Starting /dee2/code/volunteer_pipeline.sh SRR12670949 current disk space = 3054933540864 free memory = 1504560096 SRR12670949 SRAfilesize a1c2d63df9fda7108732988f610985ad SRR12670949.sra SRR12670949.sra file validated SRR12670949 is paired end SRR12670949 is conventional basespace SRR12670949 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670949_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.40375 37.0 37.0 37.0 37.0 37.0 2 36.4535 37.0 37.0 37.0 37.0 37.0 3 36.573 37.0 37.0 37.0 37.0 37.0 4 36.5745 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.607 37.0 37.0 37.0 37.0 37.0 7 36.5825 37.0 37.0 37.0 37.0 37.0 8 36.579 37.0 37.0 37.0 37.0 37.0 9 36.6795 37.0 37.0 37.0 37.0 37.0 10-14 36.617200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5977 37.0 37.0 37.0 37.0 37.0 20-24 36.605599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.54899999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.495 37.0 37.0 37.0 37.0 37.0 35-39 36.5004 37.0 37.0 37.0 37.0 37.0 40-44 36.4971 37.0 37.0 37.0 37.0 37.0 45-49 36.4625 37.0 37.0 37.0 37.0 37.0 50-54 36.410399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.43390000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.4504 37.0 37.0 37.0 37.0 37.0 65-69 36.3652 37.0 37.0 37.0 37.0 37.0 70-74 36.3702 37.0 37.0 37.0 37.0 37.0 75-79 36.2992 37.0 37.0 37.0 37.0 37.0 80-84 36.28320000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.3183 37.0 37.0 37.0 37.0 37.0 90-94 36.235200000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.20190000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.176 37.0 37.0 37.0 37.0 37.0 105-109 36.1529 37.0 37.0 37.0 37.0 37.0 110-114 36.152 37.0 37.0 37.0 37.0 37.0 115-119 36.1203 37.0 37.0 37.0 37.0 37.0 120-124 36.0617 37.0 37.0 37.0 37.0 37.0 125-129 36.006299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9042 37.0 37.0 37.0 37.0 37.0 135-139 35.86 37.0 37.0 37.0 37.0 37.0 140-144 35.829 37.0 37.0 37.0 37.0 37.0 145-149 35.693799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.4255 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 0.0 23 2.0 24 1.0 25 2.0 26 1.0 27 10.0 28 17.0 29 18.0 30 33.0 31 37.0 32 52.0 33 76.0 34 117.0 35 271.0 36 2731.0 37 629.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.46086521630408 11.727931982995749 4.651162790697675 40.160040010002504 2 16.900000000000002 10.375 41.699999999999996 31.025000000000002 3 16.3 15.25 27.675 40.775 4 22.575 21.725 23.925 31.775 5 23.0 30.125 25.424999999999997 21.45 6 19.125 32.074999999999996 24.7 24.099999999999998 7 15.525 26.900000000000002 40.625 16.950000000000003 8 16.400000000000002 24.825 35.075 23.7 9 16.875 23.225 36.4 23.5 10-14 19.46 29.585 28.29 22.665 15-19 19.245 28.449999999999996 27.91 24.395 20-24 19.564999999999998 28.32 28.255000000000003 23.86 25-29 20.175 27.865000000000002 28.77 23.189999999999998 30-34 19.455 28.22 28.505000000000003 23.82 35-39 19.814999999999998 28.299999999999997 27.894999999999996 23.990000000000002 40-44 19.585 28.935 27.889999999999997 23.59 45-49 19.75 29.365000000000002 27.555000000000003 23.330000000000002 50-54 20.549999999999997 27.925 28.09 23.435 55-59 20.275000000000002 28.110000000000003 27.48 24.135 60-64 19.775000000000002 28.515 27.83 23.880000000000003 65-69 20.369999999999997 27.965 28.444999999999997 23.22 70-74 20.465 28.084999999999997 28.275 23.175 75-79 20.64 28.1 28.244999999999997 23.015 80-84 19.869999999999997 28.544999999999998 28.244999999999997 23.34 85-89 19.89 28.585 27.6 23.925 90-94 20.05 28.035 27.935 23.98 95-99 20.415 28.615000000000002 27.87 23.1 100-104 20.215 28.475 27.955000000000002 23.355 105-109 20.365 28.67 27.650000000000002 23.315 110-114 20.605 27.779999999999998 28.17 23.445 115-119 21.240000000000002 28.560000000000002 27.43 22.770000000000003 120-124 20.75 27.855 27.639999999999997 23.755000000000003 125-129 20.705000000000002 28.01 27.0 24.285 130-134 21.099999999999998 28.29 27.589999999999996 23.02 135-139 20.925 28.24 27.125 23.71 140-144 20.69 27.77 27.685 23.855 145-149 21.349999999999998 27.85 26.840000000000003 23.96 150-151 21.8125 27.6625 26.85 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 3.0 25 3.5 26 2.0 27 5.0 28 10.0 29 14.0 30 16.5 31 19.0 32 32.0 33 51.0 34 63.5 35 79.5 36 94.5 37 109.0 38 135.0 39 152.0 40 166.5 41 208.5 42 246.0 43 253.0 44 260.5 45 282.5 46 274.0 47 247.5 48 234.5 49 216.5 50 182.5 51 155.0 52 121.5 53 84.5 54 74.0 55 58.0 56 37.0 57 26.5 58 20.5 59 17.5 60 13.0 61 8.0 62 5.0 63 1.5 64 2.5 65 1.5 66 0.0 67 0.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85147423532653 82.425 2 8.1289611463213 14.75 3 0.9644530173601543 2.625 4 0.055111600992008826 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1749999999999998 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.487500000000001 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 7.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTC 10 0.006830828 145.0 3 GGGTTCC 10 0.006830828 145.0 3 ATCTCGT 10 0.006830828 145.0 145 GGTTCCA 10 0.006830828 145.0 4 ACTTTGT 10 0.006830828 145.0 8 GGGGGTT 10 0.006830828 145.0 1 GGGGTTC 10 0.006830828 145.0 2 GCATTCT 10 0.006830828 145.0 4 ACCAGTT 10 0.006830828 145.0 7 >>END_MODULE SRR12670949 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670949_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18 37.0 37.0 37.0 37.0 37.0 2 36.1995 37.0 37.0 37.0 37.0 37.0 3 36.2805 37.0 37.0 37.0 37.0 37.0 4 36.256 37.0 37.0 37.0 37.0 37.0 5 36.458 37.0 37.0 37.0 37.0 37.0 6 36.4655 37.0 37.0 37.0 37.0 37.0 7 36.325 37.0 37.0 37.0 37.0 37.0 8 36.4255 37.0 37.0 37.0 37.0 37.0 9 36.4145 37.0 37.0 37.0 37.0 37.0 10-14 36.4409 37.0 37.0 37.0 37.0 37.0 15-19 36.4172 37.0 37.0 37.0 37.0 37.0 20-24 36.46060000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.3531 37.0 37.0 37.0 37.0 37.0 30-34 36.3716 37.0 37.0 37.0 37.0 37.0 35-39 36.360699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.2807 37.0 37.0 37.0 37.0 37.0 45-49 36.3112 37.0 37.0 37.0 37.0 37.0 50-54 36.3085 37.0 37.0 37.0 37.0 37.0 55-59 36.271100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2382 37.0 37.0 37.0 37.0 37.0 65-69 36.2248 37.0 37.0 37.0 37.0 37.0 70-74 36.2322 37.0 37.0 37.0 37.0 37.0 75-79 36.207499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.172900000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1168 37.0 37.0 37.0 37.0 37.0 90-94 36.1265 37.0 37.0 37.0 37.0 37.0 95-99 36.084700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1314 37.0 37.0 37.0 37.0 37.0 105-109 36.0039 37.0 37.0 37.0 37.0 37.0 110-114 36.033899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.974900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.8342 37.0 37.0 37.0 37.0 37.0 125-129 35.7392 37.0 37.0 37.0 37.0 37.0 130-134 35.7359 37.0 37.0 37.0 37.0 37.0 135-139 35.695299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6058 37.0 37.0 37.0 37.0 37.0 145-149 35.396499999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.134249999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 7.0 25 1.0 26 12.0 27 8.0 28 16.0 29 20.0 30 34.0 31 36.0 32 57.0 33 79.0 34 145.0 35 399.0 36 2621.0 37 553.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 24.275 8.0 27.875 2 24.55 26.450000000000003 33.85 15.15 3 18.275 26.150000000000002 35.375 20.200000000000003 4 22.8 34.275 24.275 18.65 5 25.224999999999998 37.625 21.325 15.825 6 20.7 40.1 21.875 17.325 7 20.3 22.55 38.925 18.224999999999998 8 19.425 25.8 30.3 24.474999999999998 9 21.525 24.825 29.775000000000002 23.875 10-14 23.395 30.25 25.974999999999998 20.380000000000003 15-19 22.75 28.754999999999995 27.51 20.985 20-24 22.759999999999998 28.63 28.105000000000004 20.505000000000003 25-29 21.884999999999998 28.625 28.395 21.095 30-34 22.134999999999998 28.575 28.005000000000003 21.285 35-39 22.655 28.470000000000002 27.700000000000003 21.175 40-44 22.125 28.835 28.065 20.974999999999998 45-49 22.6 27.744999999999997 28.54 21.115000000000002 50-54 22.365 28.115000000000002 28.355000000000004 21.165 55-59 22.400000000000002 28.244999999999997 27.935 21.42 60-64 23.244999999999997 28.225 27.665 20.865000000000002 65-69 22.400000000000002 28.389999999999997 28.025 21.185000000000002 70-74 23.255 28.59 27.065 21.09 75-79 22.505 28.42 28.165000000000003 20.91 80-84 22.650000000000002 29.125 27.02 21.205 85-89 22.945 28.48 27.605 20.97 90-94 23.325000000000003 28.73 27.245 20.7 95-99 22.97 28.315 27.88 20.835 100-104 22.84 28.084999999999997 27.474999999999998 21.6 105-109 23.285 28.235 27.43 21.05 110-114 23.68 28.71 27.084999999999997 20.525 115-119 23.724999999999998 28.83 27.750000000000004 19.695 120-124 24.349999999999998 28.439999999999998 27.305 19.905 125-129 24.54 27.49 27.24 20.73 130-134 25.130000000000003 28.43 26.655 19.785 135-139 24.875 28.645 26.924999999999997 19.555 140-144 24.884999999999998 27.985 27.045 20.085 145-149 26.11 27.445000000000004 26.865 19.580000000000002 150-151 26.5375 27.8375 26.8375 18.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.5 11 2.0 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 2.0 20 1.5 21 0.0 22 0.0 23 0.5 24 0.5 25 2.5 26 8.0 27 10.0 28 7.0 29 9.5 30 18.0 31 24.0 32 30.5 33 35.5 34 45.5 35 65.0 36 88.0 37 124.5 38 156.0 39 189.0 40 216.5 41 248.5 42 277.0 43 277.5 44 266.0 45 242.5 46 249.5 47 250.5 48 220.5 49 198.5 50 158.5 51 129.0 52 114.5 53 81.0 54 62.5 55 54.0 56 36.0 57 21.0 58 19.5 59 18.0 60 12.0 61 7.0 62 4.0 63 2.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.62240663900415 81.89999999999999 2 8.326417704011064 15.049999999999999 3 0.8852005532503457 2.4 4 0.13831258644536654 0.5 5 0.0 0.0 6 0.027662517289073305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.1624999999999996 0.0 0.0 0.0 0.0 114-115 3.5250000000000004 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.525 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAAT 10 0.006830828 145.0 1 AATCAAC 10 0.006830828 145.0 5 CAACTGA 10 0.006830828 145.0 8 TCAACTG 10 0.006830828 145.0 7 ATCAACT 10 0.006830828 145.0 6 >>END_MODULE Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716459 spots for SRR12670949.sra Written 716459 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra Read 716458 spots for SRR12670949.sra Written 716458 spots for SRR12670949.sra SRR ids: ['SRR12670949.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yxp8yxyu SRR12670949.sra spots: 14329161 blocks: [[1, 716458], [716459, 1432916], [1432917, 2149374], [2149375, 2865832], [2865833, 3582290], [3582291, 4298748], [4298749, 5015206], [5015207, 5731664], [5731665, 6448122], [6448123, 7164580], [7164581, 7881038], [7881039, 8597496], [8597497, 9313954], [9313955, 10030412], [10030413, 10746870], [10746871, 11463328], [11463329, 12179786], [12179787, 12896244], [12896245, 13612702], [13612703, 14329161]] SRR12670949 file size 4847975 SRR12670949 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670949 SRR12670949_1.fastq SRR12670949_2.fastq Input file: SRR12670949_1.fastq Paired file: SRR12670949_2.fastq trimmed: SRR12670949-trimmed-pair1.fastq, SRR12670949-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:31:10 2025 >> started Tue Feb 11 09:31:30 2025 >> done (20.006s) 14329161 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 760 ( 0.01%) empty read pairs filtered out after trimming by size control 14328306 (99.99%) read pairs available; of these: 1455707 (10.16%) trimmed read pairs available after processing 12872599 (89.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 4 0.00% 21 15 0.00% 22 9 0.00% 23 5 0.00% 24 9 0.00% 25 7 0.00% 26 11 0.00% 27 12 0.00% 28 14 0.00% 29 11 0.00% 30 12 0.00% 31 10 0.00% 32 16 0.00% 33 13 0.00% 34 16 0.00% 35 18 0.00% 36 12 0.00% 37 14 0.00% 38 17 0.00% 39 18 0.00% 40 16 0.00% 41 18 0.00% 42 21 0.00% 43 26 0.00% 44 35 0.00% 45 31 0.00% 46 37 0.00% 47 49 0.00% 48 53 0.00% 49 57 0.00% 50 51 0.00% 51 54 0.00% 52 83 0.00% 53 85 0.00% 54 94 0.00% 55 103 0.00% 56 120 0.00% 57 141 0.00% 58 139 0.00% 59 200 0.00% 60 195 0.00% 61 249 0.00% 62 285 0.00% 63 298 0.00% 64 363 0.00% 65 406 0.00% 66 496 0.00% 67 543 0.00% 68 567 0.00% 69 705 0.00% 70 816 0.01% 71 897 0.01% 72 1008 0.01% 73 1211 0.01% 74 1311 0.01% 75 1509 0.01% 76 1654 0.01% 77 1841 0.01% 78 1903 0.01% 79 2202 0.02% 80 2445 0.02% 81 2616 0.02% 82 3028 0.02% 83 3448 0.02% 84 3621 0.03% 85 4001 0.03% 86 4316 0.03% 87 4461 0.03% 88 4857 0.03% 89 5218 0.04% 90 5616 0.04% 91 5992 0.04% 92 6435 0.04% 93 6629 0.05% 94 7334 0.05% 95 7998 0.06% 96 8442 0.06% 97 8743 0.06% 98 9159 0.06% 99 9518 0.07% 100 9887 0.07% 101 10275 0.07% 102 11094 0.08% 103 11529 0.08% 104 11937 0.08% 105 12836 0.09% 106 13348 0.09% 107 14097 0.10% 108 14298 0.10% 109 14901 0.10% 110 15059 0.11% 111 15767 0.11% 112 16603 0.12% 113 17019 0.12% 114 17474 0.12% 115 18425 0.13% 116 19298 0.13% 117 20128 0.14% 118 20755 0.14% 119 21182 0.15% 120 22042 0.15% 121 22594 0.16% 122 23186 0.16% 123 23679 0.17% 124 24547 0.17% 125 25277 0.18% 126 26473 0.18% 127 27375 0.19% 128 28171 0.20% 129 28640 0.20% 130 29230 0.20% 131 29867 0.21% 132 30196 0.21% 133 30944 0.22% 134 31339 0.22% 135 32314 0.23% 136 33403 0.23% 137 34106 0.24% 138 34814 0.24% 139 36169 0.25% 140 36586 0.26% 141 37564 0.26% 142 38005 0.27% 143 38330 0.27% 144 39541 0.28% 145 40065 0.28% 146 40760 0.28% 147 41545 0.29% 148 42183 0.29% 149 42435 0.30% 150 44416 0.31% 151 12872599 89.84% 14328306 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.45 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=9.27 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.2 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=27 prefix-density=0.58 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=70.60 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=9.3 sequence=AAAAGAAAAGAAAA SRR12670949 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:32:38 Started mapping on | Feb 11 09:32:38 Finished on | Feb 11 09:34:04 Mapping speed, Million of reads per hour | 599.79 Number of input reads | 14328306 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12708622 Uniquely mapped reads % | 88.70% Average mapped length | 293.44 Number of splices: Total | 12769293 Number of splices: Annotated (sjdb) | 12500656 Number of splices: GT/AG | 12526446 Number of splices: GC/AG | 198542 Number of splices: AT/AC | 7589 Number of splices: Non-canonical | 36716 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290202 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 30901 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.94% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1329482 1329482 1329482 N_multimapping 290202 290202 290202 N_noFeature 493560 12550401 543054 N_ambiguous 218897 998 109676 UnstrandedReadsAssigned:11996165 PositiveStrandReadsAssigned:157223 NegativeStrandReadsAssigned:12055892 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR12670949 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670949-trimmed-pair1.fastq SRR12670949-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,328,306 reads, 12,934,515 reads pseudoaligned [quant] estimated average fragment length: 252.512 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR12670949.ke.tsv 34699 SRR12670949.se.tsv 87100 total ==> SRR12670949.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.49 572 23.8613 Potri.005G024800.1.v4.1 1035 783.488 122 11.4746 Potri.004G059700.1.v4.1 961 709.68 17 1.76521 Potri.007G009000.2.v4.1 1416 1164.49 0 0 Potri.003G141000.2.v4.1 2943 2691.49 509 13.9359 Potri.016G087400.1.v4.1 270 86.9211 548 464.584 Potri.015G069301.1.v4.1 564 325.577 0 0 Potri.010G195200.1.v4.1 1773 1521.49 40 1.93732 Potri.012G127500.1.v4.1 977 725.601 184 18.6865 ==> SRR12670949.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 522 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR12670949 completed mapping pipeline successfully