% 76 8712 0.08% 77 9084 0.08% 78 9990 0.09% 79 10916 0.10% 80 11984 0.11% 81 13389 0.12% 82 15053 0.14% 83 16465 0.15% 84 18026 0.16% 85 19029 0.17% 86 20238 0.18% 87 20974 0.19% 88 21900 0.20% 89 23178 0.21% 90 24633 0.22% 91 26443 0.24% 92 28522 0.26% 93 30553 0.28% 94 32452 0.29% 95 33944 0.31% 96 34756 0.32% 97 35499 0.32% 98 35969 0.33% 99 35870 0.33% 100 37776 0.34% 101 39036 0.35% 102 40708 0.37% 103 42273 0.38% 104 43748 0.40% 105 45166 0.41% 106 45934 0.42% 107 45387 0.41% 108 46398 0.42% 109 46276 0.42% 110 46388 0.42% 111 46832 0.43% 112 48199 0.44% 113 48846 0.44% 114 50433 0.46% 115 51618 0.47% 116 52095 0.47% 117 51791 0.47% 118 51879 0.47% 119 51807 0.47% 120 51088 0.46% 121 51933 0.47% 122 52005 0.47% 123 52916 0.48% 124 53770 0.49% 125 54376 0.49% 126 55464 0.50% 127 55084 0.50% 128 54521 0.50% 129 53187 0.48% 130 53640 0.49% 131 52976 0.48% 132 53806 0.49% 133 54585 0.50% 134 54691 0.50% 135 55019 0.50% 136 55478 0.50% 137 55066 0.50% 138 54905 0.50% 139 55223 0.50% 140 53285 0.48% 141 53561 0.49% 142 53290 0.48% 143 53622 0.49% 144 54299 0.49% 145 54716 0.50% 146 54462 0.49% 147 54066 0.49% 148 54640 0.50% 149 53141 0.48% 150 53872 0.49% 151 7788702 70.77% 11006037 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=150.72 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=29 fanout-score=40.67 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=13.9 sequence=AAAGAAAAGAAAA SRR12670181 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:14:48 Started mapping on | Feb 11 09:14:49 Finished on | Feb 11 09:15:51 Mapping speed, Million of reads per hour | 639.06 Number of input reads | 11006037 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 10386673 Uniquely mapped reads % | 94.37% Average mapped length | 281.70 Number of splices: Total | 9791708 Number of splices: Annotated (sjdb) | 9551880 Number of splices: GT/AG | 9595282 Number of splices: GC/AG | 155131 Number of splices: AT/AC | 6342 Number of splices: Non-canonical | 34953 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288245 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 28503 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331119 331119 331119 N_multimapping 288245 288245 288245 N_noFeature 393648 10238771 461191 N_ambiguous 143776 617 63038 UnstrandedReadsAssigned:9849249 PositiveStrandReadsAssigned:147285 NegativeStrandReadsAssigned:9862444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=131 echo kmer=127 SRR12670181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670181-trimmed-pair1.fastq SRR12670181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,006,037 reads, 9,905,597 reads pseudoaligned [quant] estimated average fragment length: 200.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR12670181.ke.tsv 34699 SRR12670181.se.tsv 87100 total ==> SRR12670181.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.33 478 27.2963 Potri.005G024800.1.v4.1 1035 835.325 213 26.4772 Potri.004G059700.1.v4.1 961 761.378 12 1.63655 Potri.007G009000.2.v4.1 1416 1216.33 0 0 Potri.003G141000.2.v4.1 2943 2743.33 497.805 18.8422 Potri.016G087400.1.v4.1 270 110.655 454 426.024 Potri.015G069301.1.v4.1 564 370.722 0 0 Potri.010G195200.1.v4.1 1773 1573.33 66 4.35586 Potri.012G127500.1.v4.1 977 777.357 72 9.61745 ==> SRR12670181.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 244 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 177 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 61 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12670181 completed mapping pipeline successfully