Starting /dee2/code/volunteer_pipeline.sh SRR12670956 current disk space = 3054673833984 free memory = 1459544500 SRR12670956 SRAfilesize 7a95eaa0e18108ed5d3b05ef10d2994c SRR12670956.sra SRR12670956.sra file validated SRR12670956 is paired end SRR12670956 is conventional basespace SRR12670956 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670956_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5125 37.0 37.0 37.0 37.0 37.0 2 36.416 37.0 37.0 37.0 37.0 37.0 3 36.5785 37.0 37.0 37.0 37.0 37.0 4 36.6335 37.0 37.0 37.0 37.0 37.0 5 36.6195 37.0 37.0 37.0 37.0 37.0 6 36.656 37.0 37.0 37.0 37.0 37.0 7 36.5895 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.656400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5916 37.0 37.0 37.0 37.0 37.0 20-24 36.5493 37.0 37.0 37.0 37.0 37.0 25-29 36.5052 37.0 37.0 37.0 37.0 37.0 30-34 36.4365 37.0 37.0 37.0 37.0 37.0 35-39 36.4824 37.0 37.0 37.0 37.0 37.0 40-44 36.4125 37.0 37.0 37.0 37.0 37.0 45-49 36.3371 37.0 37.0 37.0 37.0 37.0 50-54 36.3275 37.0 37.0 37.0 37.0 37.0 55-59 36.336 37.0 37.0 37.0 37.0 37.0 60-64 36.2805 37.0 37.0 37.0 37.0 37.0 65-69 36.2469 37.0 37.0 37.0 37.0 37.0 70-74 36.3023 37.0 37.0 37.0 37.0 37.0 75-79 36.28150000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2435 37.0 37.0 37.0 37.0 37.0 85-89 36.2273 37.0 37.0 37.0 37.0 37.0 90-94 36.11149999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.081100000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.143299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0989 37.0 37.0 37.0 37.0 37.0 110-114 36.094 37.0 37.0 37.0 37.0 37.0 115-119 36.0065 37.0 37.0 37.0 37.0 37.0 120-124 35.9819 37.0 37.0 37.0 37.0 37.0 125-129 35.9673 37.0 37.0 37.0 37.0 37.0 130-134 35.8357 37.0 37.0 37.0 37.0 37.0 135-139 35.818200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.824400000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.6546 37.0 37.0 37.0 37.0 37.0 150-151 35.479 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 3.0 23 10.0 24 5.0 25 6.0 26 7.0 27 6.0 28 17.0 29 37.0 30 27.0 31 34.0 32 52.0 33 78.0 34 112.0 35 224.0 36 2621.0 37 758.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.89594797398699 14.357178589294648 7.378689344672336 36.36818409204602 2 20.724999999999998 12.025 36.199999999999996 31.05 3 16.8 14.174999999999999 26.525 42.5 4 22.05 19.725 23.875 34.35 5 23.400000000000002 27.675 24.725 24.2 6 22.2 31.15 24.05 22.6 7 16.55 29.925 36.65 16.875 8 17.45 29.049999999999997 33.35 20.150000000000002 9 17.224999999999998 25.724999999999998 35.625 21.425 10-14 19.46 31.71 27.915 20.915 15-19 20.05 28.83 28.115000000000002 23.005 20-24 19.43 29.609999999999996 28.405 22.555 25-29 19.79 29.93 27.275 23.005 30-34 19.689999999999998 29.895 26.950000000000003 23.465 35-39 19.99 29.695 27.36 22.955000000000002 40-44 19.915 29.635 27.405 23.044999999999998 45-49 20.31 29.535 27.310000000000002 22.845 50-54 20.075000000000003 29.205 27.725 22.994999999999997 55-59 19.86 29.445 27.51 23.185 60-64 19.54 29.744999999999997 27.634999999999998 23.080000000000002 65-69 19.650000000000002 29.69 27.305 23.355 70-74 20.06 29.310000000000002 26.605 24.025 75-79 20.435 28.73 27.02 23.815 80-84 20.150000000000002 29.94 26.63 23.28 85-89 20.575 29.075 26.334999999999997 24.015 90-94 20.24 28.615000000000002 26.985 24.16 95-99 19.885 28.384999999999998 27.950000000000003 23.78 100-104 20.895 28.22 27.445000000000004 23.44 105-109 20.53 28.749999999999996 27.145000000000003 23.575 110-114 20.745 28.975 26.584999999999997 23.695 115-119 20.29 29.03 27.395000000000003 23.285 120-124 21.035 27.779999999999998 27.315 23.87 125-129 20.605 28.765 26.55 24.08 130-134 20.935000000000002 28.349999999999998 27.3 23.415 135-139 20.96 28.110000000000003 26.950000000000003 23.98 140-144 20.825 27.810000000000002 27.24 24.125 145-149 20.755000000000003 28.000000000000004 27.115000000000002 24.13 150-151 20.5875 28.199999999999996 26.5125 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.5 6 1.0 7 1.0 8 1.5 9 1.5 10 1.0 11 1.0 12 1.5 13 2.0 14 1.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 2.5 24 5.5 25 8.0 26 10.5 27 8.0 28 10.0 29 15.0 30 22.0 31 40.0 32 63.0 33 66.5 34 65.0 35 92.0 36 120.0 37 133.0 38 143.5 39 161.0 40 181.0 41 198.5 42 208.0 43 206.0 44 204.5 45 208.0 46 217.5 47 229.0 48 218.5 49 197.0 50 178.5 51 159.0 52 147.0 53 122.5 54 83.5 55 61.5 56 51.5 57 38.5 58 29.0 59 23.0 60 17.0 61 8.0 62 6.0 63 6.5 64 3.0 65 2.5 66 3.5 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.08656799776598 80.65 2 8.461323652611002 15.15 3 1.2007819044959507 3.225 4 0.1954761239877129 0.7000000000000001 5 0.027925160569673275 0.125 6 0.027925160569673275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAA 6 0.15 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.8250000000000002 0.0 0.0 0.0 0.0 108-109 2.0374999999999996 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.7375 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGCG 10 0.006830828 145.0 3 CCTAATC 10 0.006830828 145.0 2 CTAATCA 10 0.006830828 145.0 3 TCCATTG 15 1.1411342E-4 145.0 2 CAGTGAT 10 0.006830828 145.0 145 >>END_MODULE SRR12670956 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670956_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3285 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.409 37.0 37.0 37.0 37.0 37.0 4 36.3655 37.0 37.0 37.0 37.0 37.0 5 36.402 37.0 37.0 37.0 37.0 37.0 6 36.4535 37.0 37.0 37.0 37.0 37.0 7 36.4405 37.0 37.0 37.0 37.0 37.0 8 36.452 37.0 37.0 37.0 37.0 37.0 9 36.454 37.0 37.0 37.0 37.0 37.0 10-14 36.4795 37.0 37.0 37.0 37.0 37.0 15-19 36.4338 37.0 37.0 37.0 37.0 37.0 20-24 36.4462 37.0 37.0 37.0 37.0 37.0 25-29 36.3615 37.0 37.0 37.0 37.0 37.0 30-34 36.361599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3085 37.0 37.0 37.0 37.0 37.0 40-44 36.3381 37.0 37.0 37.0 37.0 37.0 45-49 36.3451 37.0 37.0 37.0 37.0 37.0 50-54 36.313300000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2929 37.0 37.0 37.0 37.0 37.0 60-64 36.2747 37.0 37.0 37.0 37.0 37.0 65-69 36.24550000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.23530000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1875 37.0 37.0 37.0 37.0 37.0 80-84 36.2225 37.0 37.0 37.0 37.0 37.0 85-89 36.152 37.0 37.0 37.0 37.0 37.0 90-94 36.1332 37.0 37.0 37.0 37.0 37.0 95-99 36.1754 37.0 37.0 37.0 37.0 37.0 100-104 36.227700000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1162 37.0 37.0 37.0 37.0 37.0 110-114 36.10039999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.018100000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0267 37.0 37.0 37.0 37.0 37.0 125-129 35.894000000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8131 37.0 37.0 37.0 37.0 37.0 135-139 35.802299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.745999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.5314 37.0 37.0 37.0 37.0 37.0 150-151 35.2385 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 5.0 15 1.0 16 3.0 17 0.0 18 2.0 19 0.0 20 0.0 21 1.0 22 1.0 23 5.0 24 4.0 25 5.0 26 6.0 27 11.0 28 11.0 29 17.0 30 30.0 31 33.0 32 43.0 33 69.0 34 120.0 35 292.0 36 2706.0 37 630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55 26.275 10.0 27.175 2 28.449999999999996 27.1 28.199999999999996 16.25 3 21.125 26.900000000000002 32.550000000000004 19.425 4 25.025 32.15 24.2 18.625 5 27.125 35.15 21.625 16.1 6 21.3 39.85 21.2 17.65 7 22.375 22.85 36.675000000000004 18.099999999999998 8 21.325 26.150000000000002 28.449999999999996 24.075 9 23.175 24.3 30.125 22.400000000000002 10-14 23.974999999999998 28.655 26.340000000000003 21.029999999999998 15-19 23.505000000000003 27.860000000000003 27.150000000000002 21.485000000000003 20-24 23.655 28.005000000000003 26.834999999999997 21.505 25-29 23.830000000000002 27.915 27.27 20.985 30-34 23.91 27.615000000000002 27.815 20.66 35-39 23.724999999999998 27.67 27.365000000000002 21.240000000000002 40-44 23.575 27.765 27.74 20.919999999999998 45-49 23.68 27.29 27.97 21.060000000000002 50-54 23.46 28.205000000000002 27.63 20.705000000000002 55-59 23.64 28.000000000000004 27.51 20.849999999999998 60-64 23.27 27.750000000000004 27.544999999999998 21.435000000000002 65-69 23.815 28.23 27.05 20.905 70-74 24.07 27.525 27.43 20.974999999999998 75-79 23.28 28.199999999999996 27.24 21.279999999999998 80-84 23.875 27.63 27.485 21.01 85-89 24.725 26.974999999999998 27.755000000000003 20.544999999999998 90-94 24.215 27.915 27.355 20.515 95-99 23.845 27.47 27.505000000000003 21.18 100-104 24.285 27.525 27.725 20.465 105-109 23.830000000000002 28.21 27.785 20.175 110-114 24.185000000000002 27.735 27.589999999999996 20.49 115-119 23.995 28.23 27.575 20.200000000000003 120-124 24.39 28.01 27.215 20.385 125-129 24.18 28.73 26.985 20.105 130-134 24.83 27.689999999999998 27.0 20.48 135-139 25.585 27.18 27.58 19.655 140-144 25.155 27.24 27.595 20.01 145-149 26.590000000000003 26.224999999999998 27.36 19.825 150-151 25.7625 28.175 26.85 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.0 20 1.0 21 0.5 22 1.5 23 1.5 24 1.0 25 1.5 26 2.5 27 5.5 28 4.0 29 11.5 30 21.5 31 21.0 32 20.0 33 25.5 34 49.0 35 68.5 36 85.0 37 109.5 38 136.0 39 150.5 40 177.5 41 210.0 42 223.0 43 226.0 44 230.0 45 253.5 46 270.5 47 256.0 48 229.0 49 221.5 50 190.0 51 147.5 52 134.5 53 112.5 54 92.0 55 85.5 56 63.5 57 36.5 58 28.5 59 29.5 60 21.0 61 10.0 62 6.0 63 4.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 1.0 96 1.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.2 #Duplication Level Percentage of deduplicated Percentage of total 1 89.96636771300447 80.25 2 8.43609865470852 15.049999999999999 3 1.289237668161435 3.45 4 0.2242152466367713 0.8 5 0.028026905829596414 0.125 6 0.028026905829596414 0.15 7 0.028026905829596414 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.8250000000000002 0.0 0.0 0.0 0.0 108-109 2.0374999999999996 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.35 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.7375 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAGC 10 0.006830828 145.0 6 ACCAAAA 10 0.006830828 145.0 5 CATTCCT 10 0.006830828 145.0 5 TTGGCTC 10 0.006830828 145.0 2 CTTTTTC 10 0.006830828 145.0 145 >>END_MODULE Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643777 spots for SRR12670956.sra Written 643777 spots for SRR12670956.sra Read 643781 spots for SRR12670956.sra Written 643781 spots for SRR12670956.sra SRR ids: ['SRR12670956.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jhpzkhid SRR12670956.sra spots: 12875544 blocks: [[1, 643777], [643778, 1287554], [1287555, 1931331], [1931332, 2575108], [2575109, 3218885], [3218886, 3862662], [3862663, 4506439], [4506440, 5150216], [5150217, 5793993], [5793994, 6437770], [6437771, 7081547], [7081548, 7725324], [7725325, 8369101], [8369102, 9012878], [9012879, 9656655], [9656656, 10300432], [10300433, 10944209], [10944210, 11587986], [11587987, 12231763], [12231764, 12875544]] SRR12670956 file size 4353972 SRR12670956 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670956 SRR12670956_1.fastq SRR12670956_2.fastq Input file: SRR12670956_1.fastq Paired file: SRR12670956_2.fastq trimmed: SRR12670956-trimmed-pair1.fastq, SRR12670956-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:37:43 2025 >> started Tue Feb 11 09:37:58 2025 >> done (14.305s) 12875544 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 40962 ( 0.32%) empty read pairs filtered out after trimming by size control 12834558 (99.68%) read pairs available; of these: 1192177 ( 9.29%) trimmed read pairs available after processing 11642381 (90.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 6 0.00% 21 1 0.00% 22 9 0.00% 23 2 0.00% 24 7 0.00% 25 15 0.00% 26 12 0.00% 27 12 0.00% 28 12 0.00% 29 16 0.00% 30 11 0.00% 31 18 0.00% 32 13 0.00% 33 17 0.00% 34 24 0.00% 35 12 0.00% 36 16 0.00% 37 13 0.00% 38 18 0.00% 39 17 0.00% 40 23 0.00% 41 15 0.00% 42 23 0.00% 43 24 0.00% 44 21 0.00% 45 36 0.00% 46 23 0.00% 47 26 0.00% 48 42 0.00% 49 39 0.00% 50 50 0.00% 51 60 0.00% 52 60 0.00% 53 78 0.00% 54 66 0.00% 55 84 0.00% 56 99 0.00% 57 121 0.00% 58 105 0.00% 59 123 0.00% 60 168 0.00% 61 186 0.00% 62 222 0.00% 63 272 0.00% 64 322 0.00% 65 322 0.00% 66 343 0.00% 67 397 0.00% 68 434 0.00% 69 493 0.00% 70 588 0.00% 71 718 0.01% 72 784 0.01% 73 919 0.01% 74 960 0.01% 75 1130 0.01% 76 1257 0.01% 77 1315 0.01% 78 1471 0.01% 79 1661 0.01% 80 1832 0.01% 81 2060 0.02% 82 2279 0.02% 83 2530 0.02% 84 2723 0.02% 85 3221 0.03% 86 3489 0.03% 87 3623 0.03% 88 4048 0.03% 89 4150 0.03% 90 4379 0.03% 91 4840 0.04% 92 5032 0.04% 93 5647 0.04% 94 5845 0.05% 95 6280 0.05% 96 6871 0.05% 97 7078 0.06% 98 7264 0.06% 99 7804 0.06% 100 8225 0.06% 101 8253 0.06% 102 8807 0.07% 103 9315 0.07% 104 9937 0.08% 105 10413 0.08% 106 10885 0.08% 107 11461 0.09% 108 11644 0.09% 109 11935 0.09% 110 12353 0.10% 111 12881 0.10% 112 13240 0.10% 113 13620 0.11% 114 14550 0.11% 115 15099 0.12% 116 15627 0.12% 117 16242 0.13% 118 16882 0.13% 119 17250 0.13% 120 17812 0.14% 121 18326 0.14% 122 19219 0.15% 123 19192 0.15% 124 20089 0.16% 125 20406 0.16% 126 21454 0.17% 127 21934 0.17% 128 22268 0.17% 129 23334 0.18% 130 24145 0.19% 131 24530 0.19% 132 24614 0.19% 133 25396 0.20% 134 26079 0.20% 135 26260 0.20% 136 27062 0.21% 137 27607 0.22% 138 28818 0.22% 139 30158 0.23% 140 30239 0.24% 141 30650 0.24% 142 32103 0.25% 143 31893 0.25% 144 32520 0.25% 145 33352 0.26% 146 33646 0.26% 147 35042 0.27% 148 35569 0.28% 149 36226 0.28% 150 37287 0.29% 151 11642381 90.71% 12834558 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=23 prefix-density=0.79 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=44.49 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.2 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.64 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=14.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.7 sequence=AGTACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGT SRR12670956 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:39:03 Started mapping on | Feb 11 09:39:04 Finished on | Feb 11 09:41:54 Mapping speed, Million of reads per hour | 271.79 Number of input reads | 12834558 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11563938 Uniquely mapped reads % | 90.10% Average mapped length | 296.37 Number of splices: Total | 10441411 Number of splices: Annotated (sjdb) | 10273491 Number of splices: GT/AG | 10189402 Number of splices: GC/AG | 219252 Number of splices: AT/AC | 6969 Number of splices: Non-canonical | 25788 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278689 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 45337 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.27% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991931 991931 991931 N_multimapping 278689 278689 278689 N_noFeature 275624 11333680 321259 N_ambiguous 270756 618 86017 UnstrandedReadsAssigned:11017558 PositiveStrandReadsAssigned:229640 NegativeStrandReadsAssigned:11156662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670956 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670956-trimmed-pair1.fastq SRR12670956-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,834,558 reads, 11,137,382 reads pseudoaligned [quant] estimated average fragment length: 247.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR12670956.ke.tsv 34699 SRR12670956.se.tsv 87100 total ==> SRR12670956.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.19 166 6.29871 Potri.005G024800.1.v4.1 1035 788.191 216 18.4175 Potri.004G059700.1.v4.1 961 714.244 4 0.376377 Potri.007G009000.2.v4.1 1416 1169.19 0 0 Potri.003G141000.2.v4.1 2943 2696.19 553 13.7843 Potri.016G087400.1.v4.1 270 79.4702 367 310.364 Potri.015G069301.1.v4.1 564 324.129 0 0 Potri.010G195200.1.v4.1 1773 1526.19 33 1.45316 Potri.012G127500.1.v4.1 977 730.22 107 9.8478 ==> SRR12670956.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 24 SRR12670956 completed mapping pipeline successfully