Starting /dee2/code/volunteer_pipeline.sh SRR12670960 current disk space = 3054322622464 free memory = 1471067032 SRR12670960 SRAfilesize 4024be0215e0adb0664bf677e0d64bfe SRR12670960.sra SRR12670960.sra file validated SRR12670960 is paired end SRR12670960 is conventional basespace SRR12670960 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670960_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5235 37.0 37.0 37.0 37.0 37.0 2 36.4175 37.0 37.0 37.0 37.0 37.0 3 36.5775 37.0 37.0 37.0 37.0 37.0 4 36.6255 37.0 37.0 37.0 37.0 37.0 5 36.661 37.0 37.0 37.0 37.0 37.0 6 36.6735 37.0 37.0 37.0 37.0 37.0 7 36.5735 37.0 37.0 37.0 37.0 37.0 8 36.5905 37.0 37.0 37.0 37.0 37.0 9 36.599 37.0 37.0 37.0 37.0 37.0 10-14 36.6228 37.0 37.0 37.0 37.0 37.0 15-19 36.627 37.0 37.0 37.0 37.0 37.0 20-24 36.537800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4837 37.0 37.0 37.0 37.0 37.0 30-34 36.509699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5056 37.0 37.0 37.0 37.0 37.0 40-44 36.4591 37.0 37.0 37.0 37.0 37.0 45-49 36.4128 37.0 37.0 37.0 37.0 37.0 50-54 36.4123 37.0 37.0 37.0 37.0 37.0 55-59 36.336400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3096 37.0 37.0 37.0 37.0 37.0 65-69 36.31400000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.346599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3404 37.0 37.0 37.0 37.0 37.0 80-84 36.2735 37.0 37.0 37.0 37.0 37.0 85-89 36.245099999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.201299999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1981 37.0 37.0 37.0 37.0 37.0 100-104 36.1704 37.0 37.0 37.0 37.0 37.0 105-109 36.1365 37.0 37.0 37.0 37.0 37.0 110-114 36.1771 37.0 37.0 37.0 37.0 37.0 115-119 36.0954 37.0 37.0 37.0 37.0 37.0 120-124 36.0619 37.0 37.0 37.0 37.0 37.0 125-129 36.0135 37.0 37.0 37.0 37.0 37.0 130-134 35.8571 37.0 37.0 37.0 37.0 37.0 135-139 35.906800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.794200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.7479 37.0 37.0 37.0 37.0 37.0 150-151 35.551500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 8.0 26 3.0 27 12.0 28 15.0 29 23.0 30 25.0 31 41.0 32 56.0 33 63.0 34 119.0 35 247.0 36 2746.0 37 635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.725 10.375 6.275 38.625 2 17.875 10.7 38.824999999999996 32.6 3 16.7 15.425 28.025 39.85 4 23.875 22.725 23.65 29.75 5 23.45 29.599999999999998 24.775 22.175 6 20.974999999999998 31.275 24.275 23.474999999999998 7 15.825 26.875 40.825 16.475 8 17.849999999999998 25.825 34.2 22.125 9 18.275 22.95 33.775 25.0 10-14 19.435 29.955 28.360000000000003 22.25 15-19 20.075000000000003 27.700000000000003 28.26 23.965 20-24 20.135 28.349999999999998 27.3 24.215 25-29 19.15 27.515 28.65 24.685000000000002 30-34 20.445 28.015 27.71 23.830000000000002 35-39 20.150000000000002 27.905 27.76 24.185000000000002 40-44 20.09 28.225 28.645 23.04 45-49 20.54 28.349999999999998 27.755000000000003 23.355 50-54 20.57 28.08 28.244999999999997 23.105 55-59 20.395 28.23 27.52 23.855 60-64 20.3 28.110000000000003 28.04 23.549999999999997 65-69 19.99 27.71 28.34 23.96 70-74 20.24 27.77 27.92 24.07 75-79 19.925 28.410000000000004 27.88 23.785 80-84 20.3 28.43 27.455000000000002 23.815 85-89 20.419999999999998 28.77 26.905 23.905 90-94 20.36 28.560000000000002 27.650000000000002 23.43 95-99 20.315 27.865000000000002 27.605 24.215 100-104 20.565 28.04 27.689999999999998 23.705000000000002 105-109 20.119999999999997 28.410000000000004 27.894999999999996 23.575 110-114 21.035 27.92 27.665 23.380000000000003 115-119 20.96 28.285 27.77 22.985 120-124 21.145 28.485 27.045 23.325000000000003 125-129 21.12 27.99 27.229999999999997 23.66 130-134 20.835 28.465 27.025 23.674999999999997 135-139 20.595 27.83 27.51 24.065 140-144 21.43 27.685 27.555000000000003 23.330000000000002 145-149 21.382138213821385 27.767776777677767 27.562756275627564 23.287328732873288 150-151 21.725 28.237499999999997 25.8625 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 0.5 19 1.5 20 1.5 21 0.5 22 2.0 23 2.5 24 1.5 25 2.0 26 3.0 27 3.0 28 4.5 29 8.5 30 20.0 31 27.5 32 32.0 33 47.0 34 59.0 35 65.0 36 80.5 37 109.5 38 146.0 39 160.5 40 165.5 41 187.0 42 209.5 43 229.5 44 243.5 45 257.0 46 269.0 47 268.5 48 231.0 49 209.0 50 199.0 51 158.0 52 127.0 53 113.5 54 92.5 55 66.0 56 56.5 57 47.0 58 29.0 59 18.0 60 12.0 61 7.5 62 6.0 63 3.0 64 2.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.625 #Duplication Level Percentage of deduplicated Percentage of total 1 89.8186889818689 80.5 2 9.06555090655509 16.25 3 0.8647140864714086 2.325 4 0.22315202231520223 0.8 5 0.02789400278940028 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAGACTTGGTGACCTTGGCACCAGATGGATCCTTCTTCTCAACACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.35 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.675000000000001 0.0 0.0 0.0 0.0 136-137 6.012499999999999 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAAC 10 0.006830828 145.0 8 TATTGAC 10 0.006830828 145.0 5 TTGACAA 10 0.006830828 145.0 7 ATTGACA 10 0.006830828 145.0 6 CTTGTAA 10 0.006830828 145.0 1 AATATTG 10 0.006830828 145.0 3 ATATTGA 10 0.006830828 145.0 4 GTAGCCA 10 0.006830828 145.0 145 AGGAGAG 10 0.006830828 145.0 2 >>END_MODULE SRR12670960 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670960_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24 37.0 37.0 37.0 37.0 37.0 2 36.2385 37.0 37.0 37.0 37.0 37.0 3 36.339 37.0 37.0 37.0 37.0 37.0 4 36.3525 37.0 37.0 37.0 37.0 37.0 5 36.4145 37.0 37.0 37.0 37.0 37.0 6 36.427 37.0 37.0 37.0 37.0 37.0 7 36.4745 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.394 37.0 37.0 37.0 37.0 37.0 10-14 36.4163 37.0 37.0 37.0 37.0 37.0 15-19 36.392199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.422 37.0 37.0 37.0 37.0 37.0 25-29 36.3817 37.0 37.0 37.0 37.0 37.0 30-34 36.3378 37.0 37.0 37.0 37.0 37.0 35-39 36.307900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2588 37.0 37.0 37.0 37.0 37.0 45-49 36.3001 37.0 37.0 37.0 37.0 37.0 50-54 36.261900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.2522 37.0 37.0 37.0 37.0 37.0 60-64 36.228899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2209 37.0 37.0 37.0 37.0 37.0 70-74 36.1546 37.0 37.0 37.0 37.0 37.0 75-79 36.1562 37.0 37.0 37.0 37.0 37.0 80-84 36.1496 37.0 37.0 37.0 37.0 37.0 85-89 36.1162 37.0 37.0 37.0 37.0 37.0 90-94 36.1418 37.0 37.0 37.0 37.0 37.0 95-99 36.1209 37.0 37.0 37.0 37.0 37.0 100-104 36.1284 37.0 37.0 37.0 37.0 37.0 105-109 36.027699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.02900000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.96425000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.894999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.8451 37.0 37.0 37.0 37.0 37.0 130-134 35.875 37.0 37.0 37.0 37.0 37.0 135-139 35.747 37.0 37.0 37.0 37.0 37.0 140-144 35.605650000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.48029999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.218 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 2.0 24 7.0 25 6.0 26 4.0 27 7.0 28 12.0 29 23.0 30 24.0 31 43.0 32 53.0 33 90.0 34 143.0 35 368.0 36 2670.0 37 535.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95 24.25 9.2 26.6 2 25.55 26.125 32.375 15.950000000000001 3 20.0 27.725 34.150000000000006 18.125 4 25.124999999999996 32.975 23.35 18.55 5 25.650000000000002 37.375 20.575 16.400000000000002 6 19.2 41.375 22.3 17.125 7 20.200000000000003 22.275 39.525 18.0 8 19.925 24.725 31.4 23.95 9 21.875 23.599999999999998 29.65 24.875 10-14 23.255 29.24 26.55 20.955 15-19 22.89 28.939999999999998 27.22 20.95 20-24 22.78 28.58 27.715 20.925 25-29 22.735 28.83 27.52 20.915 30-34 22.895 28.625 27.46 21.02 35-39 23.1 28.689999999999998 27.689999999999998 20.52 40-44 23.145 28.794999999999998 27.229999999999997 20.830000000000002 45-49 22.775000000000002 28.075 28.205000000000002 20.945 50-54 22.79 29.12 27.284999999999997 20.805 55-59 22.88 28.02 28.395 20.705000000000002 60-64 23.23 27.805000000000003 27.74 21.224999999999998 65-69 22.6 27.634999999999998 27.785 21.98 70-74 23.02 27.725 27.405 21.85 75-79 23.1 27.62 27.855 21.425 80-84 23.335 27.855 27.68 21.13 85-89 23.685000000000002 27.98 26.974999999999998 21.36 90-94 24.055 27.48 27.265 21.2 95-99 23.255 27.615000000000002 28.04 21.09 100-104 23.395 28.165000000000003 27.279999999999998 21.16 105-109 24.065 28.349999999999998 26.855 20.73 110-114 23.565 28.565 27.169999999999998 20.7 115-119 23.966198309915494 28.351417570878546 27.36136806840342 20.32101605080254 120-124 24.26 28.525 26.729999999999997 20.485 125-129 24.69 28.595 26.405 20.31 130-134 24.815 28.825 26.47 19.89 135-139 24.72 27.6 27.125 20.555 140-144 24.581229061453072 27.901395069753487 27.13635681784089 20.38101905095255 145-149 25.790000000000003 28.455000000000002 25.91 19.845 150-151 26.05 27.700000000000003 27.037499999999998 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 1.5 23 2.0 24 2.5 25 3.5 26 6.0 27 7.5 28 11.0 29 12.5 30 13.0 31 22.0 32 32.5 33 40.5 34 44.5 35 55.0 36 85.5 37 106.0 38 129.0 39 164.0 40 187.0 41 215.5 42 246.0 43 278.5 44 290.5 45 270.0 46 264.5 47 258.0 48 241.5 49 225.5 50 176.0 51 132.0 52 101.5 53 69.0 54 66.5 55 57.0 56 37.0 57 42.0 58 36.0 59 16.5 60 10.0 61 7.5 62 4.5 63 5.0 64 5.0 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.09486607142857 80.72500000000001 2 8.705357142857142 15.6 3 0.8370535714285714 2.25 4 0.2232142857142857 0.8 5 0.13950892857142858 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit TGAGATTTTGACCAAGATTGACAGGCGATCTGGCAAAGAGCTCGAGAAGG 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACT 10 0.006830828 145.0 2 ACTTGGG 10 0.006830828 145.0 6 TTTTTCT 10 0.006830828 145.0 4 AGAACTT 10 0.006830828 145.0 3 AACTTGG 10 0.006830828 145.0 5 GAACTTG 10 0.006830828 145.0 4 >>END_MODULE Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634841 spots for SRR12670960.sra Written 634841 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra Read 634834 spots for SRR12670960.sra Written 634834 spots for SRR12670960.sra SRR ids: ['SRR12670960.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yo7yz05e SRR12670960.sra spots: 12696687 blocks: [[1, 634834], [634835, 1269668], [1269669, 1904502], [1904503, 2539336], [2539337, 3174170], [3174171, 3809004], [3809005, 4443838], [4443839, 5078672], [5078673, 5713506], [5713507, 6348340], [6348341, 6983174], [6983175, 7618008], [7618009, 8252842], [8252843, 8887676], [8887677, 9522510], [9522511, 10157344], [10157345, 10792178], [10792179, 11427012], [11427013, 12061846], [12061847, 12696687]] SRR12670960 file size 4293189 SRR12670960 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670960 SRR12670960_1.fastq SRR12670960_2.fastq Input file: SRR12670960_1.fastq Paired file: SRR12670960_2.fastq trimmed: SRR12670960-trimmed-pair1.fastq, SRR12670960-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:47:06 2025 >> started Tue Feb 11 09:47:20 2025 >> done (14.436s) 12696687 read pairs processed; of these: 67 ( 0.00%) short read pairs filtered out after trimming by size control 13799 ( 0.11%) empty read pairs filtered out after trimming by size control 12682821 (99.89%) read pairs available; of these: 1232163 ( 9.72%) trimmed read pairs available after processing 11450658 (90.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 4 0.00% 21 7 0.00% 22 3 0.00% 23 4 0.00% 24 5 0.00% 25 9 0.00% 26 9 0.00% 27 7 0.00% 28 6 0.00% 29 6 0.00% 30 13 0.00% 31 4 0.00% 32 13 0.00% 33 6 0.00% 34 15 0.00% 35 10 0.00% 36 14 0.00% 37 10 0.00% 38 7 0.00% 39 10 0.00% 40 23 0.00% 41 16 0.00% 42 23 0.00% 43 18 0.00% 44 22 0.00% 45 16 0.00% 46 13 0.00% 47 23 0.00% 48 32 0.00% 49 38 0.00% 50 46 0.00% 51 52 0.00% 52 39 0.00% 53 47 0.00% 54 51 0.00% 55 78 0.00% 56 90 0.00% 57 84 0.00% 58 97 0.00% 59 121 0.00% 60 137 0.00% 61 140 0.00% 62 155 0.00% 63 203 0.00% 64 232 0.00% 65 246 0.00% 66 268 0.00% 67 305 0.00% 68 369 0.00% 69 364 0.00% 70 492 0.00% 71 548 0.00% 72 610 0.00% 73 733 0.01% 74 853 0.01% 75 941 0.01% 76 1045 0.01% 77 1123 0.01% 78 1237 0.01% 79 1331 0.01% 80 1610 0.01% 81 1858 0.01% 82 2028 0.02% 83 2220 0.02% 84 2515 0.02% 85 2847 0.02% 86 3062 0.02% 87 3280 0.03% 88 3518 0.03% 89 3654 0.03% 90 4182 0.03% 91 4351 0.03% 92 4647 0.04% 93 5115 0.04% 94 5505 0.04% 95 5987 0.05% 96 6378 0.05% 97 6683 0.05% 98 7149 0.06% 99 7649 0.06% 100 7970 0.06% 101 8073 0.06% 102 8718 0.07% 103 9315 0.07% 104 9681 0.08% 105 10423 0.08% 106 10858 0.09% 107 11338 0.09% 108 11922 0.09% 109 12247 0.10% 110 12916 0.10% 111 13189 0.10% 112 13754 0.11% 113 14197 0.11% 114 14757 0.12% 115 15506 0.12% 116 16418 0.13% 117 16779 0.13% 118 17541 0.14% 119 17936 0.14% 120 18689 0.15% 121 19078 0.15% 122 19756 0.16% 123 20304 0.16% 124 20851 0.16% 125 21547 0.17% 126 22697 0.18% 127 23457 0.18% 128 24013 0.19% 129 24839 0.20% 130 25270 0.20% 131 25787 0.20% 132 26282 0.21% 133 26997 0.21% 134 27337 0.22% 135 27989 0.22% 136 28982 0.23% 137 29257 0.23% 138 30000 0.24% 139 31673 0.25% 140 31791 0.25% 141 32916 0.26% 142 33290 0.26% 143 33520 0.26% 144 34462 0.27% 145 34771 0.27% 146 35923 0.28% 147 36367 0.29% 148 37701 0.30% 149 37476 0.30% 150 38928 0.31% 151 11450658 90.28% 12682821 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=422.98 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=27 prefix-density=0.83 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=24.39 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12670960 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:48:06 Started mapping on | Feb 11 09:48:06 Finished on | Feb 11 09:49:29 Mapping speed, Million of reads per hour | 550.10 Number of input reads | 12682821 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11964900 Uniquely mapped reads % | 94.34% Average mapped length | 296.16 Number of splices: Total | 12318058 Number of splices: Annotated (sjdb) | 12079629 Number of splices: GT/AG | 12066782 Number of splices: GC/AG | 212343 Number of splices: AT/AC | 6904 Number of splices: Non-canonical | 32029 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268517 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 79813 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 449404 449404 449404 N_multimapping 268517 268517 268517 N_noFeature 456244 11775689 518143 N_ambiguous 202003 757 74222 UnstrandedReadsAssigned:11306653 PositiveStrandReadsAssigned:188454 NegativeStrandReadsAssigned:11372535 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670960 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670960-trimmed-pair1.fastq SRR12670960-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,682,821 reads, 11,394,916 reads pseudoaligned [quant] estimated average fragment length: 256.615 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 991 rounds 52401 SRR12670960.ke.tsv 34699 SRR12670960.se.tsv 87100 total ==> SRR12670960.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.38 387 16.3964 Potri.005G024800.1.v4.1 1035 779.385 198 18.9693 Potri.004G059700.1.v4.1 961 705.536 0 0 Potri.007G009000.2.v4.1 1416 1160.38 0 0 Potri.003G141000.2.v4.1 2943 2687.38 710 19.7272 Potri.016G087400.1.v4.1 270 83.0173 423.711 381.099 Potri.015G069301.1.v4.1 564 320.529 0 0 Potri.010G195200.1.v4.1 1773 1517.38 49 2.41122 Potri.012G127500.1.v4.1 977 721.481 67 6.93405 ==> SRR12670960.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670960 completed mapping pipeline successfully