Starting /dee2/code/volunteer_pipeline.sh SRR12670954 current disk space = 3053597380608 free memory = 1580066968 SRR12670954 SRAfilesize 04b1042f2d686a03ec1e076172e7600e SRR12670954.sra SRR12670954.sra file validated SRR12670954 is paired end SRR12670954 is conventional basespace SRR12670954 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.453 37.0 37.0 37.0 37.0 37.0 2 36.3885 37.0 37.0 37.0 37.0 37.0 3 36.5905 37.0 37.0 37.0 37.0 37.0 4 36.5505 37.0 37.0 37.0 37.0 37.0 5 36.5945 37.0 37.0 37.0 37.0 37.0 6 36.6535 37.0 37.0 37.0 37.0 37.0 7 36.6025 37.0 37.0 37.0 37.0 37.0 8 36.533 37.0 37.0 37.0 37.0 37.0 9 36.623 37.0 37.0 37.0 37.0 37.0 10-14 36.618300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.590700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4997 37.0 37.0 37.0 37.0 37.0 25-29 36.4511 37.0 37.0 37.0 37.0 37.0 30-34 36.4189 37.0 37.0 37.0 37.0 37.0 35-39 36.422000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3874 37.0 37.0 37.0 37.0 37.0 45-49 36.3375 37.0 37.0 37.0 37.0 37.0 50-54 36.339800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2845 37.0 37.0 37.0 37.0 37.0 60-64 36.2492 37.0 37.0 37.0 37.0 37.0 65-69 36.150099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2458 37.0 37.0 37.0 37.0 37.0 75-79 36.2062 37.0 37.0 37.0 37.0 37.0 80-84 36.209199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.1462 37.0 37.0 37.0 37.0 37.0 90-94 36.1525 37.0 37.0 37.0 37.0 37.0 95-99 36.069100000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.0792 37.0 37.0 37.0 37.0 37.0 105-109 36.0678 37.0 37.0 37.0 37.0 37.0 110-114 36.0906 37.0 37.0 37.0 37.0 37.0 115-119 35.9615 37.0 37.0 37.0 37.0 37.0 120-124 35.9659 37.0 37.0 37.0 37.0 37.0 125-129 35.9112 37.0 37.0 37.0 37.0 37.0 130-134 35.8021 37.0 37.0 37.0 37.0 37.0 135-139 35.7551 37.0 37.0 37.0 37.0 37.0 140-144 35.7411 37.0 37.0 37.0 37.0 37.0 145-149 35.6361 37.0 37.0 37.0 37.0 37.0 150-151 35.468999999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 3.0 24 5.0 25 14.0 26 8.0 27 13.0 28 12.0 29 21.0 30 34.0 31 50.0 32 58.0 33 75.0 34 130.0 35 263.0 36 2624.0 37 686.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.2 13.225000000000001 6.5 31.075000000000003 2 20.95 10.525 37.1 31.424999999999997 3 16.8 16.35 31.4 35.449999999999996 4 21.575 23.425 27.325 27.675 5 22.725 30.65 24.65 21.975 6 21.025 32.800000000000004 24.349999999999998 21.825 7 15.975 29.575000000000003 39.900000000000006 14.549999999999999 8 15.425 28.625 34.050000000000004 21.9 9 15.875 24.3 36.475 23.35 10-14 19.48 30.764999999999997 28.410000000000004 21.345 15-19 20.585 29.015 27.395000000000003 23.005 20-24 20.215 29.415000000000003 27.52 22.85 25-29 19.755 29.235 27.6 23.41 30-34 19.46 29.360000000000003 28.17 23.01 35-39 19.825 29.659999999999997 27.235 23.28 40-44 19.695 30.064999999999998 27.425 22.814999999999998 45-49 20.365 29.675 27.169999999999998 22.79 50-54 19.99 29.225 27.400000000000002 23.385 55-59 19.6 29.275000000000002 27.615000000000002 23.51 60-64 19.715 29.720000000000002 27.855 22.71 65-69 20.06 29.304999999999996 27.185 23.45 70-74 20.07 28.88 27.21 23.84 75-79 19.85 28.865000000000002 27.534999999999997 23.75 80-84 20.43 28.849999999999998 27.284999999999997 23.435 85-89 20.560000000000002 29.189999999999998 26.895000000000003 23.355 90-94 20.8 28.67 27.22 23.31 95-99 20.4 28.515 27.565 23.52 100-104 20.505000000000003 28.865000000000002 27.575 23.055 105-109 20.94 28.349999999999998 27.24 23.47 110-114 20.724999999999998 29.160000000000004 26.795 23.32 115-119 21.4 28.65 27.015 22.935 120-124 20.925 27.91 27.37 23.794999999999998 125-129 20.580000000000002 28.29 26.76 24.37 130-134 20.72 28.505000000000003 27.08 23.695 135-139 21.09 27.755000000000003 27.015 24.14 140-144 21.205 27.689999999999998 26.645000000000003 24.46 145-149 21.45 27.3 27.265 23.985 150-151 21.8875 27.2625 27.150000000000002 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 0.5 4 0.0 5 1.0 6 2.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 2.5 21 2.5 22 3.0 23 5.0 24 5.0 25 9.0 26 12.0 27 14.0 28 22.5 29 24.0 30 26.5 31 35.0 32 40.0 33 53.5 34 82.0 35 99.5 36 122.0 37 143.5 38 141.0 39 148.0 40 171.0 41 192.0 42 200.5 43 215.0 44 239.0 45 237.5 46 217.5 47 214.5 48 203.0 49 183.5 50 174.5 51 160.5 52 131.0 53 105.5 54 84.0 55 66.5 56 58.5 57 41.0 58 25.5 59 20.5 60 16.5 61 8.0 62 5.0 63 4.5 64 3.5 65 4.0 66 4.5 67 4.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51580698835274 81.6 2 8.374930671103716 15.1 3 0.9151414309484194 2.475 4 0.13865779256794233 0.5 5 0.027731558513588467 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027731558513588467 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTGGTACATCTCGTAT 8 0.2 TruSeq Adapter, Index 13 (97% over 36bp) GTAAACAAGAAGTGCACCTCCGGCAAGAATGCCAGCTAGGGTAACAGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.4124999999999996 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.0250000000000004 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.2 0.0 0.0 0.0 0.0 120-121 4.425 0.0 0.0 0.0 0.0 122-123 4.699999999999999 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.6125 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.55 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.449999999999999 0.0 0.0 0.0 0.0 138-139 7.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTGT 10 0.006830828 145.0 4 TCTTGTA 10 0.006830828 145.0 5 >>END_MODULE SRR12670954 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670954_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.223 37.0 37.0 37.0 37.0 37.0 2 36.18 37.0 37.0 37.0 37.0 37.0 3 36.1675 37.0 37.0 37.0 37.0 37.0 4 36.2865 37.0 37.0 37.0 37.0 37.0 5 36.3505 37.0 37.0 37.0 37.0 37.0 6 36.1945 37.0 37.0 37.0 37.0 37.0 7 36.3015 37.0 37.0 37.0 37.0 37.0 8 36.311 37.0 37.0 37.0 37.0 37.0 9 36.2185 37.0 37.0 37.0 37.0 37.0 10-14 36.265 37.0 37.0 37.0 37.0 37.0 15-19 36.159299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.146100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.09740000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.106199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.0439 37.0 37.0 37.0 37.0 37.0 40-44 36.0232 37.0 37.0 37.0 37.0 37.0 45-49 36.016200000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.995400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.998200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.928599999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.926199999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.934900000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8544 37.0 37.0 37.0 37.0 37.0 80-84 35.9227 37.0 37.0 37.0 37.0 37.0 85-89 35.8621 37.0 37.0 37.0 37.0 37.0 90-94 35.860099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8698 37.0 37.0 37.0 37.0 37.0 100-104 35.88530000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.7991 37.0 37.0 37.0 37.0 37.0 110-114 35.863299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.768 37.0 37.0 37.0 37.0 37.0 120-124 35.6513 37.0 37.0 37.0 37.0 37.0 125-129 35.603300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5517 37.0 37.0 37.0 37.0 37.0 135-139 35.416000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3366 37.0 37.0 37.0 37.0 37.0 145-149 35.06569999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.742999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 12.0 15 4.0 16 3.0 17 4.0 18 1.0 19 4.0 20 4.0 21 11.0 22 7.0 23 10.0 24 9.0 25 10.0 26 13.0 27 7.0 28 11.0 29 18.0 30 32.0 31 29.0 32 39.0 33 93.0 34 142.0 35 361.0 36 2627.0 37 539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.4 30.25 6.225 20.125 2 31.775 24.275 27.800000000000004 16.150000000000002 3 22.05 27.224999999999998 32.725 18.0 4 24.825 33.550000000000004 22.85 18.775 5 27.200000000000003 36.5 20.575 15.725 6 21.349999999999998 38.574999999999996 21.525 18.55 7 22.475 22.8 36.3 18.425 8 22.15 25.174999999999997 28.299999999999997 24.375 9 23.0 24.45 29.725 22.825 10-14 24.740000000000002 29.2 25.814999999999998 20.244999999999997 15-19 23.810000000000002 27.97 27.375 20.845 20-24 24.275 28.199999999999996 27.310000000000002 20.215 25-29 24.385 28.084999999999997 27.065 20.465 30-34 23.775 27.700000000000003 27.305 21.22 35-39 23.71 28.27 26.55 21.47 40-44 23.26 28.46 27.595 20.685000000000002 45-49 23.94 28.275 27.155 20.630000000000003 50-54 23.425 28.470000000000002 27.675 20.43 55-59 23.75 27.96 27.525 20.765 60-64 23.849999999999998 27.83 27.52 20.8 65-69 23.91 28.225 27.169999999999998 20.695 70-74 24.099999999999998 28.305000000000003 26.75 20.845 75-79 24.355 27.450000000000003 27.465 20.73 80-84 23.74 27.785 27.13 21.345 85-89 24.099999999999998 28.535 26.52 20.845 90-94 23.955000000000002 27.839999999999996 26.779999999999998 21.425 95-99 23.62 27.935 27.700000000000003 20.745 100-104 24.03 28.449999999999996 26.935 20.585 105-109 24.165 28.365000000000002 27.345000000000002 20.125 110-114 24.255 27.775 27.169999999999998 20.8 115-119 23.974999999999998 28.449999999999996 26.919999999999998 20.655 120-124 24.965 28.125 27.169999999999998 19.74 125-129 24.86 28.065 26.645000000000003 20.43 130-134 25.22 27.815 27.05 19.915 135-139 25.814999999999998 28.084999999999997 26.924999999999997 19.175 140-144 25.290000000000003 27.905 27.105 19.7 145-149 26.22 27.815 26.650000000000002 19.314999999999998 150-151 26.3125 28.025 26.6125 19.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.5 11 1.5 12 1.0 13 1.0 14 1.5 15 0.5 16 2.0 17 3.5 18 2.0 19 2.0 20 2.0 21 1.5 22 1.5 23 1.5 24 3.0 25 3.0 26 4.0 27 7.0 28 6.0 29 7.5 30 10.5 31 18.0 32 23.0 33 34.0 34 44.0 35 54.5 36 87.0 37 101.5 38 115.5 39 158.5 40 188.0 41 194.5 42 214.5 43 232.0 44 241.0 45 250.5 46 256.5 47 284.0 48 269.0 49 227.5 50 197.5 51 153.5 52 128.5 53 106.0 54 84.0 55 60.0 56 42.5 57 34.0 58 25.5 59 22.0 60 15.0 61 11.0 62 8.0 63 5.0 64 4.5 65 3.0 66 0.5 67 0.5 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.5 76 1.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 2.5 87 2.5 88 0.5 89 0.0 90 1.0 91 1.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 2.0 98 2.5 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.4238592633315 83.15 2 7.586586036283673 13.8 3 0.8521165475536009 2.325 4 0.054975261132490384 0.2 5 0.027487630566245192 0.125 6 0.027487630566245192 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027487630566245192 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.5125 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.9500000000000002 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.199999999999999 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.300000000000001 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.574999999999999 0.0 0.0 0.0 0.0 138-139 7.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCCAA 10 0.006830828 145.0 5 >>END_MODULE Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568591 spots for SRR12670954.sra Written 568591 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra Read 568572 spots for SRR12670954.sra Written 568572 spots for SRR12670954.sra SRR ids: ['SRR12670954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25goi4kt SRR12670954.sra spots: 11371459 blocks: [[1, 568572], [568573, 1137144], [1137145, 1705716], [1705717, 2274288], [2274289, 2842860], [2842861, 3411432], [3411433, 3980004], [3980005, 4548576], [4548577, 5117148], [5117149, 5685720], [5685721, 6254292], [6254293, 6822864], [6822865, 7391436], [7391437, 7960008], [7960009, 8528580], [8528581, 9097152], [9097153, 9665724], [9665725, 10234296], [10234297, 10802868], [10802869, 11371459]] SRR12670954 file size 3842818 SRR12670954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670954 SRR12670954_1.fastq SRR12670954_2.fastq Input file: SRR12670954_1.fastq Paired file: SRR12670954_2.fastq trimmed: SRR12670954-trimmed-pair1.fastq, SRR12670954-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:11:01 2025 >> started Tue Feb 11 10:11:13 2025 >> done (11.911s) 11371459 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 30653 ( 0.27%) empty read pairs filtered out after trimming by size control 11340747 (99.73%) read pairs available; of these: 1269791 (11.20%) trimmed read pairs available after processing 10070956 (88.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 5 0.00% 20 20 0.00% 21 36 0.00% 22 17 0.00% 23 38 0.00% 24 44 0.00% 25 47 0.00% 26 44 0.00% 27 39 0.00% 28 54 0.00% 29 49 0.00% 30 62 0.00% 31 64 0.00% 32 55 0.00% 33 67 0.00% 34 59 0.00% 35 78 0.00% 36 70 0.00% 37 57 0.00% 38 58 0.00% 39 66 0.00% 40 62 0.00% 41 75 0.00% 42 69 0.00% 43 62 0.00% 44 82 0.00% 45 66 0.00% 46 69 0.00% 47 105 0.00% 48 104 0.00% 49 145 0.00% 50 167 0.00% 51 161 0.00% 52 169 0.00% 53 201 0.00% 54 203 0.00% 55 210 0.00% 56 256 0.00% 57 300 0.00% 58 307 0.00% 59 356 0.00% 60 422 0.00% 61 457 0.00% 62 536 0.00% 63 687 0.01% 64 691 0.01% 65 673 0.01% 66 858 0.01% 67 849 0.01% 68 1032 0.01% 69 1163 0.01% 70 1325 0.01% 71 1545 0.01% 72 1678 0.01% 73 1892 0.02% 74 2064 0.02% 75 2406 0.02% 76 2613 0.02% 77 2715 0.02% 78 3011 0.03% 79 3281 0.03% 80 3593 0.03% 81 4065 0.04% 82 4387 0.04% 83 4785 0.04% 84 5499 0.05% 85 5812 0.05% 86 6052 0.05% 87 6484 0.06% 88 6704 0.06% 89 7010 0.06% 90 7281 0.06% 91 7772 0.07% 92 8331 0.07% 93 9085 0.08% 94 9461 0.08% 95 9851 0.09% 96 10406 0.09% 97 10878 0.10% 98 10687 0.09% 99 11368 0.10% 100 11590 0.10% 101 11792 0.10% 102 12391 0.11% 103 12926 0.11% 104 13305 0.12% 105 13773 0.12% 106 14355 0.13% 107 14820 0.13% 108 15009 0.13% 109 15137 0.13% 110 15301 0.13% 111 15673 0.14% 112 16245 0.14% 113 16646 0.15% 114 16791 0.15% 115 17523 0.15% 116 18206 0.16% 117 18766 0.17% 118 18952 0.17% 119 19222 0.17% 120 19792 0.17% 121 19761 0.17% 122 19839 0.17% 123 20549 0.18% 124 21243 0.19% 125 21321 0.19% 126 21843 0.19% 127 22166 0.20% 128 22628 0.20% 129 22966 0.20% 130 23005 0.20% 131 23253 0.21% 132 23550 0.21% 133 24023 0.21% 134 24730 0.22% 135 25213 0.22% 136 25520 0.23% 137 25594 0.23% 138 26493 0.23% 139 26964 0.24% 140 26903 0.24% 141 27269 0.24% 142 27552 0.24% 143 27822 0.25% 144 28623 0.25% 145 28779 0.25% 146 28834 0.25% 147 29414 0.26% 148 30473 0.27% 149 30326 0.27% 150 31298 0.28% 151 10070956 88.80% 11340747 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.83 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=38.19 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=2.5 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.64 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=20.97 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.1 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12670954 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:11:57 Started mapping on | Feb 11 10:11:57 Finished on | Feb 11 10:13:09 Mapping speed, Million of reads per hour | 567.04 Number of input reads | 11340747 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10494198 Uniquely mapped reads % | 92.54% Average mapped length | 293.99 Number of splices: Total | 9478105 Number of splices: Annotated (sjdb) | 9315839 Number of splices: GT/AG | 9258233 Number of splices: GC/AG | 183967 Number of splices: AT/AC | 5914 Number of splices: Non-canonical | 29991 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260246 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 67870 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586303 586303 586303 N_multimapping 260246 260246 260246 N_noFeature 240891 10294014 297424 N_ambiguous 211493 884 67552 UnstrandedReadsAssigned:10041814 PositiveStrandReadsAssigned:199300 NegativeStrandReadsAssigned:10129222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670954 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670954-trimmed-pair1.fastq SRR12670954-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,340,747 reads, 10,270,528 reads pseudoaligned [quant] estimated average fragment length: 247.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,292 rounds 52401 SRR12670954.ke.tsv 34699 SRR12670954.se.tsv 87100 total ==> SRR12670954.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.35 190 8.74338 Potri.005G024800.1.v4.1 1035 788.355 275 28.4343 Potri.004G059700.1.v4.1 961 714.448 2 0.228187 Potri.007G009000.2.v4.1 1416 1169.35 0 0 Potri.003G141000.2.v4.1 2943 2696.35 544 16.4457 Potri.016G087400.1.v4.1 270 85.5012 548 522.444 Potri.015G069301.1.v4.1 564 326.11 0 0 Potri.010G195200.1.v4.1 1773 1526.35 20 1.06809 Potri.012G127500.1.v4.1 977 730.392 32 3.57129 ==> SRR12670954.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 95 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12670954 completed mapping pipeline successfully