Starting /dee2/code/volunteer_pipeline.sh SRR12670959 current disk space = 3054828314624 free memory = 1215726284 SRR12670959 SRAfilesize 2c08f3bdf69e09c04a5ab010951abc35 SRR12670959.sra SRR12670959.sra file validated SRR12670959 is paired end SRR12670959 is conventional basespace SRR12670959 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670959_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43575 37.0 37.0 37.0 37.0 37.0 2 36.394 37.0 37.0 37.0 37.0 37.0 3 36.5445 37.0 37.0 37.0 37.0 37.0 4 36.5055 37.0 37.0 37.0 37.0 37.0 5 36.623 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.662 37.0 37.0 37.0 37.0 37.0 8 36.6445 37.0 37.0 37.0 37.0 37.0 9 36.64 37.0 37.0 37.0 37.0 37.0 10-14 36.6001 37.0 37.0 37.0 37.0 37.0 15-19 36.5895 37.0 37.0 37.0 37.0 37.0 20-24 36.5476 37.0 37.0 37.0 37.0 37.0 25-29 36.534499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.468399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.474399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4321 37.0 37.0 37.0 37.0 37.0 45-49 36.3621 37.0 37.0 37.0 37.0 37.0 50-54 36.3714 37.0 37.0 37.0 37.0 37.0 55-59 36.30800000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.2767 37.0 37.0 37.0 37.0 37.0 65-69 36.2868 37.0 37.0 37.0 37.0 37.0 70-74 36.2572 37.0 37.0 37.0 37.0 37.0 75-79 36.251200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2214 37.0 37.0 37.0 37.0 37.0 85-89 36.202099999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.148700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.1272 37.0 37.0 37.0 37.0 37.0 100-104 36.1101 37.0 37.0 37.0 37.0 37.0 105-109 36.0827 37.0 37.0 37.0 37.0 37.0 110-114 36.0698 37.0 37.0 37.0 37.0 37.0 115-119 35.9674 37.0 37.0 37.0 37.0 37.0 120-124 35.9405 37.0 37.0 37.0 37.0 37.0 125-129 35.9362 37.0 37.0 37.0 37.0 37.0 130-134 35.772000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.7996 37.0 37.0 37.0 37.0 37.0 140-144 35.7643 37.0 37.0 37.0 37.0 37.0 145-149 35.651199999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.497 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 0.0 21 0.0 22 5.0 23 7.0 24 6.0 25 3.0 26 4.0 27 9.0 28 23.0 29 16.0 30 29.0 31 44.0 32 57.0 33 85.0 34 134.0 35 224.0 36 2662.0 37 690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.03700925231308 12.303075768942236 5.726431607901975 33.93348337084271 2 18.525 9.5 39.45 32.525 3 15.55 15.525 29.775000000000002 39.15 4 21.775 22.325 25.825 30.075000000000003 5 23.1 28.675 24.9 23.325000000000003 6 20.925 32.775 23.525 22.775000000000002 7 14.7 29.375 39.800000000000004 16.125 8 15.525 27.6 34.575 22.3 9 15.85 22.650000000000002 38.425 23.075000000000003 10-14 19.07 29.945 29.104999999999997 21.88 15-19 19.220000000000002 28.689999999999998 28.365000000000002 23.724999999999998 20-24 19.215 28.84 28.310000000000002 23.635 25-29 20.115 27.794999999999998 28.43 23.66 30-34 19.955000000000002 28.405 27.779999999999998 23.86 35-39 19.965 28.139999999999997 27.985 23.91 40-44 19.634999999999998 29.335 27.994999999999997 23.035 45-49 20.265 28.410000000000004 27.375 23.95 50-54 19.88 28.675 27.405 24.04 55-59 19.935 28.215 27.735 24.115000000000002 60-64 19.525000000000002 28.315 28.689999999999998 23.47 65-69 19.85 28.515 28.27 23.365 70-74 20.200000000000003 28.68 27.395000000000003 23.724999999999998 75-79 19.755 28.82 27.495000000000005 23.93 80-84 20.025000000000002 28.144999999999996 27.82 24.01 85-89 20.395 28.4 27.639999999999997 23.565 90-94 20.01 28.235 27.85 23.905 95-99 20.355 28.005000000000003 28.185 23.455000000000002 100-104 20.200000000000003 28.09 27.750000000000004 23.96 105-109 20.34 28.549999999999997 27.025 24.085 110-114 20.395 28.175 27.800000000000004 23.630000000000003 115-119 20.919999999999998 27.525 28.110000000000003 23.445 120-124 20.03 28.139999999999997 27.71 24.12 125-129 20.355 28.405 27.87 23.369999999999997 130-134 20.535 27.779999999999998 27.915 23.77 135-139 20.375 27.685 28.075 23.865 140-144 20.1 27.98 27.694999999999997 24.224999999999998 145-149 20.330000000000002 27.61 28.235 23.825 150-151 20.4625 28.0875 27.675 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 2.0 21 3.0 22 3.5 23 4.5 24 4.5 25 4.0 26 8.5 27 11.5 28 12.5 29 16.0 30 29.0 31 35.0 32 40.5 33 44.0 34 54.5 35 78.0 36 89.0 37 102.0 38 132.0 39 165.0 40 169.0 41 187.0 42 218.5 43 243.5 44 246.0 45 255.0 46 268.5 47 252.5 48 239.5 49 209.5 50 169.5 51 133.0 52 111.5 53 104.0 54 91.0 55 72.0 56 58.0 57 38.5 58 25.0 59 19.5 60 9.0 61 7.0 62 4.5 63 2.5 64 2.0 65 2.5 66 3.5 67 2.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 89.85547526403558 80.825 2 9.25514174541412 16.650000000000002 3 0.7782101167315175 2.1 4 0.08337965536409116 0.3 5 0.027793218454697052 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAACTCTTAAAACCTTCCCCTCGTTGTCGTCCGGAATGAGTTGGGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.0374999999999996 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.6 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 2.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGTT 10 0.006830828 145.0 4 GTTGGGG 10 0.006830828 145.0 8 CAAAAGT 10 0.006830828 145.0 3 >>END_MODULE SRR12670959 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670959_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2155 37.0 37.0 37.0 37.0 37.0 2 36.2515 37.0 37.0 37.0 37.0 37.0 3 36.17 37.0 37.0 37.0 37.0 37.0 4 36.1035 37.0 37.0 37.0 37.0 37.0 5 36.284 37.0 37.0 37.0 37.0 37.0 6 36.262 37.0 37.0 37.0 37.0 37.0 7 36.246 37.0 37.0 37.0 37.0 37.0 8 36.383 37.0 37.0 37.0 37.0 37.0 9 36.277 37.0 37.0 37.0 37.0 37.0 10-14 36.254599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.235099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2349 37.0 37.0 37.0 37.0 37.0 25-29 36.1705 37.0 37.0 37.0 37.0 37.0 30-34 36.2066 37.0 37.0 37.0 37.0 37.0 35-39 36.130500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.119899999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.137 37.0 37.0 37.0 37.0 37.0 50-54 36.14190000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.042199999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0663 37.0 37.0 37.0 37.0 37.0 65-69 36.1168 37.0 37.0 37.0 37.0 37.0 70-74 35.9607 37.0 37.0 37.0 37.0 37.0 75-79 35.971000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0204 37.0 37.0 37.0 37.0 37.0 85-89 35.928000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.936 37.0 37.0 37.0 37.0 37.0 95-99 36.0019 37.0 37.0 37.0 37.0 37.0 100-104 35.923700000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.947799999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.920300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.82955 37.0 37.0 37.0 37.0 37.0 120-124 35.81529999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.702 37.0 37.0 37.0 37.0 37.0 130-134 35.7297 37.0 37.0 37.0 37.0 37.0 135-139 35.64 37.0 37.0 37.0 37.0 37.0 140-144 35.66465 37.0 37.0 37.0 37.0 37.0 145-149 35.5029 37.0 37.0 37.0 37.0 37.0 150-151 35.19625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 4.0 15 1.0 16 3.0 17 1.0 18 0.0 19 0.0 20 0.0 21 7.0 22 3.0 23 1.0 24 8.0 25 5.0 26 8.0 27 9.0 28 19.0 29 25.0 30 41.0 31 33.0 32 59.0 33 97.0 34 158.0 35 406.0 36 2659.0 37 450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 26.525 8.825 24.224999999999998 2 28.775000000000002 25.6 29.9 15.725 3 21.075 27.250000000000004 33.25 18.425 4 23.200000000000003 32.550000000000004 24.0 20.25 5 25.424999999999997 36.325 21.25 17.0 6 21.55 41.199999999999996 20.0 17.25 7 20.674999999999997 23.375 37.724999999999994 18.224999999999998 8 20.275000000000002 25.825 29.849999999999998 24.05 9 22.225 24.45 29.15 24.175 10-14 23.494999999999997 29.054999999999996 26.52 20.93 15-19 23.87 28.18 27.634999999999998 20.315 20-24 22.865 29.065 27.27 20.8 25-29 23.595 28.110000000000003 27.275 21.02 30-34 23.09 28.410000000000004 27.88 20.62 35-39 23.23 28.810000000000002 27.015 20.945 40-44 23.535 29.315 26.974999999999998 20.175 45-49 23.185 28.59 27.435 20.79 50-54 23.395 28.435 27.215 20.955 55-59 23.02 27.800000000000004 27.49 21.69 60-64 23.595 27.889999999999997 27.750000000000004 20.765 65-69 23.53 27.589999999999996 27.950000000000003 20.93 70-74 23.974999999999998 28.075 27.165 20.785 75-79 23.380000000000003 27.894999999999996 27.74 20.985 80-84 23.685000000000002 28.189999999999998 27.185 20.94 85-89 23.94 27.495000000000005 27.405 21.16 90-94 23.255 27.93 27.839999999999996 20.974999999999998 95-99 23.855 27.85 27.045 21.25 100-104 23.794999999999998 28.125 27.0 21.08 105-109 24.22 28.744999999999997 26.365 20.669999999999998 110-114 24.5 28.065 26.779999999999998 20.655 115-119 23.896194809740486 28.16640832041602 27.44637231861593 20.49102455122756 120-124 24.495 27.96 27.025 20.52 125-129 24.490000000000002 28.244999999999997 26.865 20.4 130-134 24.11 28.384999999999998 27.084999999999997 20.419999999999998 135-139 24.355 27.189999999999998 27.295 21.16 140-144 24.72123606180309 28.10140507025351 27.29136456822841 19.885994299714984 145-149 25.05 28.08 26.995 19.875 150-151 25.3125 26.875 27.9125 19.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 1.5 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 2.0 22 2.5 23 2.5 24 4.0 25 3.5 26 3.5 27 3.5 28 6.5 29 14.0 30 15.0 31 19.0 32 30.0 33 31.0 34 41.5 35 64.0 36 72.5 37 83.5 38 116.0 39 171.0 40 199.5 41 215.5 42 268.0 43 262.5 44 262.0 45 298.0 46 273.5 47 256.5 48 240.5 49 200.0 50 173.0 51 136.5 52 112.0 53 94.5 54 68.0 55 58.0 56 46.0 57 33.0 58 21.5 59 16.5 60 15.0 61 11.5 62 10.0 63 6.5 64 3.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42582799888672 81.22500000000001 2 8.572223768438631 15.4 3 0.7514611745059838 2.025 4 0.11132758140829391 0.4 5 0.027831895352073477 0.125 6 0.055663790704146954 0.3 7 0.0 0.0 8 0.0 0.0 9 0.027831895352073477 0.22499999999999998 >10 0.027831895352073477 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit GACACAGTCTTGAAAGCATTAAAGCTAGTATTGAAGCACGCAAGCCGGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.0875000000000004 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.4124999999999996 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713977 spots for SRR12670959.sra Written 713977 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra Read 713973 spots for SRR12670959.sra Written 713973 spots for SRR12670959.sra SRR ids: ['SRR12670959.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mp6o517_ SRR12670959.sra spots: 14279464 blocks: [[1, 713973], [713974, 1427946], [1427947, 2141919], [2141920, 2855892], [2855893, 3569865], [3569866, 4283838], [4283839, 4997811], [4997812, 5711784], [5711785, 6425757], [6425758, 7139730], [7139731, 7853703], [7853704, 8567676], [8567677, 9281649], [9281650, 9995622], [9995623, 10709595], [10709596, 11423568], [11423569, 12137541], [12137542, 12851514], [12851515, 13565487], [13565488, 14279464]] SRR12670959 file size 4831086 SRR12670959 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670959 SRR12670959_1.fastq SRR12670959_2.fastq Input file: SRR12670959_1.fastq Paired file: SRR12670959_2.fastq trimmed: SRR12670959-trimmed-pair1.fastq, SRR12670959-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:34:40 2025 >> started Tue Feb 11 09:35:03 2025 >> done (22.782s) 14279464 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 11547 ( 0.08%) empty read pairs filtered out after trimming by size control 14267877 (99.92%) read pairs available; of these: 679834 ( 4.76%) trimmed read pairs available after processing 13588043 (95.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 10 0.00% 23 12 0.00% 24 22 0.00% 25 17 0.00% 26 17 0.00% 27 22 0.00% 28 25 0.00% 29 30 0.00% 30 22 0.00% 31 15 0.00% 32 23 0.00% 33 27 0.00% 34 22 0.00% 35 16 0.00% 36 21 0.00% 37 20 0.00% 38 23 0.00% 39 11 0.00% 40 17 0.00% 41 16 0.00% 42 26 0.00% 43 18 0.00% 44 17 0.00% 45 20 0.00% 46 23 0.00% 47 24 0.00% 48 17 0.00% 49 27 0.00% 50 23 0.00% 51 35 0.00% 52 59 0.00% 53 41 0.00% 54 40 0.00% 55 44 0.00% 56 66 0.00% 57 58 0.00% 58 76 0.00% 59 50 0.00% 60 90 0.00% 61 126 0.00% 62 136 0.00% 63 136 0.00% 64 170 0.00% 65 165 0.00% 66 170 0.00% 67 183 0.00% 68 218 0.00% 69 256 0.00% 70 298 0.00% 71 332 0.00% 72 402 0.00% 73 431 0.00% 74 482 0.00% 75 546 0.00% 76 570 0.00% 77 616 0.00% 78 650 0.00% 79 795 0.01% 80 918 0.01% 81 974 0.01% 82 1101 0.01% 83 1204 0.01% 84 1392 0.01% 85 1531 0.01% 86 1617 0.01% 87 1721 0.01% 88 1879 0.01% 89 1876 0.01% 90 2132 0.01% 91 2319 0.02% 92 2476 0.02% 93 2753 0.02% 94 2975 0.02% 95 3202 0.02% 96 3516 0.02% 97 3568 0.03% 98 3813 0.03% 99 4012 0.03% 100 4174 0.03% 101 4383 0.03% 102 4651 0.03% 103 4944 0.03% 104 5358 0.04% 105 5593 0.04% 106 5806 0.04% 107 5913 0.04% 108 6148 0.04% 109 6320 0.04% 110 6576 0.05% 111 6994 0.05% 112 7335 0.05% 113 7495 0.05% 114 7820 0.05% 115 8102 0.06% 116 8565 0.06% 117 9012 0.06% 118 9222 0.06% 119 9513 0.07% 120 9782 0.07% 121 10055 0.07% 122 10591 0.07% 123 10703 0.08% 124 11631 0.08% 125 11516 0.08% 126 12323 0.09% 127 12431 0.09% 128 12713 0.09% 129 13264 0.09% 130 13723 0.10% 131 13749 0.10% 132 14228 0.10% 133 14631 0.10% 134 15190 0.11% 135 15653 0.11% 136 16007 0.11% 137 16347 0.11% 138 16899 0.12% 139 17737 0.12% 140 18172 0.13% 141 18356 0.13% 142 18865 0.13% 143 19032 0.13% 144 19739 0.14% 145 20301 0.14% 146 20414 0.14% 147 21244 0.15% 148 21948 0.15% 149 22489 0.16% 150 23353 0.16% 151 13588043 95.24% 14267877 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=21 prefix-density=0.63 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=42.80 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.2 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=13 fanout-score=14.66 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=4.1 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12670959 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:35:49 Started mapping on | Feb 11 09:35:49 Finished on | Feb 11 09:37:46 Mapping speed, Million of reads per hour | 439.01 Number of input reads | 14267877 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13326037 Uniquely mapped reads % | 93.40% Average mapped length | 298.39 Number of splices: Total | 13459156 Number of splices: Annotated (sjdb) | 13224335 Number of splices: GT/AG | 13177075 Number of splices: GC/AG | 239379 Number of splices: AT/AC | 8052 Number of splices: Non-canonical | 34650 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319838 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 28077 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.05% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 622002 622002 622002 N_multimapping 319838 319838 319838 N_noFeature 351348 13108098 401102 N_ambiguous 257828 770 89560 UnstrandedReadsAssigned:12716861 PositiveStrandReadsAssigned:217169 NegativeStrandReadsAssigned:12835375 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670959 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670959-trimmed-pair1.fastq SRR12670959-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,267,877 reads, 12,808,768 reads pseudoaligned [quant] estimated average fragment length: 284.717 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52401 SRR12670959.ke.tsv 34699 SRR12670959.se.tsv 87100 total ==> SRR12670959.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.28 412 14.4384 Potri.005G024800.1.v4.1 1035 751.283 291 23.5414 Potri.004G059700.1.v4.1 961 677.457 7 0.627999 Potri.007G009000.2.v4.1 1416 1132.28 0 0 Potri.003G141000.2.v4.1 2943 2659.28 888.199 20.2997 Potri.016G087400.1.v4.1 270 69.6592 588 513.029 Potri.015G069301.1.v4.1 564 294.743 0 0 Potri.010G195200.1.v4.1 1773 1489.28 97 3.95856 Potri.012G127500.1.v4.1 977 693.394 59 5.17148 ==> SRR12670959.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 98 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670959 completed mapping pipeline successfully