Starting /dee2/code/volunteer_pipeline.sh SRR12670953 current disk space = 3054930366464 free memory = 1467638164 SRR12670953 SRAfilesize 24622797b4f3e85e813a1f414c427356 SRR12670953.sra SRR12670953.sra file validated SRR12670953 is paired end SRR12670953 is conventional basespace SRR12670953 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3855 37.0 37.0 37.0 37.0 37.0 2 36.4485 37.0 37.0 37.0 37.0 37.0 3 36.5145 37.0 37.0 37.0 37.0 37.0 4 36.676 37.0 37.0 37.0 37.0 37.0 5 36.686 37.0 37.0 37.0 37.0 37.0 6 36.6235 37.0 37.0 37.0 37.0 37.0 7 36.5425 37.0 37.0 37.0 37.0 37.0 8 36.5575 37.0 37.0 37.0 37.0 37.0 9 36.594 37.0 37.0 37.0 37.0 37.0 10-14 36.606700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5502 37.0 37.0 37.0 37.0 37.0 20-24 36.5252 37.0 37.0 37.0 37.0 37.0 25-29 36.4672 37.0 37.0 37.0 37.0 37.0 30-34 36.4247 37.0 37.0 37.0 37.0 37.0 35-39 36.45569999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.440099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3782 37.0 37.0 37.0 37.0 37.0 50-54 36.4045 37.0 37.0 37.0 37.0 37.0 55-59 36.3849 37.0 37.0 37.0 37.0 37.0 60-64 36.36410000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.298199999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2944 37.0 37.0 37.0 37.0 37.0 75-79 36.2668 37.0 37.0 37.0 37.0 37.0 80-84 36.2736 37.0 37.0 37.0 37.0 37.0 85-89 36.257999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.233799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.212 37.0 37.0 37.0 37.0 37.0 100-104 36.1895 37.0 37.0 37.0 37.0 37.0 105-109 36.1194 37.0 37.0 37.0 37.0 37.0 110-114 36.0895 37.0 37.0 37.0 37.0 37.0 115-119 35.9831 37.0 37.0 37.0 37.0 37.0 120-124 36.0209 37.0 37.0 37.0 37.0 37.0 125-129 36.0542 37.0 37.0 37.0 37.0 37.0 130-134 35.8694 37.0 37.0 37.0 37.0 37.0 135-139 35.9463 37.0 37.0 37.0 37.0 37.0 140-144 35.868300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7883 37.0 37.0 37.0 37.0 37.0 150-151 35.586 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 0.0 21 1.0 22 2.0 23 3.0 24 1.0 25 4.0 26 4.0 27 14.0 28 15.0 29 22.0 30 23.0 31 49.0 32 45.0 33 90.0 34 105.0 35 264.0 36 2644.0 37 711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.2952952952953 12.387387387387387 5.980980980980981 36.33633633633634 2 19.925 11.200000000000001 36.05 32.824999999999996 3 18.125 15.25 29.049999999999997 37.574999999999996 4 22.95 21.875 24.0 31.175000000000004 5 23.65 30.425 23.974999999999998 21.95 6 20.3 32.875 23.025000000000002 23.799999999999997 7 16.2 27.775 40.300000000000004 15.725 8 16.325 26.700000000000003 34.5 22.475 9 15.925 24.075 36.125 23.875 10-14 19.285 30.3 28.54 21.875 15-19 19.535 29.104999999999997 27.705000000000002 23.655 20-24 20.195 28.994999999999997 27.235 23.575 25-29 19.655 28.675 28.000000000000004 23.669999999999998 30-34 20.32 28.705000000000002 27.62 23.355 35-39 20.23 28.439999999999998 27.235 24.095 40-44 20.93 28.79 26.985 23.294999999999998 45-49 20.599999999999998 29.065 26.979999999999997 23.355 50-54 19.935 28.32 27.74 24.005000000000003 55-59 20.105 28.24 27.855 23.799999999999997 60-64 20.435 28.634999999999998 27.72 23.21 65-69 20.325 28.67 27.034999999999997 23.97 70-74 20.075000000000003 28.74 27.229999999999997 23.955000000000002 75-79 20.025000000000002 28.67 27.255000000000003 24.05 80-84 20.244999999999997 28.27 27.42 24.065 85-89 20.155 28.115000000000002 27.705000000000002 24.025 90-94 20.91 28.249999999999996 27.084999999999997 23.755000000000003 95-99 20.74 27.445000000000004 27.96 23.855 100-104 20.385 27.92 27.534999999999997 24.16 105-109 20.28 28.050000000000004 27.845 23.825 110-114 21.265 27.675 27.474999999999998 23.585 115-119 21.315 27.755000000000003 27.325 23.605 120-124 21.32 27.334999999999997 26.834999999999997 24.51 125-129 21.09 27.839999999999996 27.115000000000002 23.955000000000002 130-134 21.145 28.249999999999996 26.375 24.23 135-139 21.215 27.665 27.505000000000003 23.615 140-144 21.48 26.945000000000004 27.400000000000002 24.175 145-149 21.035 27.785 26.924999999999997 24.255 150-151 20.575 28.549999999999997 26.6625 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 2.5 22 2.5 23 1.5 24 1.0 25 6.5 26 9.0 27 7.0 28 8.5 29 16.5 30 22.5 31 27.0 32 38.0 33 46.0 34 62.0 35 81.0 36 92.5 37 113.0 38 131.0 39 145.0 40 179.0 41 195.0 42 198.0 43 225.0 44 242.0 45 253.5 46 264.0 47 248.0 48 212.5 49 184.0 50 181.5 51 162.0 52 125.5 53 112.5 54 98.0 55 66.5 56 49.0 57 46.0 58 34.5 59 29.0 60 21.0 61 12.0 62 11.5 63 6.0 64 1.0 65 0.5 66 0.0 67 4.0 68 6.0 69 3.5 70 2.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.63452479911332 81.77499999999999 2 8.118592407869215 14.649999999999999 3 1.0806317539484622 2.9250000000000003 4 0.13854253255749516 0.5 5 0.0 0.0 6 0.02770850651149903 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.487500000000001 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACGGAA 10 0.006830828 145.0 9 CGCATCA 10 0.006830828 145.0 3 >>END_MODULE SRR12670953 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670953_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1915 37.0 37.0 37.0 37.0 37.0 2 36.1545 37.0 37.0 37.0 37.0 37.0 3 36.2985 37.0 37.0 37.0 37.0 37.0 4 36.283 37.0 37.0 37.0 37.0 37.0 5 36.4115 37.0 37.0 37.0 37.0 37.0 6 36.3915 37.0 37.0 37.0 37.0 37.0 7 36.398 37.0 37.0 37.0 37.0 37.0 8 36.4775 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.3816 37.0 37.0 37.0 37.0 37.0 15-19 36.3638 37.0 37.0 37.0 37.0 37.0 20-24 36.3759 37.0 37.0 37.0 37.0 37.0 25-29 36.281 37.0 37.0 37.0 37.0 37.0 30-34 36.303999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3059 37.0 37.0 37.0 37.0 37.0 40-44 36.1855 37.0 37.0 37.0 37.0 37.0 45-49 36.214600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2218 37.0 37.0 37.0 37.0 37.0 55-59 36.1882 37.0 37.0 37.0 37.0 37.0 60-64 36.2142 37.0 37.0 37.0 37.0 37.0 65-69 36.2431 37.0 37.0 37.0 37.0 37.0 70-74 36.1669 37.0 37.0 37.0 37.0 37.0 75-79 36.137100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1485 37.0 37.0 37.0 37.0 37.0 85-89 36.081100000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1288 37.0 37.0 37.0 37.0 37.0 95-99 36.092400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.101800000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.00449999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.998900000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.0073 37.0 37.0 37.0 37.0 37.0 120-124 35.933499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.8433 37.0 37.0 37.0 37.0 37.0 130-134 35.808299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.786500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.772999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.5544 37.0 37.0 37.0 37.0 37.0 150-151 35.347750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 4.0 15 1.0 16 4.0 17 1.0 18 2.0 19 1.0 20 6.0 21 1.0 22 5.0 23 5.0 24 3.0 25 5.0 26 5.0 27 14.0 28 14.0 29 14.0 30 25.0 31 37.0 32 41.0 33 74.0 34 122.0 35 350.0 36 2651.0 37 612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.025 25.074999999999996 8.924999999999999 23.974999999999998 2 28.9 26.150000000000002 28.775000000000002 16.175 3 21.45 26.6 32.824999999999996 19.125 4 24.474999999999998 32.9 23.175 19.45 5 25.85 37.5 20.05 16.6 6 20.25 40.525 22.400000000000002 16.825000000000003 7 21.675 22.15 37.925 18.25 8 21.425 24.775 28.1 25.7 9 22.8 23.075000000000003 30.925000000000004 23.200000000000003 10-14 23.695 28.970000000000002 26.115 21.22 15-19 23.78 27.815 27.105 21.3 20-24 23.535 28.725 26.674999999999997 21.065 25-29 24.33 28.705000000000002 26.695 20.27 30-34 23.555 28.095 27.565 20.785 35-39 24.29 27.944999999999997 26.555 21.21 40-44 23.815 28.294999999999998 27.29 20.599999999999998 45-49 23.465 28.675 27.439999999999998 20.419999999999998 50-54 23.895 28.575 26.605 20.925 55-59 23.69 27.99 27.045 21.275 60-64 23.93 28.01 26.85 21.21 65-69 23.945 28.09 27.24 20.724999999999998 70-74 24.21 27.605 26.889999999999997 21.295 75-79 24.060000000000002 27.265 27.405 21.27 80-84 24.03 28.395 26.450000000000003 21.125 85-89 24.195 28.62 26.265 20.919999999999998 90-94 24.235 28.38 26.040000000000003 21.345 95-99 24.21 28.884999999999998 26.775 20.13 100-104 24.355 27.834999999999997 26.895000000000003 20.915 105-109 23.985 28.465 26.915 20.635 110-114 23.880000000000003 27.99 27.355 20.775 115-119 24.6 27.845 27.305 20.25 120-124 24.585 27.775 26.784999999999997 20.855 125-129 24.5 27.71 27.11 20.68 130-134 24.990000000000002 27.26 27.195000000000004 20.555 135-139 24.709999999999997 27.884999999999998 27.165 20.24 140-144 24.795 27.975 27.139999999999997 20.09 145-149 24.545 28.18 26.77 20.505000000000003 150-151 26.400000000000002 27.437499999999996 26.437500000000004 19.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 3.0 15 2.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 2.0 24 3.0 25 2.5 26 2.5 27 4.0 28 7.5 29 12.5 30 17.0 31 19.5 32 19.0 33 23.0 34 39.0 35 51.0 36 68.5 37 105.0 38 128.0 39 143.5 40 167.5 41 213.0 42 237.5 43 246.5 44 262.5 45 268.0 46 281.0 47 245.5 48 217.0 49 214.0 50 191.5 51 156.0 52 117.5 53 113.5 54 106.5 55 75.0 56 49.0 57 39.0 58 30.0 59 20.5 60 20.0 61 17.5 62 11.0 63 9.0 64 6.0 65 1.5 66 0.5 67 0.5 68 0.5 69 1.5 70 2.5 71 2.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.5 99 2.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.4151574254667 81.125 2 8.35887433825578 15.0 3 0.9473390916689886 2.55 4 0.16717748676511562 0.6 5 0.0 0.0 6 0.02786291446085261 0.15 7 0.05572582892170522 0.35000000000000003 8 0.0 0.0 9 0.02786291446085261 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.5625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 4.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591238 spots for SRR12670953.sra Written 591238 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra Read 591227 spots for SRR12670953.sra Written 591227 spots for SRR12670953.sra SRR ids: ['SRR12670953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uuj9w063 SRR12670953.sra spots: 11824551 blocks: [[1, 591227], [591228, 1182454], [1182455, 1773681], [1773682, 2364908], [2364909, 2956135], [2956136, 3547362], [3547363, 4138589], [4138590, 4729816], [4729817, 5321043], [5321044, 5912270], [5912271, 6503497], [6503498, 7094724], [7094725, 7685951], [7685952, 8277178], [8277179, 8868405], [8868406, 9459632], [9459633, 10050859], [10050860, 10642086], [10642087, 11233313], [11233314, 11824551]] SRR12670953 file size 3996799 SRR12670953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670953 SRR12670953_1.fastq SRR12670953_2.fastq Input file: SRR12670953_1.fastq Paired file: SRR12670953_2.fastq trimmed: SRR12670953-trimmed-pair1.fastq, SRR12670953-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:28:38 2025 >> started Tue Feb 11 09:28:59 2025 >> done (20.117s) 11824551 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 3787 ( 0.03%) empty read pairs filtered out after trimming by size control 11820736 (99.97%) read pairs available; of these: 882281 ( 7.46%) trimmed read pairs available after processing 10938455 (92.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 4 0.00% 28 11 0.00% 29 7 0.00% 30 6 0.00% 31 5 0.00% 32 8 0.00% 33 8 0.00% 34 16 0.00% 35 7 0.00% 36 6 0.00% 37 2 0.00% 38 10 0.00% 39 18 0.00% 40 13 0.00% 41 8 0.00% 42 14 0.00% 43 16 0.00% 44 17 0.00% 45 11 0.00% 46 14 0.00% 47 23 0.00% 48 22 0.00% 49 26 0.00% 50 34 0.00% 51 28 0.00% 52 31 0.00% 53 57 0.00% 54 56 0.00% 55 53 0.00% 56 64 0.00% 57 66 0.00% 58 81 0.00% 59 98 0.00% 60 109 0.00% 61 117 0.00% 62 122 0.00% 63 170 0.00% 64 168 0.00% 65 198 0.00% 66 211 0.00% 67 233 0.00% 68 255 0.00% 69 331 0.00% 70 310 0.00% 71 405 0.00% 72 454 0.00% 73 537 0.00% 74 603 0.01% 75 702 0.01% 76 788 0.01% 77 791 0.01% 78 829 0.01% 79 1023 0.01% 80 1098 0.01% 81 1237 0.01% 82 1411 0.01% 83 1462 0.01% 84 1760 0.01% 85 1924 0.02% 86 2093 0.02% 87 2419 0.02% 88 2536 0.02% 89 2549 0.02% 90 2755 0.02% 91 3007 0.03% 92 3105 0.03% 93 3614 0.03% 94 3806 0.03% 95 4152 0.04% 96 4451 0.04% 97 4662 0.04% 98 4829 0.04% 99 5202 0.04% 100 5296 0.04% 101 5643 0.05% 102 5995 0.05% 103 6350 0.05% 104 6615 0.06% 105 7057 0.06% 106 7286 0.06% 107 7812 0.07% 108 7946 0.07% 109 8433 0.07% 110 8562 0.07% 111 8902 0.08% 112 9374 0.08% 113 9640 0.08% 114 10025 0.08% 115 10648 0.09% 116 11472 0.10% 117 11984 0.10% 118 12117 0.10% 119 12265 0.10% 120 13201 0.11% 121 13157 0.11% 122 13585 0.11% 123 13864 0.12% 124 14517 0.12% 125 14984 0.13% 126 15672 0.13% 127 16313 0.14% 128 16700 0.14% 129 17434 0.15% 130 17791 0.15% 131 18062 0.15% 132 18394 0.16% 133 18934 0.16% 134 19367 0.16% 135 19964 0.17% 136 20796 0.18% 137 21118 0.18% 138 22127 0.19% 139 23367 0.20% 140 23671 0.20% 141 24249 0.21% 142 24893 0.21% 143 25172 0.21% 144 26264 0.22% 145 26081 0.22% 146 26622 0.23% 147 27730 0.23% 148 28325 0.24% 149 28981 0.25% 150 30217 0.26% 151 10938455 92.54% 11820736 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=52.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAAC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=30 prefix-density=0.47 prefix-fanout=2.1 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=18.44 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12670953 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:29:45 Started mapping on | Feb 11 09:29:45 Finished on | Feb 11 09:32:02 Mapping speed, Million of reads per hour | 310.62 Number of input reads | 11820736 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10933727 Uniquely mapped reads % | 92.50% Average mapped length | 297.29 Number of splices: Total | 10646135 Number of splices: Annotated (sjdb) | 10446592 Number of splices: GT/AG | 10414868 Number of splices: GC/AG | 191426 Number of splices: AT/AC | 6291 Number of splices: Non-canonical | 33550 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267578 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 166435 % of reads mapped to too many loci | 1.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 619431 619431 619431 N_multimapping 267578 267578 267578 N_noFeature 346392 10693216 408332 N_ambiguous 247230 1335 67978 UnstrandedReadsAssigned:10340105 PositiveStrandReadsAssigned:239176 NegativeStrandReadsAssigned:10457417 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670953 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670953-trimmed-pair1.fastq SRR12670953-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,820,736 reads, 10,517,265 reads pseudoaligned [quant] estimated average fragment length: 256.599 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52401 SRR12670953.ke.tsv 34699 SRR12670953.se.tsv 87100 total ==> SRR12670953.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.4 297 11.5085 Potri.005G024800.1.v4.1 1035 779.401 192 16.8231 Potri.004G059700.1.v4.1 961 705.517 2 0.193592 Potri.007G009000.2.v4.1 1416 1160.4 0 0 Potri.003G141000.2.v4.1 2943 2687.4 733 18.6268 Potri.016G087400.1.v4.1 270 76.2324 753 674.561 Potri.015G069301.1.v4.1 564 316.886 0 0 Potri.010G195200.1.v4.1 1773 1517.4 111 4.99561 Potri.012G127500.1.v4.1 977 721.441 73 6.91016 ==> SRR12670953.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670953 completed mapping pipeline successfully