Starting /dee2/code/volunteer_pipeline.sh SRR12670962 current disk space = 3053593509888 free memory = 1460199736 SRR12670962 SRAfilesize d50948b3564a09697b1889217f944d38 SRR12670962.sra SRR12670962.sra file validated SRR12670962 is paired end SRR12670962 is conventional basespace SRR12670962 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46625 37.0 37.0 37.0 37.0 37.0 2 36.4585 37.0 37.0 37.0 37.0 37.0 3 36.591 37.0 37.0 37.0 37.0 37.0 4 36.562 37.0 37.0 37.0 37.0 37.0 5 36.6135 37.0 37.0 37.0 37.0 37.0 6 36.6195 37.0 37.0 37.0 37.0 37.0 7 36.601 37.0 37.0 37.0 37.0 37.0 8 36.6335 37.0 37.0 37.0 37.0 37.0 9 36.664 37.0 37.0 37.0 37.0 37.0 10-14 36.6403 37.0 37.0 37.0 37.0 37.0 15-19 36.6376 37.0 37.0 37.0 37.0 37.0 20-24 36.58370000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.541599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5095 37.0 37.0 37.0 37.0 37.0 35-39 36.503499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3993 37.0 37.0 37.0 37.0 37.0 45-49 36.3838 37.0 37.0 37.0 37.0 37.0 50-54 36.411699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.33839999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2844 37.0 37.0 37.0 37.0 37.0 65-69 36.287099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3115 37.0 37.0 37.0 37.0 37.0 75-79 36.2188 37.0 37.0 37.0 37.0 37.0 80-84 36.2124 37.0 37.0 37.0 37.0 37.0 85-89 36.2022 37.0 37.0 37.0 37.0 37.0 90-94 36.1791 37.0 37.0 37.0 37.0 37.0 95-99 36.1357 37.0 37.0 37.0 37.0 37.0 100-104 36.114999999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1574 37.0 37.0 37.0 37.0 37.0 110-114 36.113800000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0829 37.0 37.0 37.0 37.0 37.0 120-124 35.9961 37.0 37.0 37.0 37.0 37.0 125-129 36.020799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.7963 37.0 37.0 37.0 37.0 37.0 135-139 35.83559999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.821299999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.66775 37.0 37.0 37.0 37.0 37.0 150-151 35.56175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 3.0 20 2.0 21 1.0 22 2.0 23 6.0 24 8.0 25 4.0 26 3.0 27 11.0 28 15.0 29 22.0 30 22.0 31 22.0 32 59.0 33 84.0 34 108.0 35 273.0 36 2683.0 37 671.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.38809702425606 10.877719429857464 6.326581645411353 30.407601900475118 2 20.825 11.075 34.925 33.175 3 16.950000000000003 16.375 30.875000000000004 35.8 4 21.775 21.825 25.95 30.45 5 23.625 29.5 24.75 22.125 6 20.849999999999998 32.725 25.05 21.375 7 15.024999999999999 27.750000000000004 40.175 17.05 8 15.725 27.875 32.275 24.125 9 16.85 22.925 36.05 24.175 10-14 19.24 30.620000000000005 28.68 21.46 15-19 19.8 28.060000000000002 28.595 23.544999999999998 20-24 19.945 28.560000000000002 27.96 23.535 25-29 20.035 28.09 27.63 24.245 30-34 20.07 29.054999999999996 27.134999999999998 23.74 35-39 20.395 28.685 27.43 23.49 40-44 19.755 28.575 28.294999999999998 23.375 45-49 19.82 28.715000000000003 27.975 23.49 50-54 20.150000000000002 28.83 27.35 23.669999999999998 55-59 19.695 29.304999999999996 27.060000000000002 23.94 60-64 19.705000000000002 28.65 27.525 24.12 65-69 20.34 28.485 27.765 23.41 70-74 20.255000000000003 28.4 27.715 23.630000000000003 75-79 20.155 28.599999999999998 27.255000000000003 23.990000000000002 80-84 20.73 27.365000000000002 28.07 23.835 85-89 20.695 28.16 27.305 23.84 90-94 20.794999999999998 27.74 27.560000000000002 23.905 95-99 20.18 28.055000000000003 27.905 23.86 100-104 20.415 28.325 27.115000000000002 24.145 105-109 20.415 28.875 27.11 23.599999999999998 110-114 20.59 28.115000000000002 27.439999999999998 23.855 115-119 20.945 28.24 26.96 23.855 120-124 20.849999999999998 27.85 27.01 24.29 125-129 20.82 27.575 27.794999999999998 23.810000000000002 130-134 20.705000000000002 27.889999999999997 27.084999999999997 24.32 135-139 21.279999999999998 27.400000000000002 27.49 23.830000000000002 140-144 21.029999999999998 27.68 27.3 23.990000000000002 145-149 20.973145971895786 28.069210381557237 26.55898384757714 24.398659798969845 150-151 21.375 27.675 26.887499999999996 24.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 1.0 3 2.5 4 3.0 5 1.5 6 1.0 7 2.0 8 1.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 4.0 23 3.0 24 2.0 25 7.5 26 9.0 27 8.0 28 13.5 29 20.5 30 28.5 31 37.0 32 39.0 33 41.0 34 61.5 35 79.5 36 94.0 37 121.0 38 135.0 39 150.5 40 163.0 41 174.0 42 198.5 43 211.0 44 221.5 45 231.0 46 237.0 47 235.0 48 243.0 49 218.5 50 173.5 51 157.0 52 140.0 53 122.5 54 100.5 55 74.0 56 59.0 57 46.0 58 27.0 59 27.0 60 23.5 61 15.0 62 10.5 63 4.0 64 3.0 65 3.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.03656860049492 82.775 2 8.083585372559803 14.7 3 0.8248556502612043 2.25 4 0.027495188342040146 0.1 5 0.0 0.0 6 0.0 0.0 7 0.027495188342040146 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670962 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670962_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.307 37.0 37.0 37.0 37.0 37.0 2 36.4105 37.0 37.0 37.0 37.0 37.0 3 36.3105 37.0 37.0 37.0 37.0 37.0 4 36.4085 37.0 37.0 37.0 37.0 37.0 5 36.4465 37.0 37.0 37.0 37.0 37.0 6 36.552 37.0 37.0 37.0 37.0 37.0 7 36.4775 37.0 37.0 37.0 37.0 37.0 8 36.497 37.0 37.0 37.0 37.0 37.0 9 36.5085 37.0 37.0 37.0 37.0 37.0 10-14 36.513099999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.533100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.548500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4756 37.0 37.0 37.0 37.0 37.0 30-34 36.4456 37.0 37.0 37.0 37.0 37.0 35-39 36.4554 37.0 37.0 37.0 37.0 37.0 40-44 36.349000000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3892 37.0 37.0 37.0 37.0 37.0 50-54 36.3561 37.0 37.0 37.0 37.0 37.0 55-59 36.303 37.0 37.0 37.0 37.0 37.0 60-64 36.301 37.0 37.0 37.0 37.0 37.0 65-69 36.315099999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.320899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2573 37.0 37.0 37.0 37.0 37.0 80-84 36.283 37.0 37.0 37.0 37.0 37.0 85-89 36.236599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.255500000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.181 37.0 37.0 37.0 37.0 37.0 100-104 36.2216 37.0 37.0 37.0 37.0 37.0 105-109 36.17659999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.2047 37.0 37.0 37.0 37.0 37.0 115-119 36.137 37.0 37.0 37.0 37.0 37.0 120-124 36.0634 37.0 37.0 37.0 37.0 37.0 125-129 35.931200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9392 37.0 37.0 37.0 37.0 37.0 135-139 35.9197 37.0 37.0 37.0 37.0 37.0 140-144 35.8395 37.0 37.0 37.0 37.0 37.0 145-149 35.7153 37.0 37.0 37.0 37.0 37.0 150-151 35.386250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 4.0 20 7.0 21 2.0 22 4.0 23 3.0 24 5.0 25 4.0 26 6.0 27 5.0 28 4.0 29 14.0 30 16.0 31 29.0 32 40.0 33 54.0 34 138.0 35 278.0 36 2708.0 37 671.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.25 26.525 7.1 19.125 2 30.15 25.374999999999996 27.35 17.125 3 20.150000000000002 26.8 34.925 18.125 4 23.775 33.825 23.549999999999997 18.85 5 27.150000000000002 36.55 19.375 16.925 6 21.675 40.1 20.549999999999997 17.675 7 22.125 23.375 35.025 19.475 8 20.625 25.95 29.099999999999998 24.325 9 23.150000000000002 24.95 29.325000000000003 22.575 10-14 23.865 29.64 25.965 20.53 15-19 23.735 28.115000000000002 26.950000000000003 21.2 20-24 23.919999999999998 28.71 26.625 20.745 25-29 23.82 28.055000000000003 27.224999999999998 20.9 30-34 23.669999999999998 28.185 27.32 20.825 35-39 23.97 28.09 26.765 21.175 40-44 23.985 28.18 27.165 20.669999999999998 45-49 22.900000000000002 28.095 27.395000000000003 21.61 50-54 23.32 28.48 26.974999999999998 21.224999999999998 55-59 23.830000000000002 28.29 26.735 21.145 60-64 23.555 28.044999999999998 27.025 21.375 65-69 23.56 28.21 27.139999999999997 21.09 70-74 23.78 27.810000000000002 27.435 20.974999999999998 75-79 23.72 28.105000000000004 26.534999999999997 21.64 80-84 23.805 28.189999999999998 26.75 21.255 85-89 23.895 27.779999999999998 27.175 21.15 90-94 24.5 28.345 26.119999999999997 21.035 95-99 24.565 27.955000000000002 26.875 20.605 100-104 24.465 28.494999999999997 26.52 20.52 105-109 23.75 27.975 27.474999999999998 20.8 110-114 24.46 28.395 26.950000000000003 20.195 115-119 24.532453245324533 28.217821782178216 26.782678267826782 20.467046704670466 120-124 24.565 27.845 27.169999999999998 20.419999999999998 125-129 24.505 27.994999999999997 26.44 21.060000000000002 130-134 24.535 28.015 27.134999999999998 20.315 135-139 24.205 27.555000000000003 27.13 21.11 140-144 24.867486748674867 27.75777577757776 27.037703770377036 20.337033703370334 145-149 25.635 27.82 26.625 19.919999999999998 150-151 24.637500000000003 28.249999999999996 26.437500000000004 20.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.5 7 2.5 8 2.0 9 0.5 10 0.5 11 1.0 12 1.5 13 1.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 1.5 23 1.5 24 3.0 25 3.0 26 4.5 27 5.0 28 4.5 29 6.0 30 11.5 31 14.5 32 15.5 33 23.5 34 34.0 35 48.0 36 71.5 37 95.5 38 123.5 39 155.5 40 182.5 41 210.0 42 235.0 43 248.0 44 270.5 45 276.0 46 261.5 47 255.5 48 249.0 49 213.5 50 166.0 51 153.5 52 132.5 53 105.5 54 91.0 55 72.0 56 57.0 57 47.0 58 34.0 59 28.5 60 23.0 61 13.0 62 10.0 63 8.5 64 4.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.0 97 1.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.33296763576523 83.25 2 7.926494788809654 14.45 3 0.6308283049917718 1.725 4 0.027427317608337907 0.1 5 0.027427317608337907 0.125 6 0.027427317608337907 0.15 7 0.0 0.0 8 0.027427317608337907 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAGG 10 0.006830828 145.0 1 TGGGAAC 10 0.006830828 145.0 6 >>END_MODULE Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577220 spots for SRR12670962.sra Written 577220 spots for SRR12670962.sra Read 577224 spots for SRR12670962.sra Written 577224 spots for SRR12670962.sra SRR ids: ['SRR12670962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zln7frz8 SRR12670962.sra spots: 11544404 blocks: [[1, 577220], [577221, 1154440], [1154441, 1731660], [1731661, 2308880], [2308881, 2886100], [2886101, 3463320], [3463321, 4040540], [4040541, 4617760], [4617761, 5194980], [5194981, 5772200], [5772201, 6349420], [6349421, 6926640], [6926641, 7503860], [7503861, 8081080], [8081081, 8658300], [8658301, 9235520], [9235521, 9812740], [9812741, 10389960], [10389961, 10967180], [10967181, 11544404]] SRR12670962 file size 3901593 SRR12670962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670962 SRR12670962_1.fastq SRR12670962_2.fastq Input file: SRR12670962_1.fastq Paired file: SRR12670962_2.fastq trimmed: SRR12670962-trimmed-pair1.fastq, SRR12670962-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:11:25 2025 >> started Tue Feb 11 10:11:44 2025 >> done (18.712s) 11544404 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 7113 ( 0.06%) empty read pairs filtered out after trimming by size control 11537227 (99.94%) read pairs available; of these: 778161 ( 6.74%) trimmed read pairs available after processing 10759066 (93.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 10 0.00% 21 13 0.00% 22 17 0.00% 23 16 0.00% 24 18 0.00% 25 13 0.00% 26 18 0.00% 27 13 0.00% 28 21 0.00% 29 25 0.00% 30 17 0.00% 31 19 0.00% 32 18 0.00% 33 13 0.00% 34 21 0.00% 35 20 0.00% 36 18 0.00% 37 16 0.00% 38 19 0.00% 39 16 0.00% 40 23 0.00% 41 18 0.00% 42 25 0.00% 43 26 0.00% 44 13 0.00% 45 20 0.00% 46 34 0.00% 47 31 0.00% 48 25 0.00% 49 27 0.00% 50 34 0.00% 51 37 0.00% 52 50 0.00% 53 41 0.00% 54 51 0.00% 55 48 0.00% 56 59 0.00% 57 69 0.00% 58 86 0.00% 59 85 0.00% 60 133 0.00% 61 143 0.00% 62 161 0.00% 63 165 0.00% 64 155 0.00% 65 200 0.00% 66 173 0.00% 67 262 0.00% 68 285 0.00% 69 296 0.00% 70 370 0.00% 71 445 0.00% 72 465 0.00% 73 557 0.00% 74 602 0.01% 75 653 0.01% 76 704 0.01% 77 786 0.01% 78 846 0.01% 79 1054 0.01% 80 1103 0.01% 81 1276 0.01% 82 1336 0.01% 83 1558 0.01% 84 1798 0.02% 85 1883 0.02% 86 1972 0.02% 87 2211 0.02% 88 2354 0.02% 89 2447 0.02% 90 2532 0.02% 91 2861 0.02% 92 2997 0.03% 93 3396 0.03% 94 3602 0.03% 95 3881 0.03% 96 4228 0.04% 97 4370 0.04% 98 4485 0.04% 99 4843 0.04% 100 5119 0.04% 101 5263 0.05% 102 5624 0.05% 103 5835 0.05% 104 6180 0.05% 105 6481 0.06% 106 6818 0.06% 107 6965 0.06% 108 7244 0.06% 109 7488 0.06% 110 7858 0.07% 111 7913 0.07% 112 8368 0.07% 113 8621 0.07% 114 9114 0.08% 115 9477 0.08% 116 10238 0.09% 117 10263 0.09% 118 10440 0.09% 119 10887 0.09% 120 11318 0.10% 121 11619 0.10% 122 12238 0.11% 123 12562 0.11% 124 13122 0.11% 125 13430 0.12% 126 13810 0.12% 127 14294 0.12% 128 14449 0.13% 129 15186 0.13% 130 15262 0.13% 131 15918 0.14% 132 16120 0.14% 133 16856 0.15% 134 17146 0.15% 135 17751 0.15% 136 18360 0.16% 137 18479 0.16% 138 19035 0.16% 139 19907 0.17% 140 19867 0.17% 141 20578 0.18% 142 21065 0.18% 143 21534 0.19% 144 22553 0.20% 145 23081 0.20% 146 23250 0.20% 147 23797 0.21% 148 24197 0.21% 149 24704 0.21% 150 25736 0.22% 151 10759066 93.26% 11537227 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=20 prefix-density=0.62 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=59.63 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=12.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.9 sequence=ACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12670962 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:12:36 Started mapping on | Feb 11 10:12:36 Finished on | Feb 11 10:14:57 Mapping speed, Million of reads per hour | 294.57 Number of input reads | 11537227 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10731090 Uniquely mapped reads % | 93.01% Average mapped length | 297.40 Number of splices: Total | 10300464 Number of splices: Annotated (sjdb) | 10128065 Number of splices: GT/AG | 10067217 Number of splices: GC/AG | 197334 Number of splices: AT/AC | 6835 Number of splices: Non-canonical | 29078 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279143 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 122589 % of reads mapped to too many loci | 1.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.27% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 526994 526994 526994 N_multimapping 279143 279143 279143 N_noFeature 290104 10525913 340967 N_ambiguous 222220 726 67595 UnstrandedReadsAssigned:10218766 PositiveStrandReadsAssigned:204451 NegativeStrandReadsAssigned:10322528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670962 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670962-trimmed-pair1.fastq SRR12670962-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,537,227 reads, 10,401,071 reads pseudoaligned [quant] estimated average fragment length: 266.421 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,304 rounds 52401 SRR12670962.ke.tsv 34699 SRR12670962.se.tsv 87100 total ==> SRR12670962.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.58 256 10.924 Potri.005G024800.1.v4.1 1035 769.579 295 28.6673 Potri.004G059700.1.v4.1 961 695.685 0 0 Potri.007G009000.2.v4.1 1416 1150.58 0 0 Potri.003G141000.2.v4.1 2943 2677.58 576 16.0879 Potri.016G087400.1.v4.1 270 75.3702 523 518.944 Potri.015G069301.1.v4.1 564 310.083 0 0 Potri.010G195200.1.v4.1 1773 1507.58 46 2.2819 Potri.012G127500.1.v4.1 977 711.643 114 11.9801 ==> SRR12670962.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 103 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12670962 completed mapping pipeline successfully