Starting /dee2/code/volunteer_pipeline.sh SRR12670957 current disk space = 3054429626368 free memory = 1358527388 SRR12670957 SRAfilesize a22b134d95a2d04fd1ef0985dd19bc45 SRR12670957.sra SRR12670957.sra file validated SRR12670957 is paired end SRR12670957 is conventional basespace SRR12670957 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670957_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48625 37.0 37.0 37.0 37.0 37.0 2 36.434 37.0 37.0 37.0 37.0 37.0 3 36.472 37.0 37.0 37.0 37.0 37.0 4 36.581 37.0 37.0 37.0 37.0 37.0 5 36.6105 37.0 37.0 37.0 37.0 37.0 6 36.6015 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.6755 37.0 37.0 37.0 37.0 37.0 9 36.602 37.0 37.0 37.0 37.0 37.0 10-14 36.5909 37.0 37.0 37.0 37.0 37.0 15-19 36.5835 37.0 37.0 37.0 37.0 37.0 20-24 36.511900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.503 37.0 37.0 37.0 37.0 37.0 30-34 36.45590000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.477 37.0 37.0 37.0 37.0 37.0 40-44 36.4636 37.0 37.0 37.0 37.0 37.0 45-49 36.4448 37.0 37.0 37.0 37.0 37.0 50-54 36.4045 37.0 37.0 37.0 37.0 37.0 55-59 36.3847 37.0 37.0 37.0 37.0 37.0 60-64 36.350100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3361 37.0 37.0 37.0 37.0 37.0 70-74 36.3627 37.0 37.0 37.0 37.0 37.0 75-79 36.368399999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3193 37.0 37.0 37.0 37.0 37.0 85-89 36.2378 37.0 37.0 37.0 37.0 37.0 90-94 36.254 37.0 37.0 37.0 37.0 37.0 95-99 36.2101 37.0 37.0 37.0 37.0 37.0 100-104 36.244299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.161500000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.196299999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1208 37.0 37.0 37.0 37.0 37.0 120-124 36.07809999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.10850000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.839999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8632 37.0 37.0 37.0 37.0 37.0 140-144 35.777499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7517 37.0 37.0 37.0 37.0 37.0 150-151 35.5255 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 5.0 27 11.0 28 18.0 29 25.0 30 16.0 31 49.0 32 62.0 33 75.0 34 116.0 35 254.0 36 2774.0 37 590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.010002500625156 13.678419604901226 5.901475368842211 40.41010252563141 2 19.3 12.375 36.075 32.25 3 17.75 14.149999999999999 28.15 39.95 4 23.075000000000003 21.349999999999998 23.45 32.125 5 25.025 29.125 23.875 21.975 6 21.875 32.525 22.575 23.025000000000002 7 15.875 27.775 39.425 16.925 8 16.3 28.849999999999998 31.574999999999996 23.275000000000002 9 17.424999999999997 24.025 34.599999999999994 23.95 10-14 19.45 30.845 27.505000000000003 22.2 15-19 20.04 29.15 27.3 23.51 20-24 20.165 28.38 27.36 24.095 25-29 19.645000000000003 28.384999999999998 28.265 23.705000000000002 30-34 19.365 28.349999999999998 27.93 24.355 35-39 20.225 28.395 27.384999999999998 23.995 40-44 19.935 28.775000000000002 27.565 23.724999999999998 45-49 20.244999999999997 28.499999999999996 27.560000000000002 23.695 50-54 20.48 28.194999999999997 27.175 24.15 55-59 20.4 28.53 28.17 22.900000000000002 60-64 20.62 28.4 27.150000000000002 23.830000000000002 65-69 20.21 28.29 27.875 23.625 70-74 20.175 28.79 27.115000000000002 23.919999999999998 75-79 20.57 27.79 27.555000000000003 24.085 80-84 20.625 27.944999999999997 27.615000000000002 23.815 85-89 20.419999999999998 28.4 26.955000000000002 24.224999999999998 90-94 20.22 27.6 27.29 24.89 95-99 20.16 28.315 27.27 24.255 100-104 20.349999999999998 28.535 27.065 24.05 105-109 20.655 27.66 27.3 24.385 110-114 20.630000000000003 27.54 28.285 23.544999999999998 115-119 21.099999999999998 27.875 27.18 23.845 120-124 21.005 28.115000000000002 27.275 23.605 125-129 20.855 27.045 27.63 24.47 130-134 20.990000000000002 26.8 27.655 24.555 135-139 21.085 27.034999999999997 27.315 24.565 140-144 21.505 27.250000000000004 26.805 24.44 145-149 20.895 27.700000000000003 26.85 24.555 150-151 20.6375 26.775 27.8375 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 5.0 25 6.0 26 6.0 27 9.5 28 15.0 29 15.0 30 19.5 31 32.0 32 38.0 33 52.0 34 73.5 35 82.0 36 92.5 37 105.5 38 121.5 39 146.0 40 155.5 41 185.0 42 214.5 43 218.0 44 233.5 45 249.5 46 230.0 47 209.0 48 229.5 49 220.0 50 190.5 51 162.0 52 141.0 53 133.5 54 103.5 55 69.0 56 53.5 57 45.5 58 31.5 59 24.0 60 18.0 61 13.0 62 12.0 63 5.5 64 1.0 65 3.5 66 5.0 67 3.0 68 1.0 69 3.0 70 3.0 71 1.0 72 0.5 73 3.0 74 3.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.44990339497654 81.925 2 8.749654982059067 15.85 3 0.7452387524151256 2.025 4 0.05520287054926856 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACCC 10 0.006830828 145.0 2 CCACCCA 10 0.006830828 145.0 3 CCAGGGC 10 0.006830828 145.0 145 >>END_MODULE SRR12670957 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670957_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.334 37.0 37.0 37.0 37.0 37.0 2 36.271 37.0 37.0 37.0 37.0 37.0 3 36.2425 37.0 37.0 37.0 37.0 37.0 4 36.432 37.0 37.0 37.0 37.0 37.0 5 36.468 37.0 37.0 37.0 37.0 37.0 6 36.4965 37.0 37.0 37.0 37.0 37.0 7 36.4635 37.0 37.0 37.0 37.0 37.0 8 36.478 37.0 37.0 37.0 37.0 37.0 9 36.438 37.0 37.0 37.0 37.0 37.0 10-14 36.4787 37.0 37.0 37.0 37.0 37.0 15-19 36.4824 37.0 37.0 37.0 37.0 37.0 20-24 36.4536 37.0 37.0 37.0 37.0 37.0 25-29 36.4382 37.0 37.0 37.0 37.0 37.0 30-34 36.427 37.0 37.0 37.0 37.0 37.0 35-39 36.376400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3414 37.0 37.0 37.0 37.0 37.0 45-49 36.3772 37.0 37.0 37.0 37.0 37.0 50-54 36.3668 37.0 37.0 37.0 37.0 37.0 55-59 36.3375 37.0 37.0 37.0 37.0 37.0 60-64 36.314 37.0 37.0 37.0 37.0 37.0 65-69 36.3189 37.0 37.0 37.0 37.0 37.0 70-74 36.3125 37.0 37.0 37.0 37.0 37.0 75-79 36.25500000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2747 37.0 37.0 37.0 37.0 37.0 85-89 36.2692 37.0 37.0 37.0 37.0 37.0 90-94 36.2189 37.0 37.0 37.0 37.0 37.0 95-99 36.21849999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.23350000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1528 37.0 37.0 37.0 37.0 37.0 110-114 36.1542 37.0 37.0 37.0 37.0 37.0 115-119 36.17065 37.0 37.0 37.0 37.0 37.0 120-124 36.060199999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0025 37.0 37.0 37.0 37.0 37.0 130-134 36.003499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9969 37.0 37.0 37.0 37.0 37.0 140-144 35.98775 37.0 37.0 37.0 37.0 37.0 145-149 35.8003 37.0 37.0 37.0 37.0 37.0 150-151 35.400499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 2.0 23 2.0 24 7.0 25 4.0 26 3.0 27 11.0 28 10.0 29 24.0 30 20.0 31 33.0 32 35.0 33 71.0 34 106.0 35 330.0 36 2679.0 37 657.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 24.575 10.875 26.1 2 30.3 25.924999999999997 28.325 15.45 3 20.525 28.449999999999996 31.974999999999998 19.05 4 23.3 34.575 24.275 17.849999999999998 5 27.925 34.825 21.05 16.2 6 20.325 39.975 22.5 17.2 7 21.2 22.900000000000002 36.875 19.025 8 22.125 26.35 27.675 23.849999999999998 9 22.05 23.875 30.725 23.35 10-14 23.724999999999998 29.205 25.28 21.790000000000003 15-19 24.05 28.615000000000002 26.43 20.905 20-24 24.104999999999997 28.4 26.55 20.945 25-29 23.7 28.16 26.919999999999998 21.22 30-34 23.945 28.18 26.985 20.89 35-39 23.265 27.675 26.985 22.075 40-44 24.325 28.084999999999997 26.765 20.825 45-49 24.104999999999997 27.99 26.41 21.495 50-54 23.97 27.800000000000004 27.11 21.12 55-59 23.669999999999998 27.845 27.255000000000003 21.23 60-64 23.990000000000002 28.285 26.150000000000002 21.575 65-69 24.085 26.924999999999997 27.66 21.33 70-74 24.58 27.089999999999996 26.919999999999998 21.41 75-79 24.235 28.075 26.974999999999998 20.715 80-84 24.365000000000002 28.205000000000002 26.46 20.97 85-89 24.26 27.944999999999997 26.369999999999997 21.425 90-94 24.154999999999998 28.194999999999997 26.25 21.4 95-99 23.565 28.095 26.875 21.465 100-104 24.675 28.155 26.474999999999998 20.695 105-109 24.435000000000002 28.249999999999996 27.189999999999998 20.125 110-114 24.305 27.825 27.52 20.349999999999998 115-119 24.466223311165557 28.07140357017851 27.051352567628385 20.41102055102755 120-124 24.38 27.92 26.955000000000002 20.745 125-129 24.675 27.445000000000004 27.169999999999998 20.71 130-134 24.565 27.250000000000004 27.455000000000002 20.73 135-139 24.610000000000003 27.825 26.950000000000003 20.615 140-144 24.70123506175309 27.901395069753487 26.696334816740837 20.701035051752587 145-149 25.900000000000002 27.644999999999996 26.805 19.650000000000002 150-151 25.3 27.925 26.5 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 1.5 27 4.5 28 7.5 29 10.0 30 12.5 31 15.0 32 20.5 33 22.5 34 27.5 35 46.0 36 67.0 37 86.5 38 103.5 39 141.5 40 180.0 41 192.5 42 222.5 43 261.5 44 273.0 45 273.0 46 276.0 47 271.0 48 243.5 49 225.0 50 200.0 51 155.5 52 128.5 53 112.5 54 89.5 55 63.0 56 52.5 57 49.0 58 41.0 59 30.5 60 21.5 61 13.5 62 10.5 63 12.0 64 8.0 65 2.5 66 2.0 67 1.5 68 0.5 69 1.5 70 2.5 71 2.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.68613943235052 82.27499999999999 2 8.597409754753375 15.6 3 0.5786718104160926 1.575 4 0.11022320198401765 0.4 5 0.0 0.0 6 0.027555800496004413 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.625 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551726 spots for SRR12670957.sra Written 551726 spots for SRR12670957.sra Read 551739 spots for SRR12670957.sra Written 551739 spots for SRR12670957.sra SRR ids: ['SRR12670957.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9qjugbs7 SRR12670957.sra spots: 11034533 blocks: [[1, 551726], [551727, 1103452], [1103453, 1655178], [1655179, 2206904], [2206905, 2758630], [2758631, 3310356], [3310357, 3862082], [3862083, 4413808], [4413809, 4965534], [4965535, 5517260], [5517261, 6068986], [6068987, 6620712], [6620713, 7172438], [7172439, 7724164], [7724165, 8275890], [8275891, 8827616], [8827617, 9379342], [9379343, 9931068], [9931069, 10482794], [10482795, 11034533]] SRR12670957 file size 3728316 SRR12670957 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670957 SRR12670957_1.fastq SRR12670957_2.fastq Input file: SRR12670957_1.fastq Paired file: SRR12670957_2.fastq trimmed: SRR12670957-trimmed-pair1.fastq, SRR12670957-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:42:21 2025 >> started Tue Feb 11 09:42:33 2025 >> done (12.505s) 11034533 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 4131 ( 0.04%) empty read pairs filtered out after trimming by size control 11030366 (99.96%) read pairs available; of these: 700942 ( 6.35%) trimmed read pairs available after processing 10329424 (93.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 11 0.00% 28 3 0.00% 29 5 0.00% 30 5 0.00% 31 6 0.00% 32 4 0.00% 33 9 0.00% 34 5 0.00% 35 19 0.00% 36 9 0.00% 37 8 0.00% 38 10 0.00% 39 8 0.00% 40 9 0.00% 41 12 0.00% 42 12 0.00% 43 15 0.00% 44 18 0.00% 45 19 0.00% 46 22 0.00% 47 28 0.00% 48 21 0.00% 49 40 0.00% 50 28 0.00% 51 55 0.00% 52 56 0.00% 53 58 0.00% 54 41 0.00% 55 60 0.00% 56 49 0.00% 57 60 0.00% 58 71 0.00% 59 107 0.00% 60 119 0.00% 61 149 0.00% 62 152 0.00% 63 169 0.00% 64 161 0.00% 65 212 0.00% 66 200 0.00% 67 225 0.00% 68 283 0.00% 69 307 0.00% 70 369 0.00% 71 415 0.00% 72 481 0.00% 73 555 0.01% 74 585 0.01% 75 661 0.01% 76 773 0.01% 77 797 0.01% 78 922 0.01% 79 1011 0.01% 80 1054 0.01% 81 1164 0.01% 82 1386 0.01% 83 1487 0.01% 84 1601 0.01% 85 1870 0.02% 86 2015 0.02% 87 2160 0.02% 88 2271 0.02% 89 2456 0.02% 90 2527 0.02% 91 2682 0.02% 92 2855 0.03% 93 3062 0.03% 94 3352 0.03% 95 3800 0.03% 96 3918 0.04% 97 4210 0.04% 98 4328 0.04% 99 4535 0.04% 100 4781 0.04% 101 4813 0.04% 102 4962 0.04% 103 5366 0.05% 104 5786 0.05% 105 5752 0.05% 106 6069 0.06% 107 6494 0.06% 108 6497 0.06% 109 6937 0.06% 110 7041 0.06% 111 7575 0.07% 112 7681 0.07% 113 7922 0.07% 114 8176 0.07% 115 8468 0.08% 116 8843 0.08% 117 9484 0.09% 118 9555 0.09% 119 9853 0.09% 120 10276 0.09% 121 10446 0.09% 122 10538 0.10% 123 11128 0.10% 124 11294 0.10% 125 11663 0.11% 126 12216 0.11% 127 12858 0.12% 128 12869 0.12% 129 13330 0.12% 130 13778 0.12% 131 14238 0.13% 132 14631 0.13% 133 14893 0.14% 134 15344 0.14% 135 15921 0.14% 136 16154 0.15% 137 16524 0.15% 138 16946 0.15% 139 17961 0.16% 140 17964 0.16% 141 18679 0.17% 142 18791 0.17% 143 19213 0.17% 144 19990 0.18% 145 20280 0.18% 146 20466 0.19% 147 20967 0.19% 148 22065 0.20% 149 22216 0.20% 150 23037 0.21% 151 10329424 93.65% 11030366 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=32 prefix-density=0.95 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.18 sequence-density-rank=29 fanout-score=6.43 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=2.6 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.71 prefix-fanout=2.0 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=10.57 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR12670957 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:43:34 Started mapping on | Feb 11 09:43:34 Finished on | Feb 11 09:44:49 Mapping speed, Million of reads per hour | 529.46 Number of input reads | 11030366 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 10269965 Uniquely mapped reads % | 93.11% Average mapped length | 297.89 Number of splices: Total | 9799136 Number of splices: Annotated (sjdb) | 9651761 Number of splices: GT/AG | 9580314 Number of splices: GC/AG | 190809 Number of splices: AT/AC | 5440 Number of splices: Non-canonical | 22573 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259243 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 244356 % of reads mapped to too many loci | 2.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501158 501158 501158 N_multimapping 259243 259243 259243 N_noFeature 336022 10062110 384588 N_ambiguous 231067 791 71364 UnstrandedReadsAssigned:9702876 PositiveStrandReadsAssigned:207064 NegativeStrandReadsAssigned:9814013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670957 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670957-trimmed-pair1.fastq SRR12670957-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,030,366 reads, 9,976,970 reads pseudoaligned [quant] estimated average fragment length: 264.512 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52401 SRR12670957.ke.tsv 34699 SRR12670957.se.tsv 87100 total ==> SRR12670957.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.49 231 9.87931 Potri.005G024800.1.v4.1 1035 771.488 152 14.7836 Potri.004G059700.1.v4.1 961 697.549 0 0 Potri.007G009000.2.v4.1 1416 1152.49 0 0 Potri.003G141000.2.v4.1 2943 2679.49 357.562 10.013 Potri.016G087400.1.v4.1 270 72.8998 436.279 449.058 Potri.015G069301.1.v4.1 564 309.219 0 0 Potri.010G195200.1.v4.1 1773 1509.49 41 2.03807 Potri.012G127500.1.v4.1 977 713.534 41 4.31156 ==> SRR12670957.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 110 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR12670957 completed mapping pipeline successfully