Starting /dee2/code/volunteer_pipeline.sh SRR12670951 current disk space = 3054995779584 free memory = 1471007152 SRR12670951 SRAfilesize 1b2f7bfbe31e614294e21e0926a078e6 SRR12670951.sra SRR12670951.sra file validated SRR12670951 is paired end SRR12670951 is conventional basespace SRR12670951 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670951_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46675 37.0 37.0 37.0 37.0 37.0 2 36.306 37.0 37.0 37.0 37.0 37.0 3 36.5655 37.0 37.0 37.0 37.0 37.0 4 36.613 37.0 37.0 37.0 37.0 37.0 5 36.616 37.0 37.0 37.0 37.0 37.0 6 36.6135 37.0 37.0 37.0 37.0 37.0 7 36.5775 37.0 37.0 37.0 37.0 37.0 8 36.623 37.0 37.0 37.0 37.0 37.0 9 36.552 37.0 37.0 37.0 37.0 37.0 10-14 36.6221 37.0 37.0 37.0 37.0 37.0 15-19 36.6209 37.0 37.0 37.0 37.0 37.0 20-24 36.5355 37.0 37.0 37.0 37.0 37.0 25-29 36.5001 37.0 37.0 37.0 37.0 37.0 30-34 36.479 37.0 37.0 37.0 37.0 37.0 35-39 36.4653 37.0 37.0 37.0 37.0 37.0 40-44 36.485800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.440799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4089 37.0 37.0 37.0 37.0 37.0 55-59 36.3929 37.0 37.0 37.0 37.0 37.0 60-64 36.3586 37.0 37.0 37.0 37.0 37.0 65-69 36.338300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.36129999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.2932 37.0 37.0 37.0 37.0 37.0 80-84 36.266299999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2323 37.0 37.0 37.0 37.0 37.0 90-94 36.234500000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2028 37.0 37.0 37.0 37.0 37.0 100-104 36.175399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0969 37.0 37.0 37.0 37.0 37.0 110-114 36.14639999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.072900000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0375 37.0 37.0 37.0 37.0 37.0 125-129 35.9778 37.0 37.0 37.0 37.0 37.0 130-134 35.878 37.0 37.0 37.0 37.0 37.0 135-139 35.9159 37.0 37.0 37.0 37.0 37.0 140-144 35.818200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7258 37.0 37.0 37.0 37.0 37.0 150-151 35.53075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 0.0 24 3.0 25 7.0 26 7.0 27 8.0 28 16.0 29 15.0 30 25.0 31 49.0 32 50.0 33 76.0 34 134.0 35 259.0 36 2692.0 37 657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.91097774443611 10.352588147036759 6.001500375093773 39.73493373343336 2 19.55 11.65 37.4 31.4 3 17.65 15.0 27.575 39.775 4 21.75 22.575 24.55 31.125000000000004 5 23.7 29.575000000000003 25.025 21.7 6 19.275000000000002 33.625 23.0 24.099999999999998 7 15.85 26.924999999999997 39.975 17.25 8 16.525000000000002 26.275 32.9 24.3 9 17.8 25.374999999999996 34.175 22.650000000000002 10-14 19.3 29.98 27.950000000000003 22.770000000000003 15-19 19.314999999999998 28.07 28.48 24.135 20-24 19.975 27.875 28.335 23.815 25-29 19.29 28.16 28.49 24.060000000000002 30-34 19.825 28.03 28.005000000000003 24.14 35-39 20.315 28.134999999999998 27.839999999999996 23.71 40-44 19.689999999999998 28.425 28.215 23.669999999999998 45-49 19.580000000000002 28.77 27.465 24.185000000000002 50-54 20.76 27.76 27.825 23.655 55-59 19.805 28.610000000000003 27.42 24.165 60-64 20.175 28.275 27.985 23.565 65-69 19.805 28.335 28.625 23.235 70-74 20.16 28.075 27.57 24.195 75-79 20.07 28.08 27.245 24.605 80-84 20.06 28.065 28.244999999999997 23.630000000000003 85-89 20.255000000000003 28.444999999999997 27.950000000000003 23.35 90-94 20.46 28.435 27.505000000000003 23.599999999999998 95-99 20.26 28.71 27.36 23.669999999999998 100-104 19.794999999999998 28.01 28.625 23.57 105-109 20.244999999999997 28.705000000000002 27.700000000000003 23.35 110-114 20.635 27.875 27.865000000000002 23.625 115-119 20.665 27.97 28.16 23.205000000000002 120-124 20.305 28.265 27.810000000000002 23.62 125-129 20.885 28.265 27.875 22.975 130-134 21.044999999999998 28.294999999999998 26.865 23.794999999999998 135-139 20.875 28.655 27.060000000000002 23.41 140-144 21.13 28.349999999999998 27.54 22.98 145-149 21.055 28.139999999999997 26.88 23.925 150-151 20.2875 28.525 26.950000000000003 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 2.5 23 3.5 24 4.5 25 7.5 26 9.0 27 7.5 28 10.0 29 13.5 30 16.0 31 27.5 32 36.0 33 35.5 34 45.5 35 69.0 36 95.5 37 106.0 38 116.5 39 148.5 40 177.5 41 208.0 42 227.0 43 250.5 44 284.0 45 273.0 46 258.5 47 256.0 48 223.0 49 203.5 50 194.5 51 152.5 52 107.0 53 87.0 54 74.0 55 62.0 56 51.5 57 35.0 58 26.0 59 30.0 60 24.5 61 11.0 62 7.0 63 4.0 64 3.0 65 4.5 66 3.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.5846994535519 83.8 2 7.6229508196721305 13.950000000000001 3 0.7103825136612022 1.95 4 0.08196721311475409 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 4.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670951 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670951_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1465 37.0 37.0 37.0 37.0 37.0 2 36.3225 37.0 37.0 37.0 37.0 37.0 3 36.2565 37.0 37.0 37.0 37.0 37.0 4 36.245 37.0 37.0 37.0 37.0 37.0 5 36.404 37.0 37.0 37.0 37.0 37.0 6 36.388 37.0 37.0 37.0 37.0 37.0 7 36.3715 37.0 37.0 37.0 37.0 37.0 8 36.437 37.0 37.0 37.0 37.0 37.0 9 36.4495 37.0 37.0 37.0 37.0 37.0 10-14 36.482099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4539 37.0 37.0 37.0 37.0 37.0 20-24 36.3942 37.0 37.0 37.0 37.0 37.0 25-29 36.358999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.339600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2921 37.0 37.0 37.0 37.0 37.0 40-44 36.2756 37.0 37.0 37.0 37.0 37.0 45-49 36.2927 37.0 37.0 37.0 37.0 37.0 50-54 36.2579 37.0 37.0 37.0 37.0 37.0 55-59 36.243700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1824 37.0 37.0 37.0 37.0 37.0 65-69 36.1883 37.0 37.0 37.0 37.0 37.0 70-74 36.1872 37.0 37.0 37.0 37.0 37.0 75-79 36.1313 37.0 37.0 37.0 37.0 37.0 80-84 36.089 37.0 37.0 37.0 37.0 37.0 85-89 36.0269 37.0 37.0 37.0 37.0 37.0 90-94 36.050799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.0256 37.0 37.0 37.0 37.0 37.0 100-104 36.0277 37.0 37.0 37.0 37.0 37.0 105-109 35.9231 37.0 37.0 37.0 37.0 37.0 110-114 35.970299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.933 37.0 37.0 37.0 37.0 37.0 120-124 35.8342 37.0 37.0 37.0 37.0 37.0 125-129 35.7926 37.0 37.0 37.0 37.0 37.0 130-134 35.8061 37.0 37.0 37.0 37.0 37.0 135-139 35.7539 37.0 37.0 37.0 37.0 37.0 140-144 35.743500000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5344 37.0 37.0 37.0 37.0 37.0 150-151 35.157250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 3.0 17 0.0 18 1.0 19 1.0 20 0.0 21 3.0 22 3.0 23 3.0 24 6.0 25 7.0 26 11.0 27 12.0 28 14.0 29 15.0 30 18.0 31 42.0 32 48.0 33 101.0 34 159.0 35 377.0 36 2618.0 37 556.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 24.5 9.675 26.950000000000003 2 26.125 25.674999999999997 32.025 16.175 3 20.5 27.375 32.675 19.45 4 23.025000000000002 34.449999999999996 23.425 19.1 5 24.7 37.35 21.9 16.05 6 19.900000000000002 39.525 23.65 16.925 7 20.1 23.45 37.45 19.0 8 19.15 26.325 28.975 25.55 9 21.475 24.55 31.7 22.275 10-14 22.98 29.49 26.779999999999998 20.75 15-19 22.455 29.425 27.42 20.7 20-24 22.575 28.76 27.68 20.985 25-29 22.46 28.1 27.71 21.73 30-34 22.255 28.535 28.215 20.995 35-39 22.395 28.765 27.47 21.37 40-44 22.725 28.03 28.16 21.085 45-49 22.400000000000002 27.98 28.21 21.41 50-54 22.575 28.04 28.21 21.175 55-59 23.03 28.415000000000003 27.22 21.335 60-64 22.785 27.88 27.975 21.36 65-69 23.165 27.544999999999998 28.54 20.75 70-74 22.855 28.244999999999997 27.235 21.665 75-79 22.88 27.83 28.065 21.224999999999998 80-84 23.375 28.345 26.91 21.37 85-89 22.545 28.485 27.744999999999997 21.224999999999998 90-94 22.875 28.565 27.639999999999997 20.919999999999998 95-99 23.465 27.485 27.884999999999998 21.165 100-104 24.165 28.235 27.16 20.44 105-109 23.544999999999998 28.525 27.43 20.5 110-114 23.665 27.88 27.67 20.785 115-119 23.669999999999998 28.665000000000003 26.965 20.7 120-124 24.065 28.549999999999997 27.229999999999997 20.155 125-129 23.674999999999997 29.24 26.400000000000002 20.685000000000002 130-134 24.72 28.24 27.1 19.939999999999998 135-139 24.005000000000003 28.255000000000003 27.295 20.445 140-144 24.41 28.4 27.169999999999998 20.02 145-149 25.590000000000003 28.105000000000004 26.755000000000003 19.55 150-151 26.6 28.65 25.650000000000002 19.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 2.0 23 2.5 24 3.0 25 4.0 26 3.5 27 11.0 28 13.5 29 11.0 30 15.0 31 15.0 32 24.5 33 48.0 34 61.5 35 67.0 36 88.5 37 113.0 38 141.0 39 162.0 40 198.5 41 235.0 42 248.0 43 266.0 44 274.0 45 277.5 46 275.5 47 253.0 48 216.0 49 173.0 50 157.5 51 144.5 52 104.5 53 77.5 54 66.0 55 56.0 56 42.5 57 37.5 58 26.5 59 16.5 60 15.5 61 13.5 62 9.0 63 6.0 64 4.5 65 2.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.41289437585733 83.3 2 7.626886145404664 13.900000000000002 3 0.823045267489712 2.25 4 0.10973936899862827 0.4 5 0.0 0.0 6 0.027434842249657067 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAACG 10 0.006830828 145.0 3 AAAAAAA 45 6.5511256E-4 19.333332 65-69 >>END_MODULE Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra Read 596257 spots for SRR12670951.sra Written 596257 spots for SRR12670951.sra Read 596252 spots for SRR12670951.sra Written 596252 spots for SRR12670951.sra SRR ids: ['SRR12670951.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wywpjcwc SRR12670951.sra spots: 11925045 blocks: [[1, 596252], [596253, 1192504], [1192505, 1788756], [1788757, 2385008], [2385009, 2981260], [2981261, 3577512], [3577513, 4173764], [4173765, 4770016], [4770017, 5366268], [5366269, 5962520], [5962521, 6558772], [6558773, 7155024], [7155025, 7751276], [7751277, 8347528], [8347529, 8943780], [8943781, 9540032], [9540033, 10136284], [10136285, 10732536], [10732537, 11328788], [11328789, 11925045]] SRR12670951 file size 4030951 SRR12670951 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670951 SRR12670951_1.fastq SRR12670951_2.fastq Input file: SRR12670951_1.fastq Paired file: SRR12670951_2.fastq trimmed: SRR12670951-trimmed-pair1.fastq, SRR12670951-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:22:48 2025 >> started Tue Feb 11 09:23:02 2025 >> done (13.463s) 11925045 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 1878 ( 0.02%) empty read pairs filtered out after trimming by size control 11923109 (99.98%) read pairs available; of these: 925018 ( 7.76%) trimmed read pairs available after processing 10998091 (92.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 7 0.00% 24 6 0.00% 25 3 0.00% 26 10 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 10 0.00% 31 5 0.00% 32 6 0.00% 33 17 0.00% 34 9 0.00% 35 13 0.00% 36 15 0.00% 37 10 0.00% 38 9 0.00% 39 8 0.00% 40 12 0.00% 41 19 0.00% 42 20 0.00% 43 19 0.00% 44 28 0.00% 45 31 0.00% 46 21 0.00% 47 22 0.00% 48 25 0.00% 49 25 0.00% 50 35 0.00% 51 50 0.00% 52 54 0.00% 53 63 0.00% 54 56 0.00% 55 70 0.00% 56 79 0.00% 57 80 0.00% 58 85 0.00% 59 143 0.00% 60 124 0.00% 61 168 0.00% 62 193 0.00% 63 245 0.00% 64 215 0.00% 65 236 0.00% 66 278 0.00% 67 330 0.00% 68 391 0.00% 69 421 0.00% 70 489 0.00% 71 547 0.00% 72 674 0.01% 73 782 0.01% 74 812 0.01% 75 937 0.01% 76 1025 0.01% 77 1213 0.01% 78 1219 0.01% 79 1369 0.01% 80 1452 0.01% 81 1610 0.01% 82 1914 0.02% 83 2030 0.02% 84 2277 0.02% 85 2500 0.02% 86 2666 0.02% 87 2797 0.02% 88 3237 0.03% 89 3138 0.03% 90 3533 0.03% 91 3732 0.03% 92 3997 0.03% 93 4325 0.04% 94 4735 0.04% 95 4960 0.04% 96 5234 0.04% 97 5571 0.05% 98 5607 0.05% 99 5977 0.05% 100 6458 0.05% 101 6403 0.05% 102 6896 0.06% 103 7121 0.06% 104 7550 0.06% 105 7968 0.07% 106 8482 0.07% 107 8634 0.07% 108 9141 0.08% 109 9334 0.08% 110 9509 0.08% 111 9950 0.08% 112 10305 0.09% 113 10513 0.09% 114 10948 0.09% 115 11527 0.10% 116 12007 0.10% 117 12584 0.11% 118 13044 0.11% 119 13298 0.11% 120 13837 0.12% 121 14416 0.12% 122 14541 0.12% 123 14876 0.12% 124 15505 0.13% 125 15831 0.13% 126 16732 0.14% 127 17074 0.14% 128 17666 0.15% 129 18047 0.15% 130 18601 0.16% 131 18856 0.16% 132 19189 0.16% 133 19792 0.17% 134 20057 0.17% 135 20568 0.17% 136 21229 0.18% 137 21249 0.18% 138 21931 0.18% 139 23317 0.20% 140 23326 0.20% 141 24029 0.20% 142 24439 0.20% 143 24812 0.21% 144 25534 0.21% 145 25948 0.22% 146 26451 0.22% 147 26682 0.22% 148 27711 0.23% 149 28179 0.24% 150 28860 0.24% 151 10998091 92.24% 11923109 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=32.51 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.0 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=27 prefix-density=0.83 prefix-fanout=2.1 sequence=GCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=66.45 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=8.9 sequence=AAAAGAAAAGAAAA SRR12670951 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:23:47 Started mapping on | Feb 11 09:23:47 Finished on | Feb 11 09:25:17 Mapping speed, Million of reads per hour | 476.92 Number of input reads | 11923109 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11175873 Uniquely mapped reads % | 93.73% Average mapped length | 296.89 Number of splices: Total | 11143161 Number of splices: Annotated (sjdb) | 10898768 Number of splices: GT/AG | 10923095 Number of splices: GC/AG | 179126 Number of splices: AT/AC | 6553 Number of splices: Non-canonical | 34387 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281831 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 35591 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465405 465405 465405 N_multimapping 281831 281831 281831 N_noFeature 430671 11033114 478725 N_ambiguous 174296 613 79285 UnstrandedReadsAssigned:10570906 PositiveStrandReadsAssigned:142146 NegativeStrandReadsAssigned:10617863 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670951 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670951-trimmed-pair1.fastq SRR12670951-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,923,109 reads, 10,616,275 reads pseudoaligned [quant] estimated average fragment length: 271.268 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR12670951.ke.tsv 34699 SRR12670951.se.tsv 87100 total ==> SRR12670951.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.73 405 20.3739 Potri.005G024800.1.v4.1 1035 764.732 190 21.8443 Potri.004G059700.1.v4.1 961 690.97 0 0 Potri.007G009000.2.v4.1 1416 1145.73 0 0 Potri.003G141000.2.v4.1 2943 2672.73 510.371 16.789 Potri.016G087400.1.v4.1 270 78.936 392 436.621 Potri.015G069301.1.v4.1 564 308.607 0 0 Potri.010G195200.1.v4.1 1773 1502.73 50 2.92538 Potri.012G127500.1.v4.1 977 706.83 25 3.1097 ==> SRR12670951.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 124 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12670951 completed mapping pipeline successfully