Starting /dee2/code/volunteer_pipeline.sh SRR12670950 current disk space = 3054593019904 free memory = 1507589180 SRR12670950 SRAfilesize 4ec9907ecef16ba69687ce04a837fc57 SRR12670950.sra SRR12670950.sra file validated SRR12670950 is paired end SRR12670950 is conventional basespace SRR12670950 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670950_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43225 37.0 37.0 37.0 37.0 37.0 2 36.4855 37.0 37.0 37.0 37.0 37.0 3 36.5425 37.0 37.0 37.0 37.0 37.0 4 36.631 37.0 37.0 37.0 37.0 37.0 5 36.6855 37.0 37.0 37.0 37.0 37.0 6 36.5755 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.5775 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.613800000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5798 37.0 37.0 37.0 37.0 37.0 20-24 36.5216 37.0 37.0 37.0 37.0 37.0 25-29 36.524800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.464600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4824 37.0 37.0 37.0 37.0 37.0 40-44 36.482600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4382 37.0 37.0 37.0 37.0 37.0 50-54 36.4172 37.0 37.0 37.0 37.0 37.0 55-59 36.367999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.27729999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3095 37.0 37.0 37.0 37.0 37.0 70-74 36.3246 37.0 37.0 37.0 37.0 37.0 75-79 36.2753 37.0 37.0 37.0 37.0 37.0 80-84 36.2624 37.0 37.0 37.0 37.0 37.0 85-89 36.2432 37.0 37.0 37.0 37.0 37.0 90-94 36.210300000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.180499999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2316 37.0 37.0 37.0 37.0 37.0 105-109 36.1558 37.0 37.0 37.0 37.0 37.0 110-114 36.114 37.0 37.0 37.0 37.0 37.0 115-119 36.1194 37.0 37.0 37.0 37.0 37.0 120-124 36.04600000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.051199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.8953 37.0 37.0 37.0 37.0 37.0 135-139 35.91 37.0 37.0 37.0 37.0 37.0 140-144 35.87050000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.7658 37.0 37.0 37.0 37.0 37.0 150-151 35.6075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 4.0 26 6.0 27 8.0 28 12.0 29 26.0 30 34.0 31 46.0 32 64.0 33 74.0 34 108.0 35 237.0 36 2738.0 37 640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.709927481870466 10.37759439859965 6.90172543135784 43.01075268817204 2 17.675 12.075 37.824999999999996 32.425 3 16.575 15.875 29.325000000000003 38.224999999999994 4 22.175 22.6 24.95 30.275000000000002 5 25.174999999999997 28.849999999999998 24.825 21.15 6 18.825 34.2 23.075000000000003 23.9 7 15.55 26.700000000000003 42.075 15.675 8 15.775 24.9 34.225 25.1 9 17.025000000000002 22.925 37.6 22.45 10-14 19.17 29.335 28.13 23.365 15-19 19.365 27.884999999999998 28.17 24.58 20-24 20.119999999999997 28.884999999999998 27.145000000000003 23.849999999999998 25-29 20.27 28.74 27.425 23.565 30-34 19.925 27.925 28.02 24.13 35-39 19.81 28.575 27.755000000000003 23.86 40-44 20.155 27.425 28.485 23.935000000000002 45-49 19.91 28.335 27.845 23.91 50-54 19.785 28.77 27.584999999999997 23.86 55-59 19.955000000000002 27.525 28.76 23.76 60-64 20.105 28.735 27.495000000000005 23.665 65-69 20.055 28.24 27.85 23.855 70-74 20.64 28.59 27.12 23.65 75-79 20.22 28.13 28.15 23.5 80-84 20.585 28.12 27.99 23.305 85-89 20.57 28.09 27.529999999999998 23.810000000000002 90-94 20.23 28.115000000000002 27.935 23.72 95-99 20.435 27.71 28.03 23.825 100-104 21.105 27.735 27.355 23.805 105-109 20.935000000000002 27.54 28.175 23.35 110-114 20.62 28.144999999999996 27.700000000000003 23.535 115-119 20.79 27.544999999999998 27.860000000000003 23.805 120-124 20.349999999999998 28.025 27.13 24.495 125-129 20.39 28.59 27.46 23.56 130-134 20.97 28.305000000000003 26.729999999999997 23.995 135-139 20.724999999999998 28.63 26.825 23.82 140-144 20.1 27.55 28.060000000000002 24.29 145-149 21.05 27.950000000000003 27.33 23.669999999999998 150-151 19.8375 27.450000000000003 28.999999999999996 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 2.5 23 2.0 24 4.0 25 6.5 26 5.0 27 5.0 28 9.5 29 13.0 30 16.0 31 24.5 32 28.5 33 47.5 34 58.5 35 63.0 36 82.5 37 97.0 38 132.0 39 172.5 40 179.5 41 210.0 42 246.5 43 244.5 44 249.5 45 243.5 46 253.5 47 268.5 48 238.0 49 204.0 50 165.5 51 147.5 52 127.0 53 94.5 54 84.5 55 66.0 56 53.0 57 40.0 58 29.0 59 26.5 60 19.5 61 9.0 62 4.5 63 3.0 64 2.0 65 2.5 66 3.0 67 5.0 68 3.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.9316427783903 82.475 2 8.18632855567806 14.85 3 0.6890848952590959 1.875 4 0.11025358324145534 0.4 5 0.05512679162072767 0.25 6 0.027563395810363836 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGTGAGTTCCAGTTCCCTGGGGGGCTTGGAAAAGAGAGTCCACCATAC 6 0.15 No Hit GCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAAGCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCA 10 0.006830828 145.0 7 GGCTCCT 10 0.006830828 145.0 1 >>END_MODULE SRR12670950 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670950_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1955 37.0 37.0 37.0 37.0 37.0 2 36.2755 37.0 37.0 37.0 37.0 37.0 3 36.357 37.0 37.0 37.0 37.0 37.0 4 36.323 37.0 37.0 37.0 37.0 37.0 5 36.412 37.0 37.0 37.0 37.0 37.0 6 36.438 37.0 37.0 37.0 37.0 37.0 7 36.294 37.0 37.0 37.0 37.0 37.0 8 36.389 37.0 37.0 37.0 37.0 37.0 9 36.3695 37.0 37.0 37.0 37.0 37.0 10-14 36.4016 37.0 37.0 37.0 37.0 37.0 15-19 36.3823 37.0 37.0 37.0 37.0 37.0 20-24 36.3679 37.0 37.0 37.0 37.0 37.0 25-29 36.259 37.0 37.0 37.0 37.0 37.0 30-34 36.244600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2338 37.0 37.0 37.0 37.0 37.0 40-44 36.2196 37.0 37.0 37.0 37.0 37.0 45-49 36.2192 37.0 37.0 37.0 37.0 37.0 50-54 36.214999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.21060000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.1907 37.0 37.0 37.0 37.0 37.0 65-69 36.174 37.0 37.0 37.0 37.0 37.0 70-74 36.1993 37.0 37.0 37.0 37.0 37.0 75-79 36.125899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.090700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.052299999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.051 37.0 37.0 37.0 37.0 37.0 95-99 36.056 37.0 37.0 37.0 37.0 37.0 100-104 36.0022 37.0 37.0 37.0 37.0 37.0 105-109 36.0104 37.0 37.0 37.0 37.0 37.0 110-114 36.0157 37.0 37.0 37.0 37.0 37.0 115-119 35.982 37.0 37.0 37.0 37.0 37.0 120-124 35.8677 37.0 37.0 37.0 37.0 37.0 125-129 35.805899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.8223 37.0 37.0 37.0 37.0 37.0 135-139 35.8446 37.0 37.0 37.0 37.0 37.0 140-144 35.781099999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6339 37.0 37.0 37.0 37.0 37.0 150-151 35.317750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 0.0 16 2.0 17 1.0 18 0.0 19 1.0 20 1.0 21 5.0 22 4.0 23 4.0 24 6.0 25 6.0 26 8.0 27 12.0 28 16.0 29 24.0 30 25.0 31 33.0 32 44.0 33 69.0 34 145.0 35 381.0 36 2677.0 37 532.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 22.225 11.825 28.799999999999997 2 27.05 26.625 31.25 15.075 3 19.7 28.000000000000004 33.2 19.1 4 24.65 32.475 23.325000000000003 19.55 5 25.374999999999996 37.125 20.95 16.55 6 19.225 40.625 22.475 17.675 7 20.825 20.825 38.525 19.825 8 20.075000000000003 25.2 29.975 24.75 9 22.650000000000002 24.675 29.75 22.925 10-14 22.919999999999998 28.985 26.845000000000002 21.25 15-19 23.04 28.185 28.16 20.615 20-24 23.115 28.705000000000002 27.305 20.875 25-29 22.95 27.935 28.13 20.985 30-34 22.31 28.310000000000002 28.444999999999997 20.935000000000002 35-39 22.845 27.589999999999996 28.155 21.41 40-44 23.035 27.589999999999996 28.535 20.84 45-49 23.025000000000002 27.905 27.810000000000002 21.26 50-54 23.06 27.965 28.42 20.555 55-59 23.345 28.139999999999997 27.644999999999996 20.87 60-64 22.7 27.55 28.675 21.075 65-69 22.975 27.73 27.97 21.325 70-74 23.555 27.875 27.250000000000004 21.32 75-79 23.01 28.155 27.54 21.295 80-84 23.71 27.939999999999998 27.400000000000002 20.95 85-89 24.07 27.83 26.855 21.245 90-94 23.685000000000002 27.694999999999997 27.185 21.435000000000002 95-99 23.665 27.98 26.790000000000003 21.565 100-104 23.71 28.000000000000004 26.755000000000003 21.535 105-109 23.555 27.865000000000002 28.310000000000002 20.27 110-114 24.25 28.095 27.595 20.06 115-119 23.494999999999997 28.645 27.439999999999998 20.419999999999998 120-124 24.46 28.065 27.045 20.43 125-129 24.54 28.105000000000004 27.18 20.175 130-134 24.03 27.439999999999998 27.744999999999997 20.785 135-139 24.79 27.825 27.13 20.255000000000003 140-144 24.395 28.625 26.805 20.175 145-149 24.94 28.355000000000004 26.479999999999997 20.225 150-151 25.650000000000002 28.0875 26.2875 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 3.0 23 3.0 24 2.0 25 2.5 26 4.5 27 5.0 28 6.5 29 14.5 30 20.0 31 27.0 32 33.0 33 43.0 34 53.0 35 60.5 36 83.5 37 114.5 38 142.0 39 169.5 40 192.0 41 206.5 42 231.0 43 251.5 44 271.5 45 274.5 46 267.0 47 258.0 48 234.0 49 204.5 50 165.0 51 125.0 52 106.0 53 98.5 54 73.5 55 58.0 56 51.0 57 35.0 58 25.5 59 19.5 60 14.5 61 10.5 62 6.0 63 5.0 64 3.0 65 2.5 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81350304371887 82.05 2 8.162700608743775 14.75 3 0.774764803541782 2.1 4 0.16602102933038185 0.6 5 0.02767017155506364 0.125 6 0.02767017155506364 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02767017155506364 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.0875000000000004 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.975 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606097 spots for SRR12670950.sra Written 606097 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra Read 606087 spots for SRR12670950.sra Written 606087 spots for SRR12670950.sra SRR ids: ['SRR12670950.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w77873b7 SRR12670950.sra spots: 12121750 blocks: [[1, 606087], [606088, 1212174], [1212175, 1818261], [1818262, 2424348], [2424349, 3030435], [3030436, 3636522], [3636523, 4242609], [4242610, 4848696], [4848697, 5454783], [5454784, 6060870], [6060871, 6666957], [6666958, 7273044], [7273045, 7879131], [7879132, 8485218], [8485219, 9091305], [9091306, 9697392], [9697393, 10303479], [10303480, 10909566], [10909567, 11515653], [11515654, 12121750]] SRR12670950 file size 4097800 SRR12670950 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670950 SRR12670950_1.fastq SRR12670950_2.fastq Input file: SRR12670950_1.fastq Paired file: SRR12670950_2.fastq trimmed: SRR12670950-trimmed-pair1.fastq, SRR12670950-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:38:58 2025 >> started Tue Feb 11 09:39:13 2025 >> done (15.021s) 12121750 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 39235 ( 0.32%) empty read pairs filtered out after trimming by size control 12082484 (99.68%) read pairs available; of these: 623765 ( 5.16%) trimmed read pairs available after processing 11458719 (94.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 11 0.00% 24 3 0.00% 25 4 0.00% 26 3 0.00% 27 2 0.00% 28 6 0.00% 29 9 0.00% 30 4 0.00% 31 5 0.00% 32 9 0.00% 33 3 0.00% 34 10 0.00% 35 5 0.00% 36 5 0.00% 37 9 0.00% 38 6 0.00% 39 13 0.00% 40 14 0.00% 41 22 0.00% 42 13 0.00% 43 15 0.00% 44 13 0.00% 45 11 0.00% 46 11 0.00% 47 19 0.00% 48 19 0.00% 49 17 0.00% 50 30 0.00% 51 23 0.00% 52 44 0.00% 53 27 0.00% 54 41 0.00% 55 48 0.00% 56 58 0.00% 57 64 0.00% 58 48 0.00% 59 69 0.00% 60 62 0.00% 61 95 0.00% 62 99 0.00% 63 95 0.00% 64 112 0.00% 65 116 0.00% 66 119 0.00% 67 135 0.00% 68 144 0.00% 69 194 0.00% 70 206 0.00% 71 228 0.00% 72 272 0.00% 73 355 0.00% 74 334 0.00% 75 384 0.00% 76 418 0.00% 77 482 0.00% 78 566 0.00% 79 565 0.00% 80 613 0.01% 81 756 0.01% 82 817 0.01% 83 898 0.01% 84 1013 0.01% 85 1141 0.01% 86 1274 0.01% 87 1369 0.01% 88 1493 0.01% 89 1476 0.01% 90 1706 0.01% 91 1910 0.02% 92 1958 0.02% 93 2183 0.02% 94 2400 0.02% 95 2607 0.02% 96 2880 0.02% 97 3071 0.03% 98 3152 0.03% 99 3354 0.03% 100 3515 0.03% 101 3592 0.03% 102 4017 0.03% 103 4131 0.03% 104 4347 0.04% 105 4626 0.04% 106 4938 0.04% 107 5110 0.04% 108 5321 0.04% 109 5762 0.05% 110 5930 0.05% 111 6193 0.05% 112 6358 0.05% 113 6526 0.05% 114 6958 0.06% 115 7414 0.06% 116 7762 0.06% 117 8083 0.07% 118 8427 0.07% 119 8649 0.07% 120 9207 0.08% 121 9130 0.08% 122 9625 0.08% 123 10058 0.08% 124 10303 0.09% 125 10529 0.09% 126 11168 0.09% 127 11367 0.09% 128 11930 0.10% 129 12320 0.10% 130 12634 0.10% 131 12965 0.11% 132 13476 0.11% 133 13689 0.11% 134 14063 0.12% 135 14289 0.12% 136 14922 0.12% 137 15788 0.13% 138 15876 0.13% 139 16998 0.14% 140 17109 0.14% 141 17498 0.14% 142 18052 0.15% 143 18182 0.15% 144 18680 0.15% 145 19423 0.16% 146 19863 0.16% 147 20330 0.17% 148 21226 0.18% 149 21239 0.18% 150 22391 0.19% 151 11458719 94.84% 12082484 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=591.68 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.18 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=1.21 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=41.02 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCAAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAG SRR12670950 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:39:59 Started mapping on | Feb 11 09:39:59 Finished on | Feb 11 09:41:27 Mapping speed, Million of reads per hour | 494.28 Number of input reads | 12082484 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11363314 Uniquely mapped reads % | 94.05% Average mapped length | 298.42 Number of splices: Total | 11394464 Number of splices: Annotated (sjdb) | 11162329 Number of splices: GT/AG | 11170898 Number of splices: GC/AG | 180657 Number of splices: AT/AC | 7271 Number of splices: Non-canonical | 35638 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288355 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 57520 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430815 430815 430815 N_multimapping 288355 288355 288355 N_noFeature 421591 11140222 482888 N_ambiguous 238802 782 76500 UnstrandedReadsAssigned:10702921 PositiveStrandReadsAssigned:222310 NegativeStrandReadsAssigned:10803926 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670950 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670950-trimmed-pair1.fastq SRR12670950-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,082,484 reads, 10,731,402 reads pseudoaligned [quant] estimated average fragment length: 278.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR12670950.ke.tsv 34699 SRR12670950.se.tsv 87100 total ==> SRR12670950.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.16 458 18.2641 Potri.005G024800.1.v4.1 1035 757.158 282 25.8455 Potri.004G059700.1.v4.1 961 683.32 0 0 Potri.007G009000.2.v4.1 1416 1138.16 0 0 Potri.003G141000.2.v4.1 2943 2665.16 732.57 19.0743 Potri.016G087400.1.v4.1 270 71.4254 471 457.605 Potri.015G069301.1.v4.1 564 299.535 0 0 Potri.010G195200.1.v4.1 1773 1495.16 153.911 7.1434 Potri.012G127500.1.v4.1 977 699.246 74 7.34385 ==> SRR12670950.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670950 completed mapping pipeline successfully