Starting /dee2/code/volunteer_pipeline.sh SRR12670958 current disk space = 3053613371392 free memory = 1485978848 SRR12670958 SRAfilesize e8515a50686ba9270cd9d6510ead0eb2 SRR12670958.sra SRR12670958.sra file validated SRR12670958 is paired end SRR12670958 is conventional basespace SRR12670958 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670958_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45675 37.0 37.0 37.0 37.0 37.0 2 36.432 37.0 37.0 37.0 37.0 37.0 3 36.496 37.0 37.0 37.0 37.0 37.0 4 36.589 37.0 37.0 37.0 37.0 37.0 5 36.6095 37.0 37.0 37.0 37.0 37.0 6 36.602 37.0 37.0 37.0 37.0 37.0 7 36.548 37.0 37.0 37.0 37.0 37.0 8 36.562 37.0 37.0 37.0 37.0 37.0 9 36.644 37.0 37.0 37.0 37.0 37.0 10-14 36.606 37.0 37.0 37.0 37.0 37.0 15-19 36.5572 37.0 37.0 37.0 37.0 37.0 20-24 36.536699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5184 37.0 37.0 37.0 37.0 37.0 30-34 36.5312 37.0 37.0 37.0 37.0 37.0 35-39 36.44949999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4225 37.0 37.0 37.0 37.0 37.0 45-49 36.4532 37.0 37.0 37.0 37.0 37.0 50-54 36.3771 37.0 37.0 37.0 37.0 37.0 55-59 36.393600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3814 37.0 37.0 37.0 37.0 37.0 65-69 36.3445 37.0 37.0 37.0 37.0 37.0 70-74 36.3198 37.0 37.0 37.0 37.0 37.0 75-79 36.3245 37.0 37.0 37.0 37.0 37.0 80-84 36.2935 37.0 37.0 37.0 37.0 37.0 85-89 36.2833 37.0 37.0 37.0 37.0 37.0 90-94 36.3285 37.0 37.0 37.0 37.0 37.0 95-99 36.227 37.0 37.0 37.0 37.0 37.0 100-104 36.1984 37.0 37.0 37.0 37.0 37.0 105-109 36.171499999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1702 37.0 37.0 37.0 37.0 37.0 115-119 36.099000000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0822 37.0 37.0 37.0 37.0 37.0 125-129 36.07940000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.8654 37.0 37.0 37.0 37.0 37.0 135-139 35.9317 37.0 37.0 37.0 37.0 37.0 140-144 35.7979 37.0 37.0 37.0 37.0 37.0 145-149 35.70035 37.0 37.0 37.0 37.0 37.0 150-151 35.57625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 2.0 25 3.0 26 3.0 27 10.0 28 8.0 29 15.0 30 39.0 31 44.0 32 77.0 33 72.0 34 131.0 35 252.0 36 2622.0 37 719.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.509877469367346 14.253563390847713 7.201800450112527 39.034758689672415 2 19.7 12.5 36.25 31.55 3 16.825000000000003 14.875 27.375 40.925 4 22.3 21.75 24.65 31.3 5 23.825 26.474999999999998 26.5 23.200000000000003 6 20.549999999999997 33.625 22.975 22.85 7 16.125 29.15 38.375 16.35 8 16.1 28.725 32.625 22.55 9 16.7 23.724999999999998 37.3 22.275 10-14 18.675 31.505 28.18 21.64 15-19 19.185 28.93 27.85 24.035 20-24 19.99 29.515 27.705000000000002 22.79 25-29 19.175 29.909999999999997 27.71 23.205000000000002 30-34 19.42 29.299999999999997 27.35 23.93 35-39 19.915 29.465000000000003 27.315 23.305 40-44 19.665 29.520000000000003 27.744999999999997 23.07 45-49 19.59 29.145 27.57 23.695 50-54 19.794999999999998 29.035 27.279999999999998 23.89 55-59 20.085 28.865000000000002 27.534999999999997 23.515 60-64 19.73 28.765 27.800000000000004 23.705000000000002 65-69 20.200000000000003 28.18 27.625 23.995 70-74 20.01 28.87 27.005000000000003 24.115000000000002 75-79 20.005 28.975 27.939999999999998 23.080000000000002 80-84 20.330000000000002 28.28 27.72 23.669999999999998 85-89 19.985 28.565 27.215 24.235 90-94 20.155 28.139999999999997 27.33 24.375 95-99 20.93 27.725 27.74 23.605 100-104 20.424999999999997 28.425 27.515 23.635 105-109 20.4 27.96 27.375 24.265 110-114 21.224999999999998 28.49 27.1 23.185 115-119 21.224999999999998 28.02 27.195000000000004 23.56 120-124 20.905 27.83 27.195000000000004 24.07 125-129 21.05 28.42 26.775 23.755000000000003 130-134 21.185000000000002 28.785 26.58 23.45 135-139 21.595 27.700000000000003 27.250000000000004 23.455000000000002 140-144 21.525 27.625 27.05 23.799999999999997 145-149 20.58602930146507 27.85139256962848 26.786339316965847 24.776238811940594 150-151 21.2625 27.5625 27.212500000000002 23.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.5 20 1.0 21 1.5 22 2.0 23 1.5 24 2.5 25 2.5 26 4.5 27 8.5 28 11.0 29 14.5 30 25.5 31 32.5 32 39.0 33 54.0 34 78.0 35 104.0 36 114.5 37 122.5 38 124.5 39 142.5 40 191.5 41 210.5 42 210.0 43 225.5 44 230.0 45 238.0 46 249.5 47 254.5 48 233.0 49 212.5 50 194.0 51 143.5 52 112.5 53 94.0 54 70.0 55 59.5 56 51.0 57 34.5 58 23.0 59 19.0 60 15.5 61 12.0 62 8.0 63 3.5 64 1.5 65 2.0 66 1.5 67 1.5 68 1.5 69 0.0 70 1.0 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.03903243540407 82.8 2 8.136338647608577 14.799999999999999 3 0.6871907641561297 1.875 4 0.10995052226498077 0.4 5 0.027487630566245192 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACACTTGATCCTTTGCATTCAAACAGGATTTTCTTTAGGTCAGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.3375 0.0 0.0 0.0 0.0 130-131 3.5625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670958 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670958_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1555 37.0 37.0 37.0 37.0 37.0 2 36.0575 37.0 37.0 37.0 37.0 37.0 3 36.088 37.0 37.0 37.0 37.0 37.0 4 36.2465 37.0 37.0 37.0 37.0 37.0 5 36.337 37.0 37.0 37.0 37.0 37.0 6 36.253 37.0 37.0 37.0 37.0 37.0 7 36.282 37.0 37.0 37.0 37.0 37.0 8 36.3185 37.0 37.0 37.0 37.0 37.0 9 36.401 37.0 37.0 37.0 37.0 37.0 10-14 36.367399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.293800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3244 37.0 37.0 37.0 37.0 37.0 25-29 36.2466 37.0 37.0 37.0 37.0 37.0 30-34 36.2221 37.0 37.0 37.0 37.0 37.0 35-39 36.1799 37.0 37.0 37.0 37.0 37.0 40-44 36.1903 37.0 37.0 37.0 37.0 37.0 45-49 36.209500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1636 37.0 37.0 37.0 37.0 37.0 55-59 36.1496 37.0 37.0 37.0 37.0 37.0 60-64 36.1905 37.0 37.0 37.0 37.0 37.0 65-69 36.1962 37.0 37.0 37.0 37.0 37.0 70-74 36.1014 37.0 37.0 37.0 37.0 37.0 75-79 36.0375 37.0 37.0 37.0 37.0 37.0 80-84 36.064299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9913 37.0 37.0 37.0 37.0 37.0 90-94 36.0663 37.0 37.0 37.0 37.0 37.0 95-99 36.068799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0259 37.0 37.0 37.0 37.0 37.0 105-109 35.916399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9567 37.0 37.0 37.0 37.0 37.0 115-119 35.85425 37.0 37.0 37.0 37.0 37.0 120-124 35.8112 37.0 37.0 37.0 37.0 37.0 125-129 35.7611 37.0 37.0 37.0 37.0 37.0 130-134 35.749 37.0 37.0 37.0 37.0 37.0 135-139 35.711999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.61305 37.0 37.0 37.0 37.0 37.0 145-149 35.407399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.21875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 3.0 21 0.0 22 2.0 23 2.0 24 1.0 25 6.0 26 9.0 27 15.0 28 23.0 29 14.0 30 40.0 31 38.0 32 60.0 33 87.0 34 152.0 35 420.0 36 2654.0 37 465.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05 25.35 9.9 26.700000000000003 2 28.4 26.6 29.525000000000002 15.475 3 20.025000000000002 27.650000000000002 33.2 19.125 4 22.475 31.8 25.174999999999997 20.549999999999997 5 27.700000000000003 36.8 20.150000000000002 15.35 6 20.625 41.25 22.1 16.025 7 21.575 23.75 36.625 18.05 8 21.775 27.05 28.775000000000002 22.400000000000002 9 23.150000000000002 23.549999999999997 29.675 23.625 10-14 24.185000000000002 28.999999999999996 25.77 21.044999999999998 15-19 23.64 28.07 27.400000000000002 20.89 20-24 23.735 28.555000000000003 27.060000000000002 20.65 25-29 23.580000000000002 28.96 26.87 20.59 30-34 23.35 28.060000000000002 27.515 21.075 35-39 24.215 27.474999999999998 27.175 21.135 40-44 24.01 27.900000000000002 27.450000000000003 20.64 45-49 23.635 27.845 27.134999999999998 21.385 50-54 23.515 28.115000000000002 27.11 21.26 55-59 24.044999999999998 28.110000000000003 26.979999999999997 20.865000000000002 60-64 23.48 27.82 27.555000000000003 21.145 65-69 23.515 27.62 27.139999999999997 21.725 70-74 23.76 27.74 27.665 20.835 75-79 23.41 27.985 27.415 21.19 80-84 23.974999999999998 28.065 27.16 20.8 85-89 23.41 27.275 27.74 21.575 90-94 23.98 27.655 27.73 20.635 95-99 23.96 27.775 27.275 20.990000000000002 100-104 23.68 27.68 28.03 20.61 105-109 23.5 27.639999999999997 27.96 20.9 110-114 24.07 27.529999999999998 27.889999999999997 20.51 115-119 24.046202310115504 27.821391069553474 27.461373068653433 20.671033551677585 120-124 24.33 28.1 27.305 20.265 125-129 24.73 27.415 28.26 19.595000000000002 130-134 24.84 26.884999999999998 27.900000000000002 20.375 135-139 24.2 28.235 27.455000000000002 20.11 140-144 24.441222061103055 27.521376068803438 27.551377568878443 20.48602430121506 145-149 25.595000000000002 27.595 26.795 20.015 150-151 25.8125 27.437499999999996 27.1 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 3.0 24 2.5 25 1.5 26 3.0 27 3.0 28 4.5 29 7.0 30 11.0 31 21.0 32 26.0 33 27.0 34 37.5 35 51.5 36 74.0 37 102.0 38 127.0 39 150.0 40 192.0 41 224.5 42 238.5 43 246.0 44 262.0 45 275.0 46 271.5 47 261.5 48 242.5 49 213.5 50 181.0 51 152.5 52 127.0 53 103.0 54 83.0 55 70.0 56 54.0 57 44.5 58 28.0 59 18.5 60 16.0 61 8.5 62 7.5 63 6.0 64 1.0 65 1.0 66 0.5 67 1.0 68 2.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.28050452426652 83.22500000000001 2 7.869481765834934 14.35 3 0.7403345215245407 2.025 4 0.10967918837400603 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.2125000000000004 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.3125 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTAG 10 0.006830828 145.0 5 >>END_MODULE Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra Read 579367 spots for SRR12670958.sra Written 579367 spots for SRR12670958.sra Read 579351 spots for SRR12670958.sra Written 579351 spots for SRR12670958.sra SRR ids: ['SRR12670958.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_spzzypaq SRR12670958.sra spots: 11587036 blocks: [[1, 579351], [579352, 1158702], [1158703, 1738053], [1738054, 2317404], [2317405, 2896755], [2896756, 3476106], [3476107, 4055457], [4055458, 4634808], [4634809, 5214159], [5214160, 5793510], [5793511, 6372861], [6372862, 6952212], [6952213, 7531563], [7531564, 8110914], [8110915, 8690265], [8690266, 9269616], [9269617, 9848967], [9848968, 10428318], [10428319, 11007669], [11007670, 11587036]] SRR12670958 file size 3916081 SRR12670958 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670958 SRR12670958_1.fastq SRR12670958_2.fastq Input file: SRR12670958_1.fastq Paired file: SRR12670958_2.fastq trimmed: SRR12670958-trimmed-pair1.fastq, SRR12670958-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:10:02 2025 >> started Tue Feb 11 10:10:15 2025 >> done (12.599s) 11587036 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 10294 ( 0.09%) empty read pairs filtered out after trimming by size control 11576715 (99.91%) read pairs available; of these: 771119 ( 6.66%) trimmed read pairs available after processing 10805596 (93.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 8 0.00% 25 5 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 4 0.00% 33 3 0.00% 34 10 0.00% 35 9 0.00% 36 13 0.00% 37 12 0.00% 38 6 0.00% 39 16 0.00% 40 7 0.00% 41 6 0.00% 42 9 0.00% 43 11 0.00% 44 15 0.00% 45 13 0.00% 46 14 0.00% 47 21 0.00% 48 18 0.00% 49 23 0.00% 50 35 0.00% 51 28 0.00% 52 49 0.00% 53 52 0.00% 54 46 0.00% 55 38 0.00% 56 51 0.00% 57 63 0.00% 58 77 0.00% 59 89 0.00% 60 89 0.00% 61 119 0.00% 62 148 0.00% 63 157 0.00% 64 155 0.00% 65 161 0.00% 66 219 0.00% 67 227 0.00% 68 247 0.00% 69 283 0.00% 70 302 0.00% 71 368 0.00% 72 382 0.00% 73 478 0.00% 74 551 0.00% 75 569 0.00% 76 661 0.01% 77 736 0.01% 78 847 0.01% 79 884 0.01% 80 979 0.01% 81 1105 0.01% 82 1283 0.01% 83 1394 0.01% 84 1606 0.01% 85 1830 0.02% 86 1905 0.02% 87 1980 0.02% 88 2191 0.02% 89 2278 0.02% 90 2435 0.02% 91 2611 0.02% 92 2994 0.03% 93 3213 0.03% 94 3460 0.03% 95 3753 0.03% 96 4016 0.03% 97 4138 0.04% 98 4532 0.04% 99 4617 0.04% 100 4859 0.04% 101 5000 0.04% 102 5311 0.05% 103 5595 0.05% 104 5921 0.05% 105 6257 0.05% 106 6575 0.06% 107 6793 0.06% 108 7121 0.06% 109 7691 0.07% 110 7773 0.07% 111 7834 0.07% 112 8218 0.07% 113 8529 0.07% 114 8818 0.08% 115 9434 0.08% 116 9665 0.08% 117 10129 0.09% 118 10423 0.09% 119 10960 0.09% 120 11086 0.10% 121 11607 0.10% 122 11674 0.10% 123 12276 0.11% 124 12467 0.11% 125 13170 0.11% 126 13559 0.12% 127 13983 0.12% 128 14650 0.13% 129 15121 0.13% 130 15535 0.13% 131 15809 0.14% 132 16354 0.14% 133 16678 0.14% 134 16922 0.15% 135 17681 0.15% 136 18173 0.16% 137 18791 0.16% 138 19156 0.17% 139 20044 0.17% 140 20518 0.18% 141 21071 0.18% 142 21596 0.19% 143 21521 0.19% 144 22374 0.19% 145 23001 0.20% 146 23297 0.20% 147 23658 0.20% 148 24374 0.21% 149 25249 0.22% 150 26112 0.23% 151 10805596 93.34% 11576715 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.75 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=69.80 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.7 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.56 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=50.29 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.7 sequence=AACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGC SRR12670958 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:11:10 Started mapping on | Feb 11 10:11:11 Finished on | Feb 11 10:12:12 Mapping speed, Million of reads per hour | 683.22 Number of input reads | 11576715 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10397388 Uniquely mapped reads % | 89.81% Average mapped length | 290.79 Number of splices: Total | 9623595 Number of splices: Annotated (sjdb) | 9448924 Number of splices: GT/AG | 9405974 Number of splices: GC/AG | 185774 Number of splices: AT/AC | 5359 Number of splices: Non-canonical | 26488 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 266820 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 54777 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.31% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 912507 912507 912507 N_multimapping 266820 266820 266820 N_noFeature 275168 10222617 316114 N_ambiguous 231558 980 97311 UnstrandedReadsAssigned:9890662 PositiveStrandReadsAssigned:173791 NegativeStrandReadsAssigned:9983963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670958 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670958-trimmed-pair1.fastq SRR12670958-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,576,715 reads, 10,616,243 reads pseudoaligned [quant] estimated average fragment length: 252.509 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52401 SRR12670958.ke.tsv 34699 SRR12670958.se.tsv 87100 total ==> SRR12670958.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.49 211 9.34423 Potri.005G024800.1.v4.1 1035 783.491 136 13.5793 Potri.004G059700.1.v4.1 961 709.537 9 0.992293 Potri.007G009000.2.v4.1 1416 1164.49 0 0 Potri.003G141000.2.v4.1 2943 2691.49 453.97 13.1949 Potri.016G087400.1.v4.1 270 78.331 572 571.262 Potri.015G069301.1.v4.1 564 320.051 0 0 Potri.010G195200.1.v4.1 1773 1521.49 32 1.64533 Potri.012G127500.1.v4.1 977 725.524 106 11.4295 ==> SRR12670958.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 260 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670958 completed mapping pipeline successfully