Starting /dee2/code/volunteer_pipeline.sh SRR12670961 current disk space = 3053787344896 free memory = 1471394512 SRR12670961 SRAfilesize c2c1f321a05143746e1a7acd3cc36ab7 SRR12670961.sra SRR12670961.sra file validated SRR12670961 is paired end SRR12670961 is conventional basespace SRR12670961 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46275 37.0 37.0 37.0 37.0 37.0 2 36.5145 37.0 37.0 37.0 37.0 37.0 3 36.603 37.0 37.0 37.0 37.0 37.0 4 36.571 37.0 37.0 37.0 37.0 37.0 5 36.669 37.0 37.0 37.0 37.0 37.0 6 36.724 37.0 37.0 37.0 37.0 37.0 7 36.594 37.0 37.0 37.0 37.0 37.0 8 36.6135 37.0 37.0 37.0 37.0 37.0 9 36.631 37.0 37.0 37.0 37.0 37.0 10-14 36.6458 37.0 37.0 37.0 37.0 37.0 15-19 36.6124 37.0 37.0 37.0 37.0 37.0 20-24 36.56510000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.533300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.474199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.511 37.0 37.0 37.0 37.0 37.0 40-44 36.5232 37.0 37.0 37.0 37.0 37.0 45-49 36.4884 37.0 37.0 37.0 37.0 37.0 50-54 36.40990000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4139 37.0 37.0 37.0 37.0 37.0 60-64 36.3775 37.0 37.0 37.0 37.0 37.0 65-69 36.3618 37.0 37.0 37.0 37.0 37.0 70-74 36.3853 37.0 37.0 37.0 37.0 37.0 75-79 36.3904 37.0 37.0 37.0 37.0 37.0 80-84 36.287400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.24739999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.314699999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2214 37.0 37.0 37.0 37.0 37.0 100-104 36.2052 37.0 37.0 37.0 37.0 37.0 105-109 36.198899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.2237 37.0 37.0 37.0 37.0 37.0 115-119 36.0988 37.0 37.0 37.0 37.0 37.0 120-124 36.0859 37.0 37.0 37.0 37.0 37.0 125-129 36.061099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.910999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.941900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.916999999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.7702 37.0 37.0 37.0 37.0 37.0 150-151 35.511250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 3.0 24 0.0 25 2.0 26 5.0 27 12.0 28 12.0 29 15.0 30 33.0 31 35.0 32 49.0 33 76.0 34 108.0 35 266.0 36 2691.0 37 690.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.335333833458364 12.328082020505127 6.27656914228557 40.060015003750934 2 20.275000000000002 10.35 36.6 32.775 3 16.675 14.725 28.625 39.975 4 22.975 20.200000000000003 24.775 32.05 5 23.5 27.775 24.55 24.175 6 21.4 31.724999999999998 23.175 23.7 7 16.825000000000003 29.425 38.425 15.325 8 16.35 27.55 33.0 23.1 9 15.65 24.65 34.2 25.5 10-14 19.74 30.025000000000002 27.779999999999998 22.455 15-19 19.885 28.470000000000002 28.025 23.62 20-24 19.925 28.075 27.894999999999996 24.104999999999997 25-29 19.935 28.63 27.779999999999998 23.655 30-34 20.015 28.904999999999998 27.265 23.815 35-39 19.88 28.499999999999996 28.34 23.28 40-44 20.1 28.610000000000003 27.46 23.830000000000002 45-49 20.73 28.435 27.305 23.53 50-54 20.18 28.199999999999996 27.865000000000002 23.755000000000003 55-59 20.41 28.499999999999996 27.015 24.075 60-64 20.07 28.22 28.21 23.5 65-69 20.415 28.055000000000003 27.41 24.12 70-74 20.22 28.64 27.195000000000004 23.945 75-79 20.13 28.15 27.589999999999996 24.13 80-84 20.25 28.38 27.725 23.645 85-89 20.09 28.235 27.465 24.21 90-94 20.09 28.165000000000003 27.685 24.060000000000002 95-99 20.62 27.05 28.449999999999996 23.880000000000003 100-104 20.48 27.465 28.025 24.03 105-109 19.919999999999998 27.91 28.18 23.990000000000002 110-114 20.775 28.025 27.169999999999998 24.03 115-119 20.815 28.175 27.650000000000002 23.36 120-124 20.8 27.884999999999998 27.21 24.104999999999997 125-129 20.485 27.62 27.675 24.22 130-134 20.580000000000002 28.444999999999997 26.685 24.29 135-139 20.77 27.534999999999997 27.54 24.154999999999998 140-144 21.085 27.725 26.995 24.195 145-149 20.3 27.97 27.265 24.465 150-151 19.875 27.5625 28.462500000000002 24.099999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 0.5 23 0.5 24 2.0 25 3.0 26 3.0 27 5.5 28 12.5 29 13.0 30 17.5 31 28.5 32 28.5 33 42.5 34 62.5 35 66.0 36 80.0 37 116.0 38 133.0 39 150.0 40 179.0 41 208.5 42 226.5 43 222.0 44 222.5 45 236.5 46 260.5 47 252.5 48 237.5 49 215.5 50 187.5 51 165.5 52 144.0 53 120.5 54 90.5 55 69.0 56 50.0 57 40.0 58 29.5 59 23.0 60 17.5 61 9.5 62 8.5 63 7.0 64 2.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.67633928571429 80.35 2 9.1796875 16.45 3 1.0323660714285714 2.775 4 0.08370535714285714 0.3 5 0.027901785714285712 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAGAACTAATAATATCCTGTAATCCAGAGATCCAGTTTGTTATTATCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.7375 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.7125000000000004 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670961 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670961_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2215 37.0 37.0 37.0 37.0 37.0 2 36.398 37.0 37.0 37.0 37.0 37.0 3 36.3085 37.0 37.0 37.0 37.0 37.0 4 36.362 37.0 37.0 37.0 37.0 37.0 5 36.445 37.0 37.0 37.0 37.0 37.0 6 36.465 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.451 37.0 37.0 37.0 37.0 37.0 9 36.434 37.0 37.0 37.0 37.0 37.0 10-14 36.45649999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4864 37.0 37.0 37.0 37.0 37.0 20-24 36.4677 37.0 37.0 37.0 37.0 37.0 25-29 36.3514 37.0 37.0 37.0 37.0 37.0 30-34 36.3675 37.0 37.0 37.0 37.0 37.0 35-39 36.326299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2712 37.0 37.0 37.0 37.0 37.0 45-49 36.2753 37.0 37.0 37.0 37.0 37.0 50-54 36.2334 37.0 37.0 37.0 37.0 37.0 55-59 36.288 37.0 37.0 37.0 37.0 37.0 60-64 36.2413 37.0 37.0 37.0 37.0 37.0 65-69 36.2268 37.0 37.0 37.0 37.0 37.0 70-74 36.2408 37.0 37.0 37.0 37.0 37.0 75-79 36.1434 37.0 37.0 37.0 37.0 37.0 80-84 36.1856 37.0 37.0 37.0 37.0 37.0 85-89 36.1712 37.0 37.0 37.0 37.0 37.0 90-94 36.1755 37.0 37.0 37.0 37.0 37.0 95-99 36.1004 37.0 37.0 37.0 37.0 37.0 100-104 36.1148 37.0 37.0 37.0 37.0 37.0 105-109 35.992200000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.002300000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0193 37.0 37.0 37.0 37.0 37.0 120-124 35.9041 37.0 37.0 37.0 37.0 37.0 125-129 35.9091 37.0 37.0 37.0 37.0 37.0 130-134 35.849900000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.828700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.861900000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6024 37.0 37.0 37.0 37.0 37.0 150-151 35.34325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 2.0 17 3.0 18 1.0 19 1.0 20 3.0 21 0.0 22 2.0 23 0.0 24 3.0 25 4.0 26 6.0 27 14.0 28 19.0 29 13.0 30 23.0 31 30.0 32 46.0 33 84.0 34 128.0 35 379.0 36 2698.0 37 538.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9 27.250000000000004 9.6 25.25 2 28.675 26.8 28.799999999999997 15.725 3 20.474999999999998 28.599999999999998 32.025 18.9 4 22.925 34.075 24.875 18.125 5 26.424999999999997 36.875 21.2 15.5 6 20.625 39.275 22.275 17.825 7 20.375 23.45 36.225 19.950000000000003 8 20.775 26.375 28.499999999999996 24.349999999999998 9 21.825 25.1 29.425 23.65 10-14 23.915 28.96 25.905 21.22 15-19 23.825 28.194999999999997 26.165 21.815 20-24 23.395 28.444999999999997 27.26 20.9 25-29 23.44 28.044999999999998 27.450000000000003 21.065 30-34 23.7 27.99 26.97 21.34 35-39 23.189999999999998 28.455000000000002 26.915 21.44 40-44 23.169999999999998 27.474999999999998 27.700000000000003 21.654999999999998 45-49 23.695 28.175 26.71 21.42 50-54 23.97 27.47 27.200000000000003 21.36 55-59 23.21 27.36 27.395000000000003 22.035 60-64 23.794999999999998 27.229999999999997 27.565 21.41 65-69 23.485 27.589999999999996 27.275 21.65 70-74 24.41 28.52 26.695 20.375 75-79 23.555 28.165000000000003 27.355 20.925 80-84 24.05 27.845 27.325 20.78 85-89 24.035 27.529999999999998 26.939999999999998 21.495 90-94 23.54 27.92 27.089999999999996 21.45 95-99 23.89 28.125 27.13 20.855 100-104 23.74 28.065 26.795 21.4 105-109 24.19 26.974999999999998 27.939999999999998 20.895 110-114 24.240000000000002 27.26 27.235 21.265 115-119 23.715 27.975 27.165 21.145 120-124 24.315 28.075 27.015 20.595 125-129 23.605 27.775 27.515 21.105 130-134 25.135 27.76 26.97 20.135 135-139 23.974999999999998 28.235 27.400000000000002 20.39 140-144 24.465 27.805000000000003 26.619999999999997 21.11 145-149 24.635 28.255000000000003 26.47 20.64 150-151 24.6125 28.037499999999998 27.8375 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.0 25 2.0 26 4.5 27 4.0 28 4.5 29 6.5 30 12.5 31 16.0 32 17.0 33 24.0 34 34.5 35 54.0 36 75.0 37 97.5 38 133.0 39 155.5 40 169.5 41 198.0 42 235.0 43 270.5 44 269.5 45 268.0 46 275.0 47 262.5 48 261.5 49 232.5 50 177.0 51 137.0 52 111.5 53 103.0 54 92.5 55 78.0 56 62.0 57 39.0 58 29.0 59 25.0 60 16.0 61 11.0 62 8.0 63 5.5 64 3.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.5 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.84375 80.5 2 8.928571428571429 16.0 3 1.0602678571428572 2.85 4 0.11160714285714285 0.4 5 0.055803571428571425 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 5 0.125 No Hit AAGAAGAAAAGGAGGAAGATTTGATATCTTAGATTGACTTGAAATAATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.2249999999999996 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGCT 10 0.006830828 145.0 7 CCTGTTT 10 0.006830828 145.0 2 TCAGGCA 10 0.006830828 145.0 3 GTCTCAT 10 0.006830828 145.0 1 ATTTTTT 10 0.006830828 145.0 1 GTTGTTT 10 0.006830828 145.0 1 >>END_MODULE Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630802 spots for SRR12670961.sra Written 630802 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra Read 630783 spots for SRR12670961.sra Written 630783 spots for SRR12670961.sra SRR ids: ['SRR12670961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j2joo8v6 SRR12670961.sra spots: 12615679 blocks: [[1, 630783], [630784, 1261566], [1261567, 1892349], [1892350, 2523132], [2523133, 3153915], [3153916, 3784698], [3784699, 4415481], [4415482, 5046264], [5046265, 5677047], [5677048, 6307830], [6307831, 6938613], [6938614, 7569396], [7569397, 8200179], [8200180, 8830962], [8830963, 9461745], [9461746, 10092528], [10092529, 10723311], [10723312, 11354094], [11354095, 11984877], [11984878, 12615679]] SRR12670961 file size 4265659 SRR12670961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670961 SRR12670961_1.fastq SRR12670961_2.fastq Input file: SRR12670961_1.fastq Paired file: SRR12670961_2.fastq trimmed: SRR12670961-trimmed-pair1.fastq, SRR12670961-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:04:29 2025 >> started Tue Feb 11 10:04:42 2025 >> done (13.618s) 12615679 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 4179 ( 0.03%) empty read pairs filtered out after trimming by size control 12611473 (99.97%) read pairs available; of these: 668244 ( 5.30%) trimmed read pairs available after processing 11943229 (94.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 1 0.00% 27 6 0.00% 28 4 0.00% 29 10 0.00% 30 7 0.00% 31 6 0.00% 32 2 0.00% 33 12 0.00% 34 5 0.00% 35 7 0.00% 36 12 0.00% 37 5 0.00% 38 12 0.00% 39 15 0.00% 40 9 0.00% 41 12 0.00% 42 16 0.00% 43 12 0.00% 44 14 0.00% 45 24 0.00% 46 16 0.00% 47 18 0.00% 48 20 0.00% 49 23 0.00% 50 26 0.00% 51 25 0.00% 52 33 0.00% 53 38 0.00% 54 26 0.00% 55 37 0.00% 56 55 0.00% 57 62 0.00% 58 44 0.00% 59 71 0.00% 60 74 0.00% 61 75 0.00% 62 102 0.00% 63 110 0.00% 64 129 0.00% 65 127 0.00% 66 137 0.00% 67 142 0.00% 68 173 0.00% 69 196 0.00% 70 237 0.00% 71 261 0.00% 72 289 0.00% 73 342 0.00% 74 388 0.00% 75 445 0.00% 76 482 0.00% 77 523 0.00% 78 595 0.00% 79 645 0.01% 80 703 0.01% 81 840 0.01% 82 928 0.01% 83 1010 0.01% 84 1106 0.01% 85 1305 0.01% 86 1404 0.01% 87 1509 0.01% 88 1687 0.01% 89 1662 0.01% 90 1962 0.02% 91 2097 0.02% 92 2298 0.02% 93 2526 0.02% 94 2607 0.02% 95 2877 0.02% 96 3175 0.03% 97 3406 0.03% 98 3461 0.03% 99 3579 0.03% 100 3872 0.03% 101 4104 0.03% 102 4231 0.03% 103 4440 0.04% 104 4918 0.04% 105 5157 0.04% 106 5410 0.04% 107 5810 0.05% 108 5812 0.05% 109 6255 0.05% 110 6275 0.05% 111 6616 0.05% 112 6932 0.05% 113 7153 0.06% 114 7469 0.06% 115 7904 0.06% 116 8161 0.06% 117 8808 0.07% 118 8899 0.07% 119 9207 0.07% 120 9654 0.08% 121 9964 0.08% 122 10582 0.08% 123 10744 0.09% 124 10835 0.09% 125 11399 0.09% 126 11683 0.09% 127 12082 0.10% 128 12698 0.10% 129 13211 0.10% 130 13560 0.11% 131 13795 0.11% 132 14319 0.11% 133 14812 0.12% 134 15005 0.12% 135 15171 0.12% 136 16250 0.13% 137 16817 0.13% 138 16904 0.13% 139 17924 0.14% 140 18122 0.14% 141 18854 0.15% 142 19217 0.15% 143 19443 0.15% 144 19890 0.16% 145 20696 0.16% 146 20745 0.16% 147 21182 0.17% 148 22721 0.18% 149 22498 0.18% 150 23702 0.19% 151 11943229 94.70% 12611473 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.68 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=97.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=131.84 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.5 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12670961 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:05:29 Started mapping on | Feb 11 10:05:29 Finished on | Feb 11 10:07:19 Mapping speed, Million of reads per hour | 412.74 Number of input reads | 12611473 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11805228 Uniquely mapped reads % | 93.61% Average mapped length | 298.53 Number of splices: Total | 11726708 Number of splices: Annotated (sjdb) | 11541781 Number of splices: GT/AG | 11482518 Number of splices: GC/AG | 209487 Number of splices: AT/AC | 6616 Number of splices: Non-canonical | 28087 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290543 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 93885 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515702 515702 515702 N_multimapping 290543 290543 290543 N_noFeature 294593 11622786 336914 N_ambiguous 221837 731 81481 UnstrandedReadsAssigned:11288798 PositiveStrandReadsAssigned:181711 NegativeStrandReadsAssigned:11386833 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670961 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670961-trimmed-pair1.fastq SRR12670961-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,611,473 reads, 11,454,352 reads pseudoaligned [quant] estimated average fragment length: 274.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR12670961.ke.tsv 34699 SRR12670961.se.tsv 87100 total ==> SRR12670961.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.6 341 13.7464 Potri.005G024800.1.v4.1 1035 761.6 245 22.624 Potri.004G059700.1.v4.1 961 687.703 11 1.12492 Potri.007G009000.2.v4.1 1416 1142.6 0 0 Potri.003G141000.2.v4.1 2943 2669.6 396 10.4323 Potri.016G087400.1.v4.1 270 70.6457 647 644.094 Potri.015G069301.1.v4.1 564 302.484 0 0 Potri.010G195200.1.v4.1 1773 1499.6 5 0.234491 Potri.012G127500.1.v4.1 977 703.64 162 16.1918 ==> SRR12670961.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 359 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR12670961 completed mapping pipeline successfully