Starting /dee2/code/volunteer_pipeline.sh SRR12670955 current disk space = 3055066189824 free memory = 1172381416 SRR12670955 SRAfilesize aab839fcd37575ea8b1582fac8bfabc2 SRR12670955.sra SRR12670955.sra file validated SRR12670955 is paired end SRR12670955 is conventional basespace SRR12670955 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.49225 37.0 37.0 37.0 37.0 37.0 2 36.476 37.0 37.0 37.0 37.0 37.0 3 36.57 37.0 37.0 37.0 37.0 37.0 4 36.616 37.0 37.0 37.0 37.0 37.0 5 36.7325 37.0 37.0 37.0 37.0 37.0 6 36.7175 37.0 37.0 37.0 37.0 37.0 7 36.538 37.0 37.0 37.0 37.0 37.0 8 36.6795 37.0 37.0 37.0 37.0 37.0 9 36.7035 37.0 37.0 37.0 37.0 37.0 10-14 36.632999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6074 37.0 37.0 37.0 37.0 37.0 20-24 36.562400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5526 37.0 37.0 37.0 37.0 37.0 30-34 36.5372 37.0 37.0 37.0 37.0 37.0 35-39 36.52159999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.505900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4677 37.0 37.0 37.0 37.0 37.0 50-54 36.4797 37.0 37.0 37.0 37.0 37.0 55-59 36.467999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4045 37.0 37.0 37.0 37.0 37.0 65-69 36.3578 37.0 37.0 37.0 37.0 37.0 70-74 36.401599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.328700000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3716 37.0 37.0 37.0 37.0 37.0 85-89 36.29879999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.3055 37.0 37.0 37.0 37.0 37.0 95-99 36.2606 37.0 37.0 37.0 37.0 37.0 100-104 36.278200000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.2259 37.0 37.0 37.0 37.0 37.0 110-114 36.225 37.0 37.0 37.0 37.0 37.0 115-119 36.1685 37.0 37.0 37.0 37.0 37.0 120-124 36.123799999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0896 37.0 37.0 37.0 37.0 37.0 130-134 35.9818 37.0 37.0 37.0 37.0 37.0 135-139 36.090500000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.98309999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.868300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.624 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 7.0 26 4.0 27 12.0 28 15.0 29 17.0 30 17.0 31 38.0 32 60.0 33 67.0 34 94.0 35 230.0 36 2726.0 37 711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.75943985996499 13.028257064266066 6.401600400100025 42.810702675668914 2 19.6 11.525 36.575 32.300000000000004 3 17.025000000000002 14.75 27.474999999999998 40.75 4 20.424999999999997 21.3 25.374999999999996 32.9 5 23.1 29.25 24.85 22.8 6 22.0 31.874999999999996 22.625 23.5 7 15.375 29.099999999999998 38.925 16.6 8 17.325 25.900000000000002 32.85 23.925 9 16.925 24.275 34.0 24.8 10-14 19.84 30.535 27.67 21.955 15-19 19.900000000000002 27.595 28.255000000000003 24.25 20-24 20.51 28.53 26.97 23.990000000000002 25-29 19.900000000000002 28.935 27.485 23.68 30-34 19.85 28.494999999999997 27.105 24.55 35-39 20.544999999999998 28.57 26.779999999999998 24.104999999999997 40-44 20.24 28.535 27.375 23.849999999999998 45-49 20.549999999999997 28.799999999999997 27.155 23.494999999999997 50-54 20.68 28.939999999999998 26.96 23.419999999999998 55-59 20.385 28.194999999999997 27.29 24.13 60-64 20.794999999999998 27.755000000000003 26.83 24.62 65-69 21.029999999999998 28.065 27.575 23.330000000000002 70-74 20.305 28.63 26.88 24.185000000000002 75-79 20.28 27.88 27.810000000000002 24.03 80-84 20.544999999999998 27.955000000000002 27.425 24.075 85-89 20.415 28.26 27.08 24.245 90-94 20.9 27.894999999999996 27.195000000000004 24.01 95-99 20.72 27.605 27.46 24.215 100-104 20.830000000000002 27.47 27.834999999999997 23.865 105-109 21.205 27.650000000000002 27.605 23.54 110-114 21.205 27.075 27.42 24.3 115-119 20.985 27.775 27.425 23.815 120-124 20.919999999999998 27.884999999999998 26.900000000000002 24.295 125-129 21.81 26.935 26.685 24.57 130-134 21.37 26.88 27.38 24.37 135-139 21.075 27.644999999999996 27.310000000000002 23.97 140-144 21.965 26.995 27.1 23.94 145-149 21.215 27.595 27.1 24.09 150-151 21.3625 28.349999999999998 26.275 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.5 24 1.5 25 3.5 26 6.0 27 6.0 28 7.5 29 12.5 30 18.5 31 24.5 32 33.5 33 47.0 34 57.0 35 72.0 36 93.5 37 112.0 38 127.5 39 147.0 40 157.5 41 185.0 42 201.0 43 209.5 44 234.0 45 248.0 46 251.0 47 250.0 48 227.0 49 201.0 50 190.0 51 161.0 52 138.0 53 119.0 54 103.0 55 81.0 56 66.0 57 56.0 58 38.0 59 27.5 60 21.0 61 13.5 62 9.0 63 10.0 64 7.5 65 4.0 66 4.0 67 2.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.54762573756673 79.675 2 8.82270300646249 15.7 3 1.4610845743186287 3.9 4 0.112391121101433 0.4 5 0.02809778027535825 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02809778027535825 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACAC 8 0.2 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGGT 10 0.006830828 145.0 8 CCACCTG 10 0.006830828 145.0 3 >>END_MODULE SRR12670955 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670955_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3745 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.5105 37.0 37.0 37.0 37.0 37.0 4 36.4495 37.0 37.0 37.0 37.0 37.0 5 36.565 37.0 37.0 37.0 37.0 37.0 6 36.482 37.0 37.0 37.0 37.0 37.0 7 36.5005 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.4005 37.0 37.0 37.0 37.0 37.0 10-14 36.5637 37.0 37.0 37.0 37.0 37.0 15-19 36.566500000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.56660000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.446099999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.48350000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.462700000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3908 37.0 37.0 37.0 37.0 37.0 45-49 36.405499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.394600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.37 37.0 37.0 37.0 37.0 37.0 60-64 36.3612 37.0 37.0 37.0 37.0 37.0 65-69 36.351600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3452 37.0 37.0 37.0 37.0 37.0 75-79 36.3563 37.0 37.0 37.0 37.0 37.0 80-84 36.3637 37.0 37.0 37.0 37.0 37.0 85-89 36.28439999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2921 37.0 37.0 37.0 37.0 37.0 95-99 36.283699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.224599999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.2024 37.0 37.0 37.0 37.0 37.0 110-114 36.2239 37.0 37.0 37.0 37.0 37.0 115-119 36.158 37.0 37.0 37.0 37.0 37.0 120-124 36.119800000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.048899999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.01370000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.999900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8957 37.0 37.0 37.0 37.0 37.0 145-149 35.75619999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.55225 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 3.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 4.0 23 1.0 24 2.0 25 5.0 26 7.0 27 9.0 28 7.0 29 8.0 30 12.0 31 27.0 32 47.0 33 70.0 34 128.0 35 308.0 36 2682.0 37 675.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 24.55 9.1 29.375 2 27.275 25.674999999999997 31.2 15.85 3 20.575 27.175 33.375 18.875 4 24.825 32.2 24.45 18.525 5 26.924999999999997 35.199999999999996 21.125 16.75 6 20.75 41.3 21.3 16.650000000000002 7 20.724999999999998 22.85 37.375 19.05 8 21.099999999999998 26.125 29.025000000000002 23.75 9 22.925 25.1 30.025000000000002 21.95 10-14 23.044999999999998 29.5 25.685000000000002 21.77 15-19 24.505 27.85 26.655 20.990000000000002 20-24 23.24 28.99 25.96 21.81 25-29 23.400000000000002 27.400000000000002 27.935 21.265 30-34 23.44 28.355000000000004 27.055 21.15 35-39 23.94 27.97 26.790000000000003 21.3 40-44 24.01 27.834999999999997 26.924999999999997 21.23 45-49 23.665 28.000000000000004 26.97 21.365000000000002 50-54 23.75 27.900000000000002 26.900000000000002 21.45 55-59 22.994999999999997 28.095 27.47 21.44 60-64 23.755000000000003 27.315 27.79 21.14 65-69 24.165 27.455000000000002 27.01 21.37 70-74 23.86 27.689999999999998 26.845000000000002 21.605 75-79 23.655 27.644999999999996 26.400000000000002 22.3 80-84 23.915 28.255000000000003 26.314999999999998 21.515 85-89 23.78 27.88 27.26 21.08 90-94 24.095 27.735 26.779999999999998 21.39 95-99 23.87 27.889999999999997 26.974999999999998 21.265 100-104 23.93 27.61 27.075 21.385 105-109 24.13 27.49 26.795 21.584999999999997 110-114 24.104999999999997 28.26 27.26 20.375 115-119 24.7 28.215 26.345000000000002 20.74 120-124 24.47 28.01 26.245 21.275 125-129 24.575 27.705000000000002 26.605 21.115000000000002 130-134 24.65 27.245 27.51 20.595 135-139 24.94 26.51 27.425 21.125 140-144 25.415 27.345000000000002 26.945000000000004 20.294999999999998 145-149 25.31 27.47 26.729999999999997 20.49 150-151 25.05 28.3375 26.200000000000003 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 4.0 26 6.5 27 6.0 28 5.5 29 10.0 30 11.5 31 16.0 32 32.0 33 39.5 34 40.0 35 52.5 36 73.0 37 92.0 38 118.5 39 153.0 40 157.0 41 169.0 42 212.5 43 250.5 44 280.5 45 280.0 46 252.5 47 248.0 48 251.0 49 211.5 50 175.5 51 161.5 52 134.5 53 112.0 54 94.0 55 77.0 56 62.0 57 54.0 58 45.0 59 30.5 60 21.0 61 15.0 62 13.0 63 7.0 64 4.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.9 #Duplication Level Percentage of deduplicated Percentage of total 1 89.59505061867267 79.65 2 8.91451068616423 15.85 3 1.152980877390326 3.075 4 0.22497187851518563 0.8 5 0.05624296962879641 0.25 6 0.028121484814398204 0.15 7 0.0 0.0 8 0.0 0.0 9 0.028121484814398204 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGA 9 0.22499999999999998 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCT 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.487500000000001 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.0875 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGACA 10 0.006830828 145.0 145 ATGAAGT 10 0.006830828 145.0 2 >>END_MODULE Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428396 spots for SRR12670955.sra Written 428396 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra Read 428377 spots for SRR12670955.sra Written 428377 spots for SRR12670955.sra SRR ids: ['SRR12670955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sqgqfkhu SRR12670955.sra spots: 8567559 blocks: [[1, 428377], [428378, 856754], [856755, 1285131], [1285132, 1713508], [1713509, 2141885], [2141886, 2570262], [2570263, 2998639], [2998640, 3427016], [3427017, 3855393], [3855394, 4283770], [4283771, 4712147], [4712148, 5140524], [5140525, 5568901], [5568902, 5997278], [5997279, 6425655], [6425656, 6854032], [6854033, 7282409], [7282410, 7710786], [7710787, 8139163], [8139164, 8567559]] SRR12670955 file size 2892728 SRR12670955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670955 SRR12670955_1.fastq SRR12670955_2.fastq Input file: SRR12670955_1.fastq Paired file: SRR12670955_2.fastq trimmed: SRR12670955-trimmed-pair1.fastq, SRR12670955-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:16:42 2025 >> started Tue Feb 11 09:16:56 2025 >> done (13.747s) 8567559 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 1733 ( 0.02%) empty read pairs filtered out after trimming by size control 8565796 (99.98%) read pairs available; of these: 788483 ( 9.21%) trimmed read pairs available after processing 7777313 (90.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 7 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 3 0.00% 31 6 0.00% 32 9 0.00% 33 8 0.00% 34 12 0.00% 35 11 0.00% 36 12 0.00% 37 12 0.00% 38 10 0.00% 39 8 0.00% 40 13 0.00% 41 8 0.00% 42 25 0.00% 43 11 0.00% 44 17 0.00% 45 11 0.00% 46 17 0.00% 47 18 0.00% 48 15 0.00% 49 26 0.00% 50 35 0.00% 51 37 0.00% 52 51 0.00% 53 32 0.00% 54 48 0.00% 55 49 0.00% 56 73 0.00% 57 59 0.00% 58 77 0.00% 59 96 0.00% 60 117 0.00% 61 123 0.00% 62 157 0.00% 63 160 0.00% 64 190 0.00% 65 193 0.00% 66 235 0.00% 67 306 0.00% 68 294 0.00% 69 365 0.00% 70 436 0.01% 71 477 0.01% 72 512 0.01% 73 608 0.01% 74 699 0.01% 75 792 0.01% 76 777 0.01% 77 882 0.01% 78 948 0.01% 79 1148 0.01% 80 1227 0.01% 81 1313 0.02% 82 1530 0.02% 83 1644 0.02% 84 1799 0.02% 85 2071 0.02% 86 2196 0.03% 87 2369 0.03% 88 2565 0.03% 89 2693 0.03% 90 2961 0.03% 91 3031 0.04% 92 3170 0.04% 93 3463 0.04% 94 3876 0.05% 95 4075 0.05% 96 4290 0.05% 97 4640 0.05% 98 4819 0.06% 99 5038 0.06% 100 5248 0.06% 101 5441 0.06% 102 5645 0.07% 103 5875 0.07% 104 6086 0.07% 105 6573 0.08% 106 6795 0.08% 107 7169 0.08% 108 7535 0.09% 109 7809 0.09% 110 8079 0.09% 111 8242 0.10% 112 8563 0.10% 113 8645 0.10% 114 9182 0.11% 115 9609 0.11% 116 10011 0.12% 117 10689 0.12% 118 10905 0.13% 119 11286 0.13% 120 11906 0.14% 121 11786 0.14% 122 12264 0.14% 123 12784 0.15% 124 13165 0.15% 125 13324 0.16% 126 13918 0.16% 127 14131 0.16% 128 14937 0.17% 129 15323 0.18% 130 15814 0.18% 131 16293 0.19% 132 16480 0.19% 133 16919 0.20% 134 17143 0.20% 135 17610 0.21% 136 18227 0.21% 137 18434 0.22% 138 18945 0.22% 139 20296 0.24% 140 20452 0.24% 141 20963 0.24% 142 21451 0.25% 143 21297 0.25% 144 22367 0.26% 145 22251 0.26% 146 23188 0.27% 147 23631 0.28% 148 24423 0.29% 149 24668 0.29% 150 25660 0.30% 151 7777313 90.79% 8565796 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.71 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=24.15 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=1.09 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=14.69 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.7 sequence=AGTACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12670955 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:17:45 Started mapping on | Feb 11 09:17:46 Finished on | Feb 11 09:19:11 Mapping speed, Million of reads per hour | 362.79 Number of input reads | 8565796 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 7838561 Uniquely mapped reads % | 91.51% Average mapped length | 296.59 Number of splices: Total | 7588831 Number of splices: Annotated (sjdb) | 7459831 Number of splices: GT/AG | 7426304 Number of splices: GC/AG | 137586 Number of splices: AT/AC | 4726 Number of splices: Non-canonical | 20215 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215815 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 197257 % of reads mapped to too many loci | 2.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 511420 511420 511420 N_multimapping 215815 215815 215815 N_noFeature 304556 7662913 346216 N_ambiguous 184490 634 50227 UnstrandedReadsAssigned:7349515 PositiveStrandReadsAssigned:175014 NegativeStrandReadsAssigned:7442118 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670955 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670955-trimmed-pair1.fastq SRR12670955-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,565,796 reads, 7,542,644 reads pseudoaligned [quant] estimated average fragment length: 248.528 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR12670955.ke.tsv 34699 SRR12670955.se.tsv 87100 total ==> SRR12670955.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.47 162 8.32367 Potri.005G024800.1.v4.1 1035 787.472 189 21.8331 Potri.004G059700.1.v4.1 961 713.519 0 0 Potri.007G009000.2.v4.1 1416 1168.47 0 0 Potri.003G141000.2.v4.1 2943 2695.47 366 12.3519 Potri.016G087400.1.v4.1 270 80.1822 538 610.37 Potri.015G069301.1.v4.1 564 324.206 0 0 Potri.010G195200.1.v4.1 1773 1525.47 25 1.49082 Potri.012G127500.1.v4.1 977 729.488 72 8.97848 ==> SRR12670955.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670955 completed mapping pipeline successfully