Starting /dee2/code/volunteer_pipeline.sh SRR12670182 current disk space = 3055486976000 free memory = 1219190740 SRR12670182 SRAfilesize 5f83f84edfddad40dcd500428d7ebb9c SRR12670182.sra SRR12670182.sra file validated SRR12670182 is paired end SRR12670182 is conventional basespace SRR12670182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.633 37.0 37.0 37.0 37.0 37.0 2 36.441 37.0 37.0 37.0 37.0 37.0 3 36.663 37.0 37.0 37.0 37.0 37.0 4 36.6315 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.684 37.0 37.0 37.0 37.0 37.0 7 36.639 37.0 37.0 37.0 37.0 37.0 8 36.658 37.0 37.0 37.0 37.0 37.0 9 36.641 37.0 37.0 37.0 37.0 37.0 10-14 36.6647 37.0 37.0 37.0 37.0 37.0 15-19 36.622 37.0 37.0 37.0 37.0 37.0 20-24 36.5971 37.0 37.0 37.0 37.0 37.0 25-29 36.56 37.0 37.0 37.0 37.0 37.0 30-34 36.5449 37.0 37.0 37.0 37.0 37.0 35-39 36.517 37.0 37.0 37.0 37.0 37.0 40-44 36.4878 37.0 37.0 37.0 37.0 37.0 45-49 36.4736 37.0 37.0 37.0 37.0 37.0 50-54 36.4593 37.0 37.0 37.0 37.0 37.0 55-59 36.425 37.0 37.0 37.0 37.0 37.0 60-64 36.3989 37.0 37.0 37.0 37.0 37.0 65-69 36.3729 37.0 37.0 37.0 37.0 37.0 70-74 36.352199999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3551 37.0 37.0 37.0 37.0 37.0 80-84 36.308 37.0 37.0 37.0 37.0 37.0 85-89 36.2898 37.0 37.0 37.0 37.0 37.0 90-94 36.275600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2638 37.0 37.0 37.0 37.0 37.0 100-104 36.267700000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.230599999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.2039 37.0 37.0 37.0 37.0 37.0 115-119 36.177099999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0869 37.0 37.0 37.0 37.0 37.0 125-129 35.950900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9387 37.0 37.0 37.0 37.0 37.0 135-139 35.8221 37.0 37.0 37.0 37.0 37.0 140-144 35.7048 37.0 37.0 37.0 37.0 37.0 145-149 35.655899999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.406 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 2.0 25 2.0 26 5.0 27 3.0 28 14.0 29 20.0 30 20.0 31 32.0 32 38.0 33 57.0 34 126.0 35 311.0 36 2986.0 37 381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.025 11.5 4.575 42.9 2 17.15931863727455 12.725450901803606 40.6813627254509 29.43386773547094 3 16.775000000000002 16.2 29.275000000000002 37.75 4 23.3 24.8 24.775 27.125 5 23.125 32.0 23.25 21.625 6 20.175 35.65 23.525 20.65 7 15.275 27.575 40.0 17.150000000000002 8 18.75 24.4 33.074999999999996 23.775 9 17.25 22.925 34.975 24.85 10-14 19.59 29.78 27.52 23.11 15-19 19.835 27.715 28.48 23.97 20-24 20.369999999999997 27.87 29.044999999999998 22.715 25-29 20.19 28.565 27.505000000000003 23.74 30-34 20.235 28.92 27.42 23.425 35-39 20.26 28.89 27.725 23.125 40-44 20.5 29.104999999999997 27.365000000000002 23.03 45-49 20.655 28.87 27.54 22.935 50-54 19.445 28.854999999999997 28.105000000000004 23.595 55-59 20.695 28.38 28.015 22.91 60-64 20.9 29.04 27.465 22.595000000000002 65-69 20.785 27.705000000000002 27.87 23.64 70-74 20.085 29.29 27.839999999999996 22.785 75-79 20.73 28.52 27.375 23.375 80-84 20.200000000000003 28.499999999999996 27.605 23.695 85-89 20.485 29.03 27.765 22.720000000000002 90-94 20.91 28.845 27.22 23.025000000000002 95-99 20.685000000000002 28.53 27.925 22.86 100-104 20.75 29.095 26.745 23.41 105-109 20.97 28.675 27.08 23.275000000000002 110-114 21.325 28.075 27.21 23.39 115-119 21.47 28.455000000000002 26.96 23.115 120-124 20.5 27.744999999999997 27.305 24.45 125-129 20.985 28.565 27.105 23.345 130-134 21.654999999999998 27.800000000000004 26.82 23.724999999999998 135-139 21.45 28.060000000000002 26.474999999999998 24.015 140-144 21.310000000000002 28.02 26.915 23.755000000000003 145-149 21.595 27.295 27.095000000000002 24.015 150-151 21.4125 27.8625 26.6 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 2.5 26 3.0 27 9.5 28 11.5 29 11.0 30 18.5 31 24.5 32 31.5 33 38.5 34 53.0 35 68.0 36 86.5 37 120.0 38 157.0 39 170.5 40 191.0 41 231.5 42 235.5 43 244.5 44 278.0 45 266.5 46 251.0 47 245.5 48 219.0 49 196.5 50 162.5 51 139.0 52 119.0 53 87.0 54 85.5 55 73.5 56 43.0 57 36.5 58 23.5 59 11.5 60 10.5 61 12.0 62 9.5 63 5.0 64 4.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.65 #Duplication Level Percentage of deduplicated Percentage of total 1 80.97928436911488 64.5 2 14.155681104833647 22.55 3 3.640929064657878 8.7 4 0.9102322661644695 2.9000000000000004 5 0.2197112366603892 0.8750000000000001 6 0.06277463904582549 0.3 7 0.031387319522912745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTAAAGAAGATAAAGACTCCAAAGTATACAATGCTGTAATGGTATAAT 7 0.17500000000000002 No Hit CCACTTATTTATTTTTCTCACTAGGACCTCATCCTGTTGATTTGGTTCAA 6 0.15 No Hit ATCAGAATTCGGATAGCCCCAGTAATGTTAGTTAAGTTGTTGGCGGAAAT 6 0.15 No Hit AATAGATTGATGTACCTCAACTAAACTTGAGCAACCTTCAAGCAGTAGTT 5 0.125 No Hit CTCTGAGAAGACCTGAGTTGAAGGCTGGTCCTAGAAGGCACACCCACCTT 5 0.125 No Hit CTTTTATAAGTTCTAGCTATGAACAAACCTGGACAAGGTATCTCTAATGG 5 0.125 No Hit GTATGATTAGCTCCCCTGCACTTCAATAGGTTTTTGTTGATATCGACTTC 5 0.125 No Hit CTCTTGAGCTTCACCGCTACAGCCTTCTTCCCCGGTGATGCAACCTTCTT 5 0.125 No Hit ATCCACTGCTTTATAACTGACAGCTTTACACATTACTCGAATCTGGCTCA 5 0.125 No Hit GTGATGTGCTTCCCTGCGCCTTCCCTGTCGACGAAAACCCCGGTACCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.6625000000000001 0.0 0.0 0.0 0.0 80-81 0.8374999999999999 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.6 0.0 0.0 0.0 0.0 86-87 1.8250000000000002 0.0 0.0 0.0 0.0 88-89 2.2375 0.0 0.0 0.0 0.0 90-91 2.5125 0.0 0.0 0.0 0.0 92-93 3.0125 0.0 0.0 0.0 0.0 94-95 3.4 0.0 0.0 0.0 0.0 96-97 3.675 0.0 0.0 0.0 0.0 98-99 4.0875 0.0 0.0 0.0 0.0 100-101 4.5 0.0 0.0 0.0 0.0 102-103 5.137499999999999 0.0 0.0 0.0 0.0 104-105 5.7125 0.0 0.0 0.0 0.0 106-107 6.275 0.0 0.0 0.0 0.0 108-109 6.887499999999999 0.0 0.0 0.0 0.0 110-111 7.35 0.0 0.0 0.0 0.0 112-113 7.737500000000001 0.0 0.0 0.0 0.0 114-115 8.375 0.0 0.0 0.0 0.0 116-117 8.925 0.0 0.0 0.0 0.0 118-119 9.6 0.0 0.0 0.0 0.0 120-121 10.325 0.0 0.0 0.0 0.0 122-123 11.2 0.0 0.0 0.0 0.0 124-125 11.825 0.0 0.0 0.0 0.0 126-127 12.825 0.0 0.0 0.0 0.0 128-129 13.7375 0.0 0.0 0.0 0.0 130-131 14.325 0.0 0.0 0.0 0.0 132-133 15.087499999999999 0.0 0.0 0.0 0.0 134-135 16.025 0.0 0.0 0.0 0.0 136-137 16.7875 0.0 0.0 0.0 0.0 138-139 17.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATTC 10 0.006830828 145.0 1 >>END_MODULE SRR12670182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.328 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.3165 37.0 37.0 37.0 37.0 37.0 4 36.419 37.0 37.0 37.0 37.0 37.0 5 36.324 37.0 37.0 37.0 37.0 37.0 6 36.317 37.0 37.0 37.0 37.0 37.0 7 36.382 37.0 37.0 37.0 37.0 37.0 8 36.466 37.0 37.0 37.0 37.0 37.0 9 36.415 37.0 37.0 37.0 37.0 37.0 10-14 36.47240000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.393299999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3439 37.0 37.0 37.0 37.0 37.0 25-29 36.3981 37.0 37.0 37.0 37.0 37.0 30-34 36.3389 37.0 37.0 37.0 37.0 37.0 35-39 36.3267 37.0 37.0 37.0 37.0 37.0 40-44 36.309900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.2783 37.0 37.0 37.0 37.0 37.0 50-54 36.2342 37.0 37.0 37.0 37.0 37.0 55-59 36.243100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.196999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.21509999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.1697 37.0 37.0 37.0 37.0 37.0 75-79 36.1451 37.0 37.0 37.0 37.0 37.0 80-84 36.115899999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.036699999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.0495 37.0 37.0 37.0 37.0 37.0 95-99 36.01610000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.9766 37.0 37.0 37.0 37.0 37.0 105-109 35.8562 37.0 37.0 37.0 37.0 37.0 110-114 35.829899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.854400000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6625 37.0 37.0 37.0 37.0 37.0 125-129 35.5616 37.0 37.0 37.0 37.0 37.0 130-134 35.384100000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.256299999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.076899999999995 37.0 37.0 37.0 27.4 37.0 145-149 34.7547 37.0 37.0 37.0 25.0 37.0 150-151 34.47725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 5.0 23 3.0 24 4.0 25 7.0 26 8.0 27 5.0 28 5.0 29 17.0 30 20.0 31 39.0 32 68.0 33 101.0 34 202.0 35 528.0 36 2648.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 22.575 8.15 28.65 2 24.925 25.825 32.800000000000004 16.45 3 18.65 28.050000000000004 33.175 20.125 4 23.65 32.6 24.825 18.925 5 24.55 36.85 21.325 17.275 6 18.15 40.699999999999996 22.5 18.65 7 18.85 21.85 39.85 19.45 8 18.65 25.525 31.525 24.3 9 21.6 24.3 30.625000000000004 23.474999999999998 10-14 22.465 30.335 26.415 20.785 15-19 22.755 28.294999999999998 27.96 20.990000000000002 20-24 22.34 28.68 27.834999999999997 21.145 25-29 22.37 28.675 28.4 20.555 30-34 22.605 28.084999999999997 28.749999999999996 20.560000000000002 35-39 22.264999999999997 28.084999999999997 28.449999999999996 21.2 40-44 22.465 27.73 28.389999999999997 21.415 45-49 23.055 28.18 28.395 20.369999999999997 50-54 22.634999999999998 28.384999999999998 28.12 20.86 55-59 23.165 28.115000000000002 28.285 20.435 60-64 22.830000000000002 28.24 28.23 20.7 65-69 22.82 28.249999999999996 27.755000000000003 21.175 70-74 23.165 28.49 27.66 20.685000000000002 75-79 22.445 28.499999999999996 28.595 20.46 80-84 23.555 27.88 27.49 21.075 85-89 23.064999999999998 28.895 27.015 21.025 90-94 23.26 28.62 27.185 20.935000000000002 95-99 23.68 28.494999999999997 27.450000000000003 20.375 100-104 24.665 28.384999999999998 26.995 19.955000000000002 105-109 24.169999999999998 28.249999999999996 27.145000000000003 20.435 110-114 24.65 28.634999999999998 27.185 19.53 115-119 25.124999999999996 28.439999999999998 27.345000000000002 19.09 120-124 24.925 27.500000000000004 27.825 19.75 125-129 25.895000000000003 27.529999999999998 27.485 19.09 130-134 26.44 27.439999999999998 27.215 18.905 135-139 27.455000000000002 26.779999999999998 26.605 19.16 140-144 28.395 27.315 25.885 18.404999999999998 145-149 29.255 26.979999999999997 26.025 17.740000000000002 150-151 29.75 27.0125 25.5125 17.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 2.0 25 3.5 26 5.0 27 8.0 28 13.0 29 13.0 30 13.5 31 22.5 32 34.0 33 45.5 34 56.0 35 71.0 36 96.5 37 116.0 38 140.5 39 179.5 40 233.5 41 255.0 42 256.0 43 272.5 44 263.5 45 257.5 46 244.5 47 225.5 48 213.0 49 197.0 50 174.5 51 125.5 52 91.0 53 89.5 54 79.0 55 57.5 56 41.0 57 27.0 58 20.5 59 16.0 60 8.5 61 4.5 62 4.5 63 4.5 64 1.5 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 1.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.975 #Duplication Level Percentage of deduplicated Percentage of total 1 81.55673648015005 65.225 2 13.597999374804626 21.75 3 3.6886527039699906 8.85 4 0.8127539856205065 2.6 5 0.2188183807439825 0.8750000000000001 6 0.06251953735542357 0.3 7 0.03125976867771178 0.17500000000000002 8 0.0 0.0 9 0.03125976867771178 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTGTTTTCGCAGCCCCTGCTCCTATTCTCTATCCACCTCGGAGAGGCG 9 0.22499999999999998 No Hit GAAGTTGTGATTATGATCTCAGACAGCTAAGAATAATGCGTTTCTTCTAT 7 0.17500000000000002 No Hit CTCTGACCTCGATTTCTCCACACTCCCCAAGCTTACCACCCTCGATCTTG 6 0.15 No Hit CTTTGGGTGCTCTACAATATTCTACAGCCAGCTTTGAACCAAATCAACAG 6 0.15 No Hit GTTAAAACACCAAACCTGCACAGTTCAAGTCTAGAGAAACTACTGCTTGA 5 0.125 No Hit CACTCGCTCTGTTTTTTTCTTTTTTCTTTTGAATACACAGTTCCAAGCGA 5 0.125 No Hit GCACTTGTTAAATCTGGAATGGTGATTGGACTAGGCACTGGAAGAACCTT 5 0.125 No Hit GAAAATCTTGCAAGAAGAACTAGATGTATTGAGAAGTCGGACAAGCGTAA 5 0.125 No Hit GGTCTCACTGTCAAGGCTTCCTTTACCAAGGGAGGTCCTGGCGTCTTGGA 5 0.125 No Hit CCGAGAAAGATAGCGACCCCTGCCAAGCCAAAGCCGAAGCCAAAAGCCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.425 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.6625000000000001 0.0 0.0 0.0 0.0 80-81 0.8374999999999999 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.6 0.0 0.0 0.0 0.0 86-87 1.8250000000000002 0.0 0.0 0.0 0.0 88-89 2.2375 0.0 0.0 0.0 0.0 90-91 2.525 0.0 0.0 0.0 0.0 92-93 3.0374999999999996 0.0 0.0 0.0 0.0 94-95 3.4375 0.0 0.0 0.0 0.0 96-97 3.725 0.0 0.0 0.0 0.0 98-99 4.137499999999999 0.0 0.0 0.0 0.0 100-101 4.5625 0.0 0.0 0.0 0.0 102-103 5.2125 0.0 0.0 0.0 0.0 104-105 5.7875 0.0 0.0 0.0 0.0 106-107 6.35 0.0 0.0 0.0 0.0 108-109 7.012499999999999 0.0 0.0 0.0 0.0 110-111 7.475 0.0 0.0 0.0 0.0 112-113 7.8875 0.0 0.0 0.0 0.0 114-115 8.524999999999999 0.0 0.0 0.0 0.0 116-117 9.1125 0.0 0.0 0.0 0.0 118-119 9.8125 0.0 0.0 0.0 0.0 120-121 10.587499999999999 0.0 0.0 0.0 0.0 122-123 11.475000000000001 0.0 0.0 0.0 0.0 124-125 12.125 0.0 0.0 0.0 0.0 126-127 13.15 0.0 0.0 0.0 0.0 128-129 14.0625 0.0 0.0 0.0 0.0 130-131 14.649999999999999 0.0 0.0 0.0 0.0 132-133 15.45 0.0 0.0 0.0 0.0 134-135 16.4375 0.0 0.0 0.0 0.0 136-137 17.225 0.0 0.0 0.0 0.0 138-139 18.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAACA 10 0.006830828 145.0 145 >>END_MODULE Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767934 spots for SRR12670182.sra Written 767934 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra Read 767918 spots for SRR12670182.sra Written 767918 spots for SRR12670182.sra SRR ids: ['SRR12670182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_37dg42jo SRR12670182.sra spots: 15358376 blocks: [[1, 767918], [767919, 1535836], [1535837, 2303754], [2303755, 3071672], [3071673, 3839590], [3839591, 4607508], [4607509, 5375426], [5375427, 6143344], [6143345, 6911262], [6911263, 7679180], [7679181, 8447098], [8447099, 9215016], [9215017, 9982934], [9982935, 10750852], [10750853, 11518770], [11518771, 12286688], [12286689, 13054606], [13054607, 13822524], [13822525, 14590442], [14590443, 15358376]] SRR12670182 file size 5197747 SRR12670182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670182 SRR12670182_1.fastq SRR12670182_2.fastq Input file: SRR12670182_1.fastq Paired file: SRR12670182_2.fastq trimmed: SRR12670182-trimmed-pair1.fastq, SRR12670182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:05:23 2025 >> started Tue Feb 11 09:05:42 2025 >> done (18.838s) 15358376 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 2054 ( 0.01%) empty read pairs filtered out after trimming by size control 15356225 (99.99%) read pairs available; of these: 3238690 (21.09%) trimmed read pairs available after processing 12117535 (78.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 7 0.00% 21 9 0.00% 22 12 0.00% 23 16 0.00% 24 25 0.00% 25 15 0.00% 26 26 0.00% 27 35 0.00% 28 48 0.00% 29 43 0.00% 30 38 0.00% 31 63 0.00% 32 76 0.00% 33 63 0.00% 34 70 0.00% 35 74 0.00% 36 92 0.00% 37 107 0.00% 38 96 0.00% 39 128 0.00% 40 132 0.00% 41 149 0.00% 42 180 0.00% 43 162 0.00% 44 178 0.00% 45 185 0.00% 46 177 0.00% 47 221 0.00% 48 273 0.00% 49 353 0.00% 50 372 0.00% 51 449 0.00% 52 505 0.00% 53 490 0.00% 54 567 0.00% 55 608 0.00% 56 676 0.00% 57 714 0.00% 58 819 0.01% 59 968 0.01% 60 1173 0.01% 61 1342 0.01% 62 1502 0.01% 63 1708 0.01% 64 1882 0.01% 65 2099 0.01% 66 2240 0.01% 67 2429 0.02% 68 2702 0.02% 69 3098 0.02% 70 3614 0.02% 71 4019 0.03% 72 4837 0.03% 73 5525 0.04% 74 5707 0.04% 75 6230 0.04% 76 6845 0.04% 77 7412 0.05% 78 7906 0.05% 79 8760 0.06% 80 9653 0.06% 81 10868 0.07% 82 12166 0.08% 83 13109 0.09% 84 14508 0.09% 85 15677 0.10% 86 16331 0.11% 87 17164 0.11% 88 17768 0.12% 89 19035 0.12% 90 20543 0.13% 91 21752 0.14% 92 23327 0.15% 93 24799 0.16% 94 26681 0.17% 95 27925 0.18% 96 28970 0.19% 97 30155 0.20% 98 30197 0.20% 99 31166 0.20% 100 32610 0.21% 101 33526 0.22% 102 35277 0.23% 103 37006 0.24% 104 38059 0.25% 105 39634 0.26% 106 40105 0.26% 107 41198 0.27% 108 41602 0.27% 109 42103 0.27% 110 42424 0.28% 111 43899 0.29% 112 44802 0.29% 113 45855 0.30% 114 47375 0.31% 115 48815 0.32% 116 49394 0.32% 117 50823 0.33% 118 50742 0.33% 119 50483 0.33% 120 51358 0.33% 121 51951 0.34% 122 53211 0.35% 123 54484 0.35% 124 55289 0.36% 125 55554 0.36% 126 57401 0.37% 127 57781 0.38% 128 57583 0.37% 129 58350 0.38% 130 58608 0.38% 131 58039 0.38% 132 59074 0.38% 133 59748 0.39% 134 60621 0.39% 135 61649 0.40% 136 61979 0.40% 137 62806 0.41% 138 62443 0.41% 139 63827 0.42% 140 63114 0.41% 141 63444 0.41% 142 63669 0.41% 143 63864 0.42% 144 65584 0.43% 145 65510 0.43% 146 66240 0.43% 147 66762 0.43% 148 67107 0.44% 149 66689 0.43% 150 67160 0.44% 151 12117535 78.91% 15356225 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=339.66 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.89 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.8 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12670182 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:06:47 Started mapping on | Feb 11 09:06:47 Finished on | Feb 11 09:08:35 Mapping speed, Million of reads per hour | 511.87 Number of input reads | 15356225 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14387241 Uniquely mapped reads % | 93.69% Average mapped length | 288.00 Number of splices: Total | 13807926 Number of splices: Annotated (sjdb) | 13458350 Number of splices: GT/AG | 13519020 Number of splices: GC/AG | 223753 Number of splices: AT/AC | 9696 Number of splices: Non-canonical | 55457 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380886 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 58764 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588098 588098 588098 N_multimapping 380886 380886 380886 N_noFeature 602377 14201899 681459 N_ambiguous 200453 813 93663 UnstrandedReadsAssigned:13584411 PositiveStrandReadsAssigned:184529 NegativeStrandReadsAssigned:13612119 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR12670182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670182-trimmed-pair1.fastq SRR12670182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,356,225 reads, 13,631,328 reads pseudoaligned [quant] estimated average fragment length: 218.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12670182.ke.tsv 34699 SRR12670182.se.tsv 87100 total ==> SRR12670182.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.63 652 28.297 Potri.005G024800.1.v4.1 1035 817.63 230 21.9831 Potri.004G059700.1.v4.1 961 743.684 9 0.945739 Potri.007G009000.2.v4.1 1416 1198.63 0 0 Potri.003G141000.2.v4.1 2943 2725.63 695.442 19.9394 Potri.016G087400.1.v4.1 270 101.579 683 525.455 Potri.015G069301.1.v4.1 564 354.025 0 0 Potri.010G195200.1.v4.1 1773 1555.63 128 6.43015 Potri.012G127500.1.v4.1 977 759.657 183 18.8257 ==> SRR12670182.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 318 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12670182 completed mapping pipeline successfully