Starting /dee2/code/volunteer_pipeline.sh SRR12670952 current disk space = 3054927859712 free memory = 1471248916 SRR12670952 SRAfilesize 0765187fcebaeb04915d64dcad16603c SRR12670952.sra SRR12670952.sra file validated SRR12670952 is paired end SRR12670952 is conventional basespace SRR12670952 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670952_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43525 37.0 37.0 37.0 37.0 37.0 2 36.4135 37.0 37.0 37.0 37.0 37.0 3 36.4755 37.0 37.0 37.0 37.0 37.0 4 36.609 37.0 37.0 37.0 37.0 37.0 5 36.6615 37.0 37.0 37.0 37.0 37.0 6 36.626 37.0 37.0 37.0 37.0 37.0 7 36.543 37.0 37.0 37.0 37.0 37.0 8 36.5125 37.0 37.0 37.0 37.0 37.0 9 36.533 37.0 37.0 37.0 37.0 37.0 10-14 36.5866 37.0 37.0 37.0 37.0 37.0 15-19 36.571 37.0 37.0 37.0 37.0 37.0 20-24 36.5175 37.0 37.0 37.0 37.0 37.0 25-29 36.4408 37.0 37.0 37.0 37.0 37.0 30-34 36.390499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.423199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3634 37.0 37.0 37.0 37.0 37.0 45-49 36.2716 37.0 37.0 37.0 37.0 37.0 50-54 36.302200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1887 37.0 37.0 37.0 37.0 37.0 60-64 36.1611 37.0 37.0 37.0 37.0 37.0 65-69 36.1586 37.0 37.0 37.0 37.0 37.0 70-74 36.1754 37.0 37.0 37.0 37.0 37.0 75-79 36.1679 37.0 37.0 37.0 37.0 37.0 80-84 36.124700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.063900000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.058800000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.0581 37.0 37.0 37.0 37.0 37.0 100-104 36.064600000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.0013 37.0 37.0 37.0 37.0 37.0 110-114 35.9904 37.0 37.0 37.0 37.0 37.0 115-119 35.9825 37.0 37.0 37.0 37.0 37.0 120-124 35.9139 37.0 37.0 37.0 37.0 37.0 125-129 35.8733 37.0 37.0 37.0 37.0 37.0 130-134 35.792699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.7239 37.0 37.0 37.0 37.0 37.0 140-144 35.59779999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.60295000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.292500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 2.0 21 6.0 22 8.0 23 6.0 24 1.0 25 5.0 26 2.0 27 15.0 28 22.0 29 27.0 30 37.0 31 48.0 32 58.0 33 78.0 34 144.0 35 230.0 36 2632.0 37 677.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.91147786946736 13.053263315828959 7.1267816954238565 33.908477119279816 2 20.3 10.875 37.65 31.175000000000004 3 16.45 15.925 29.45 38.175 4 21.45 21.4 25.374999999999996 31.775 5 21.7 30.3 24.85 23.150000000000002 6 21.375 33.725 23.849999999999998 21.05 7 15.65 28.475 39.6 16.275000000000002 8 15.5 28.15 33.75 22.6 9 16.825000000000003 24.25 35.949999999999996 22.975 10-14 19.255 31.055 28.03 21.66 15-19 19.005 29.095 28.360000000000003 23.54 20-24 19.8 29.044999999999998 28.189999999999998 22.965 25-29 19.855 29.81 27.589999999999996 22.745 30-34 19.875 29.53 27.785 22.81 35-39 19.735 28.585 27.625 24.055 40-44 19.99 29.025000000000002 28.065 22.919999999999998 45-49 19.68 29.165000000000003 27.985 23.169999999999998 50-54 20.555 29.205 27.42 22.82 55-59 19.375 28.825 28.29 23.51 60-64 19.855 29.175 27.6 23.369999999999997 65-69 19.415 28.89 28.595 23.1 70-74 20.794999999999998 29.459999999999997 26.55 23.195 75-79 20.630000000000003 28.470000000000002 27.565 23.335 80-84 20.555 28.249999999999996 27.584999999999997 23.61 85-89 20.025000000000002 28.965000000000003 27.175 23.835 90-94 20.815 28.235 27.395000000000003 23.555 95-99 20.150000000000002 28.349999999999998 27.384999999999998 24.115000000000002 100-104 20.419999999999998 28.935 26.700000000000003 23.945 105-109 20.66 28.33 27.505000000000003 23.505000000000003 110-114 20.75 28.199999999999996 27.63 23.419999999999998 115-119 21.240000000000002 27.63 27.72 23.41 120-124 20.86 27.800000000000004 27.334999999999997 24.005000000000003 125-129 20.91 27.839999999999996 27.24 24.01 130-134 20.995 27.845 27.08 24.08 135-139 21.445 27.639999999999997 26.665 24.25 140-144 21.265 27.775 26.86 24.099999999999998 145-149 20.89813472020803 28.34425163774566 26.964044606691 23.793569035355304 150-151 20.3375 28.225 26.450000000000003 24.9875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 1.0 5 1.5 6 1.5 7 2.0 8 1.5 9 1.5 10 2.0 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.0 19 0.5 20 1.0 21 2.5 22 3.0 23 4.0 24 3.0 25 4.5 26 7.5 27 13.5 28 19.0 29 21.0 30 23.0 31 33.0 32 53.0 33 67.5 34 69.5 35 88.5 36 106.0 37 104.0 38 123.0 39 160.5 40 186.0 41 200.5 42 215.0 43 238.0 44 255.0 45 227.0 46 214.0 47 229.0 48 209.5 49 207.0 50 203.5 51 149.0 52 117.5 53 100.5 54 79.5 55 66.5 56 45.5 57 29.5 58 20.5 59 18.5 60 16.0 61 10.5 62 8.0 63 5.5 64 4.5 65 5.5 66 4.5 67 2.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.59639389736476 81.65 2 8.210818307905686 14.799999999999999 3 0.9986130374479889 2.7 4 0.13869625520110956 0.5 5 0.0 0.0 6 0.027739251040221912 0.15 7 0.0 0.0 8 0.027739251040221912 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCTCCTAATCTCGTAT 6 0.15 TruSeq Adapter, Index 14 (97% over 39bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.8625000000000003 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.987500000000001 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.8875 0.0 0.0 0.0 0.0 136-137 6.362500000000001 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAATCC 10 0.006830828 145.0 8 ATAGACA 10 0.006830828 145.0 6 >>END_MODULE SRR12670952 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670952_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1235 37.0 37.0 37.0 37.0 37.0 2 36.2495 37.0 37.0 37.0 37.0 37.0 3 36.3025 37.0 37.0 37.0 37.0 37.0 4 36.2925 37.0 37.0 37.0 37.0 37.0 5 36.4435 37.0 37.0 37.0 37.0 37.0 6 36.393 37.0 37.0 37.0 37.0 37.0 7 36.378 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.4245 37.0 37.0 37.0 37.0 37.0 10-14 36.3753 37.0 37.0 37.0 37.0 37.0 15-19 36.3103 37.0 37.0 37.0 37.0 37.0 20-24 36.30499999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.202200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1921 37.0 37.0 37.0 37.0 37.0 35-39 36.1228 37.0 37.0 37.0 37.0 37.0 40-44 36.1024 37.0 37.0 37.0 37.0 37.0 45-49 36.100500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0938 37.0 37.0 37.0 37.0 37.0 55-59 36.0552 37.0 37.0 37.0 37.0 37.0 60-64 36.079499999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0731 37.0 37.0 37.0 37.0 37.0 70-74 36.0153 37.0 37.0 37.0 37.0 37.0 75-79 35.9542 37.0 37.0 37.0 37.0 37.0 80-84 36.0004 37.0 37.0 37.0 37.0 37.0 85-89 35.994600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.954499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.97279999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9541 37.0 37.0 37.0 37.0 37.0 105-109 35.9575 37.0 37.0 37.0 37.0 37.0 110-114 35.885400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8778 37.0 37.0 37.0 37.0 37.0 120-124 35.8112 37.0 37.0 37.0 37.0 37.0 125-129 35.7145 37.0 37.0 37.0 37.0 37.0 130-134 35.6706 37.0 37.0 37.0 37.0 37.0 135-139 35.643499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5468 37.0 37.0 37.0 37.0 37.0 145-149 35.3605 37.0 37.0 37.0 37.0 37.0 150-151 35.056 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 6.0 14 11.0 15 6.0 16 2.0 17 3.0 18 3.0 19 2.0 20 5.0 21 3.0 22 2.0 23 10.0 24 2.0 25 12.0 26 7.0 27 11.0 28 18.0 29 17.0 30 26.0 31 29.0 32 42.0 33 67.0 34 132.0 35 309.0 36 2616.0 37 656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.25 26.05 7.8 21.9 2 30.0 25.0 28.749999999999996 16.25 3 21.6 27.025 33.375 18.0 4 25.650000000000002 33.0 22.925 18.425 5 28.449999999999996 34.975 20.724999999999998 15.85 6 21.075 39.6 20.825 18.5 7 22.25 23.05 36.875 17.825 8 22.400000000000002 26.125 27.275 24.2 9 23.325000000000003 24.375 28.799999999999997 23.5 10-14 24.62 29.005 26.5 19.875 15-19 25.135 27.485 26.41 20.97 20-24 24.345 28.65 26.229999999999997 20.775 25-29 24.81 28.775000000000002 26.229999999999997 20.185 30-34 25.165 27.715 26.77 20.349999999999998 35-39 24.2 28.444999999999997 26.950000000000003 20.405 40-44 24.7 27.68 27.450000000000003 20.169999999999998 45-49 23.925 28.155 27.529999999999998 20.39 50-54 24.895 27.889999999999997 26.924999999999997 20.29 55-59 23.87 27.810000000000002 27.279999999999998 21.04 60-64 23.97 27.744999999999997 27.415 20.87 65-69 24.22 27.905 27.185 20.69 70-74 24.425 26.974999999999998 27.99 20.61 75-79 23.7 28.134999999999998 27.33 20.835 80-84 24.154999999999998 28.865000000000002 26.76 20.22 85-89 24.33 29.15 26.669999999999998 19.85 90-94 24.245 27.98 27.189999999999998 20.585 95-99 24.33 28.645 27.11 19.915 100-104 24.67 28.349999999999998 26.69 20.29 105-109 24.47 28.08 26.645000000000003 20.805 110-114 24.125 28.165000000000003 27.134999999999998 20.575 115-119 24.607460746074608 28.28782878287829 27.16771677167717 19.936993699369935 120-124 24.5 28.185 27.345000000000002 19.97 125-129 25.019999999999996 28.43 27.105 19.445 130-134 25.235000000000003 28.17 26.46 20.135 135-139 25.119999999999997 28.03 27.47 19.38 140-144 24.942494249424943 27.87778777877788 27.422742274227424 19.756975697569757 145-149 25.855 28.205000000000002 26.325 19.615 150-151 26.150000000000002 27.5875 27.200000000000003 19.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.5 9 1.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 4.5 26 4.5 27 1.5 28 2.0 29 4.5 30 9.0 31 15.0 32 22.0 33 30.5 34 47.0 35 61.5 36 77.0 37 92.0 38 107.5 39 150.5 40 177.0 41 208.0 42 229.5 43 250.5 44 294.0 45 288.0 46 273.5 47 263.5 48 238.0 49 214.0 50 181.0 51 147.5 52 117.0 53 100.5 54 90.5 55 65.5 56 48.0 57 34.0 58 23.5 59 20.5 60 18.5 61 14.0 62 8.5 63 7.0 64 6.0 65 2.5 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 1.5 72 1.5 73 0.5 74 0.5 75 2.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 1.0 96 1.5 97 0.5 98 0.5 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.50791007493754 81.525 2 8.381903968914793 15.1 3 0.9159034138218152 2.475 4 0.13877324451845685 0.5 5 0.02775464890369137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02775464890369137 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GTTAGCACCAATGCTGATGGTGGATATGATGGAAATGCTGGGTTGGGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.275 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAGTC 10 0.006830828 145.0 9 >>END_MODULE Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Read 646787 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra Written 646787 spots for SRR12670952.sra Read 646778 spots for SRR12670952.sra Written 646778 spots for SRR12670952.sra SRR ids: ['SRR12670952.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ur5dcue9 SRR12670952.sra spots: 12935569 blocks: [[1, 646778], [646779, 1293556], [1293557, 1940334], [1940335, 2587112], [2587113, 3233890], [3233891, 3880668], [3880669, 4527446], [4527447, 5174224], [5174225, 5821002], [5821003, 6467780], [6467781, 7114558], [7114559, 7761336], [7761337, 8408114], [8408115, 9054892], [9054893, 9701670], [9701671, 10348448], [10348449, 10995226], [10995227, 11642004], [11642005, 12288782], [12288783, 12935569]] SRR12670952 file size 4374371 SRR12670952 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670952 SRR12670952_1.fastq SRR12670952_2.fastq Input file: SRR12670952_1.fastq Paired file: SRR12670952_2.fastq trimmed: SRR12670952-trimmed-pair1.fastq, SRR12670952-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:27:27 2025 >> started Tue Feb 11 09:27:41 2025 >> done (14.089s) 12935569 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 30827 ( 0.24%) empty read pairs filtered out after trimming by size control 12904711 (99.76%) read pairs available; of these: 1230754 ( 9.54%) trimmed read pairs available after processing 11673957 (90.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 16 0.00% 21 5 0.00% 22 8 0.00% 23 15 0.00% 24 14 0.00% 25 15 0.00% 26 22 0.00% 27 11 0.00% 28 25 0.00% 29 23 0.00% 30 19 0.00% 31 23 0.00% 32 24 0.00% 33 28 0.00% 34 14 0.00% 35 14 0.00% 36 32 0.00% 37 17 0.00% 38 20 0.00% 39 22 0.00% 40 35 0.00% 41 39 0.00% 42 26 0.00% 43 24 0.00% 44 33 0.00% 45 29 0.00% 46 37 0.00% 47 50 0.00% 48 46 0.00% 49 48 0.00% 50 61 0.00% 51 77 0.00% 52 75 0.00% 53 76 0.00% 54 72 0.00% 55 92 0.00% 56 120 0.00% 57 118 0.00% 58 159 0.00% 59 183 0.00% 60 206 0.00% 61 257 0.00% 62 282 0.00% 63 323 0.00% 64 326 0.00% 65 334 0.00% 66 379 0.00% 67 472 0.00% 68 520 0.00% 69 575 0.00% 70 726 0.01% 71 793 0.01% 72 894 0.01% 73 1070 0.01% 74 1127 0.01% 75 1226 0.01% 76 1345 0.01% 77 1537 0.01% 78 1632 0.01% 79 1765 0.01% 80 1956 0.02% 81 2262 0.02% 82 2486 0.02% 83 2718 0.02% 84 3149 0.02% 85 3378 0.03% 86 3775 0.03% 87 3862 0.03% 88 4141 0.03% 89 4396 0.03% 90 4701 0.04% 91 4889 0.04% 92 5283 0.04% 93 5806 0.04% 94 6159 0.05% 95 6764 0.05% 96 7097 0.05% 97 7597 0.06% 98 7803 0.06% 99 8293 0.06% 100 8271 0.06% 101 8643 0.07% 102 9099 0.07% 103 9729 0.08% 104 10343 0.08% 105 10834 0.08% 106 11352 0.09% 107 11657 0.09% 108 11992 0.09% 109 12691 0.10% 110 12695 0.10% 111 13557 0.11% 112 13719 0.11% 113 14275 0.11% 114 14714 0.11% 115 15512 0.12% 116 16158 0.13% 117 17194 0.13% 118 17389 0.13% 119 18043 0.14% 120 18128 0.14% 121 18749 0.15% 122 19113 0.15% 123 20001 0.15% 124 20737 0.16% 125 21113 0.16% 126 22104 0.17% 127 22839 0.18% 128 23094 0.18% 129 23995 0.19% 130 24529 0.19% 131 24996 0.19% 132 25857 0.20% 133 25847 0.20% 134 26751 0.21% 135 27527 0.21% 136 28374 0.22% 137 28678 0.22% 138 29658 0.23% 139 30648 0.24% 140 31260 0.24% 141 31221 0.24% 142 32432 0.25% 143 32329 0.25% 144 33485 0.26% 145 33932 0.26% 146 34671 0.27% 147 35424 0.27% 148 36215 0.28% 149 36813 0.29% 150 38286 0.30% 151 11673957 90.46% 12904711 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=36 prefix-density=0.48 prefix-fanout=1.9 sequence=GTACAGCCTTCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=143.16 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.4 sequence=AAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.43 fanout-score-rank=12 prefix-density=0.47 prefix-fanout=3.3 sequence=CTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=132.57 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.1 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCAG SRR12670952 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:28:23 Started mapping on | Feb 11 09:28:24 Finished on | Feb 11 09:29:51 Mapping speed, Million of reads per hour | 533.99 Number of input reads | 12904711 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12075929 Uniquely mapped reads % | 93.58% Average mapped length | 295.99 Number of splices: Total | 10761417 Number of splices: Annotated (sjdb) | 10573204 Number of splices: GT/AG | 10525873 Number of splices: GC/AG | 197616 Number of splices: AT/AC | 7452 Number of splices: Non-canonical | 30476 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293563 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 62818 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.45% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535219 535219 535219 N_multimapping 293563 293563 293563 N_noFeature 272275 11875721 322584 N_ambiguous 229474 802 79329 UnstrandedReadsAssigned:11574180 PositiveStrandReadsAssigned:199406 NegativeStrandReadsAssigned:11674016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670952 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670952-trimmed-pair1.fastq SRR12670952-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,904,711 reads, 11,816,061 reads pseudoaligned [quant] estimated average fragment length: 247.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR12670952.ke.tsv 34699 SRR12670952.se.tsv 87100 total ==> SRR12670952.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.87 393 16.445 Potri.005G024800.1.v4.1 1035 788.87 353 33.1775 Potri.004G059700.1.v4.1 961 714.911 13 1.34824 Potri.007G009000.2.v4.1 1416 1169.87 0 0 Potri.003G141000.2.v4.1 2943 2696.87 590 16.2206 Potri.016G087400.1.v4.1 270 81.1962 515 470.268 Potri.015G069301.1.v4.1 564 325.396 0 0 Potri.010G195200.1.v4.1 1773 1526.87 102 4.95305 Potri.012G127500.1.v4.1 977 730.891 644 65.3293 ==> SRR12670952.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 142 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 568 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12670952 completed mapping pipeline successfully