Starting /dee2/code/volunteer_pipeline.sh SRR12670964 current disk space = 3054119649280 free memory = 1191593944 SRR12670964 SRAfilesize e75588049baba6f5a09de2a633bf73a6 SRR12670964.sra SRR12670964.sra file validated SRR12670964 is paired end SRR12670964 is conventional basespace SRR12670964 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.45625 37.0 37.0 37.0 37.0 37.0 2 36.381 37.0 37.0 37.0 37.0 37.0 3 36.5085 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.59 37.0 37.0 37.0 37.0 37.0 6 36.6065 37.0 37.0 37.0 37.0 37.0 7 36.6185 37.0 37.0 37.0 37.0 37.0 8 36.653 37.0 37.0 37.0 37.0 37.0 9 36.576 37.0 37.0 37.0 37.0 37.0 10-14 36.6075 37.0 37.0 37.0 37.0 37.0 15-19 36.5723 37.0 37.0 37.0 37.0 37.0 20-24 36.491299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4255 37.0 37.0 37.0 37.0 37.0 30-34 36.384699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3644 37.0 37.0 37.0 37.0 37.0 40-44 36.362199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.281 37.0 37.0 37.0 37.0 37.0 50-54 36.321000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2736 37.0 37.0 37.0 37.0 37.0 60-64 36.238 37.0 37.0 37.0 37.0 37.0 65-69 36.2119 37.0 37.0 37.0 37.0 37.0 70-74 36.24829999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1947 37.0 37.0 37.0 37.0 37.0 80-84 36.096900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.136500000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.117000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.070100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0428 37.0 37.0 37.0 37.0 37.0 105-109 36.0132 37.0 37.0 37.0 37.0 37.0 110-114 35.9724 37.0 37.0 37.0 37.0 37.0 115-119 35.977 37.0 37.0 37.0 37.0 37.0 120-124 35.9018 37.0 37.0 37.0 37.0 37.0 125-129 35.94539999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.7249 37.0 37.0 37.0 37.0 37.0 135-139 35.769099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7273 37.0 37.0 37.0 37.0 37.0 145-149 35.6468 37.0 37.0 37.0 37.0 37.0 150-151 35.52575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 7.0 22 5.0 23 4.0 24 2.0 25 5.0 26 4.0 27 10.0 28 8.0 29 32.0 30 42.0 31 52.0 32 61.0 33 84.0 34 123.0 35 256.0 36 2661.0 37 642.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.08831623717789 11.758819114335752 7.480610457843382 29.67225419064298 2 21.475 10.575 35.225 32.725 3 16.6 17.025000000000002 31.1 35.275 4 20.45 21.925 27.575 30.049999999999997 5 23.575 30.375000000000004 24.975 21.075 6 20.325 33.125 24.0 22.55 7 14.899999999999999 26.85 42.875 15.375 8 16.950000000000003 25.825 33.7 23.525 9 16.575 22.900000000000002 36.625 23.9 10-14 19.139999999999997 30.875000000000004 28.405 21.58 15-19 19.7 28.815 27.839999999999996 23.645 20-24 20.105 28.994999999999997 28.095 22.805 25-29 19.445 28.910000000000004 28.01 23.635 30-34 20.150000000000002 28.735 28.01 23.105 35-39 19.48 28.575 28.15 23.794999999999998 40-44 20.549999999999997 28.499999999999996 28.15 22.8 45-49 20.875 28.355000000000004 27.544999999999998 23.225 50-54 20.169999999999998 29.415000000000003 26.8 23.615 55-59 19.895 28.884999999999998 27.35 23.87 60-64 20.745 27.855 27.589999999999996 23.810000000000002 65-69 19.715 29.28 27.395000000000003 23.61 70-74 20.369999999999997 28.825 27.150000000000002 23.655 75-79 20.625 28.03 27.405 23.94 80-84 20.080000000000002 28.365000000000002 28.325 23.23 85-89 20.775 27.889999999999997 27.400000000000002 23.935000000000002 90-94 20.974999999999998 27.67 27.744999999999997 23.61 95-99 20.575 28.110000000000003 27.67 23.645 100-104 21.165 28.199999999999996 26.884999999999998 23.75 105-109 20.97 28.105000000000004 27.52 23.405 110-114 20.62 28.410000000000004 27.279999999999998 23.69 115-119 20.9 27.794999999999998 27.715 23.59 120-124 21.015 27.735 27.255000000000003 23.995 125-129 20.785 27.445000000000004 28.13 23.64 130-134 20.72 27.500000000000004 27.525 24.255 135-139 21.52 27.250000000000004 27.255000000000003 23.974999999999998 140-144 20.810000000000002 28.410000000000004 26.905 23.875 145-149 20.794999999999998 27.83 26.784999999999997 24.59 150-151 21.175 28.037499999999998 26.0 24.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 2.0 3 1.0 4 1.0 5 1.5 6 1.0 7 1.0 8 1.5 9 2.0 10 2.0 11 1.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 5.0 25 6.5 26 8.0 27 13.5 28 19.5 29 22.5 30 26.0 31 32.0 32 45.0 33 58.5 34 76.0 35 89.5 36 100.5 37 122.0 38 131.0 39 134.0 40 158.0 41 188.5 42 206.0 43 202.5 44 201.5 45 220.0 46 230.5 47 239.0 48 234.5 49 213.0 50 196.5 51 163.0 52 130.5 53 117.5 54 104.0 55 75.5 56 51.5 57 42.0 58 31.5 59 21.5 60 15.5 61 12.5 62 5.5 63 3.0 64 3.5 65 3.5 66 4.0 67 4.0 68 3.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.38621839399833 81.325 2 8.363434287302027 15.049999999999999 3 1.0836343428730202 2.9250000000000003 4 0.08335648791330925 0.3 5 0.05557099194220616 0.25 6 0.02778549597110308 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit TAATATAGTATGCCCATAGTTGCCATACAAGCCATGATTGCTATAAAGAG 5 0.125 No Hit CCTGAATCTAATAACCAATTAGTTGGGATCCCAAACTCTCTGTATCGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.0875 0.025 0.0 0.0 0.0 90-91 0.125 0.025 0.0 0.0 0.0 92-93 0.21250000000000002 0.025 0.0 0.0 0.0 94-95 0.225 0.025 0.0 0.0 0.0 96-97 0.275 0.025 0.0 0.0 0.0 98-99 0.35 0.025 0.0 0.0 0.0 100-101 0.4125 0.025 0.0 0.0 0.0 102-103 0.5 0.025 0.0 0.0 0.0 104-105 0.55 0.025 0.0 0.0 0.0 106-107 0.6375 0.025 0.0 0.0 0.0 108-109 0.725 0.025 0.0 0.0 0.0 110-111 0.7375 0.025 0.0 0.0 0.0 112-113 0.8875 0.025 0.0 0.0 0.0 114-115 1.0125 0.025 0.0 0.0 0.0 116-117 1.15 0.025 0.0 0.0 0.0 118-119 1.3125 0.025 0.0 0.0 0.0 120-121 1.3875000000000002 0.025 0.0 0.0 0.0 122-123 1.5625 0.025 0.0 0.0 0.0 124-125 1.7625000000000002 0.025 0.0 0.0 0.0 126-127 1.9625 0.025 0.0 0.0 0.0 128-129 2.0999999999999996 0.025 0.0 0.0 0.0 130-131 2.3 0.025 0.0 0.0 0.0 132-133 2.625 0.025 0.0 0.0 0.0 134-135 2.9000000000000004 0.025 0.0 0.0 0.0 136-137 3.0375 0.025 0.0 0.0 0.0 138-139 3.325 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCATC 10 0.006830828 145.0 3 CAGAGCA 10 0.006830828 145.0 1 AGAGCAT 10 0.006830828 145.0 2 TTTTTTT 160 0.0018216907 22.65625 1 >>END_MODULE SRR12670964 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670964_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0925 37.0 37.0 37.0 37.0 37.0 2 36.1805 37.0 37.0 37.0 37.0 37.0 3 36.175 37.0 37.0 37.0 37.0 37.0 4 36.2275 37.0 37.0 37.0 37.0 37.0 5 36.2565 37.0 37.0 37.0 37.0 37.0 6 36.2325 37.0 37.0 37.0 37.0 37.0 7 36.1685 37.0 37.0 37.0 37.0 37.0 8 36.313 37.0 37.0 37.0 37.0 37.0 9 36.1995 37.0 37.0 37.0 37.0 37.0 10-14 36.2336 37.0 37.0 37.0 37.0 37.0 15-19 36.2001 37.0 37.0 37.0 37.0 37.0 20-24 36.1744 37.0 37.0 37.0 37.0 37.0 25-29 36.125600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.08540000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.090500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.0089 37.0 37.0 37.0 37.0 37.0 45-49 36.0692 37.0 37.0 37.0 37.0 37.0 50-54 36.0201 37.0 37.0 37.0 37.0 37.0 55-59 35.9964 37.0 37.0 37.0 37.0 37.0 60-64 35.9413 37.0 37.0 37.0 37.0 37.0 65-69 35.9801 37.0 37.0 37.0 37.0 37.0 70-74 35.927299999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.892399999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.88550000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.813 37.0 37.0 37.0 37.0 37.0 90-94 35.8837 37.0 37.0 37.0 37.0 37.0 95-99 35.849900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.854200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.8335 37.0 37.0 37.0 37.0 37.0 110-114 35.799099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.788 37.0 37.0 37.0 37.0 37.0 120-124 35.6823 37.0 37.0 37.0 37.0 37.0 125-129 35.68019999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.685199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.544200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.534000000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.3429 37.0 37.0 37.0 37.0 37.0 150-151 35.17375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 8.0 14 8.0 15 8.0 16 1.0 17 2.0 18 1.0 19 3.0 20 7.0 21 3.0 22 7.0 23 12.0 24 10.0 25 10.0 26 8.0 27 8.0 28 17.0 29 25.0 30 24.0 31 31.0 32 48.0 33 85.0 34 123.0 35 312.0 36 2695.0 37 540.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.875 25.95 6.925000000000001 18.25 2 31.175000000000004 24.825 26.775 17.224999999999998 3 23.225 27.150000000000002 32.6 17.025000000000002 4 25.45 34.075 21.475 19.0 5 25.45 36.375 21.05 17.125 6 23.375 38.85 19.525000000000002 18.25 7 23.0 24.099999999999998 34.925 17.974999999999998 8 22.575 24.625 28.025 24.775 9 23.225 23.7 28.625 24.45 10-14 25.035 28.349999999999998 25.525 21.09 15-19 25.465 27.575 26.790000000000003 20.169999999999998 20-24 24.38 28.73 26.125 20.765 25-29 24.51 28.410000000000004 26.615 20.465 30-34 23.955000000000002 28.395 26.625 21.025 35-39 24.08 28.060000000000002 26.39 21.47 40-44 24.25 28.015 26.685 21.05 45-49 23.835 28.310000000000002 26.889999999999997 20.965 50-54 23.815 28.155 26.655 21.375 55-59 24.02 28.155 26.775 21.05 60-64 24.19 27.265 27.169999999999998 21.375 65-69 23.745 28.375 27.150000000000002 20.73 70-74 23.895 27.91 26.97 21.224999999999998 75-79 23.735 28.335 26.985 20.945 80-84 24.18 28.645 26.540000000000003 20.635 85-89 24.51 27.250000000000004 26.974999999999998 21.265 90-94 24.295 28.294999999999998 26.27 21.14 95-99 24.03 28.07 27.22 20.68 100-104 24.005000000000003 28.125 27.055 20.815 105-109 24.705 27.889999999999997 26.55 20.855 110-114 24.154999999999998 28.749999999999996 26.724999999999998 20.369999999999997 115-119 24.565 28.02 27.089999999999996 20.325 120-124 23.799999999999997 28.78 26.834999999999997 20.585 125-129 24.345 28.465 26.815 20.375 130-134 24.0 29.080000000000002 26.935 19.985 135-139 24.095 28.560000000000002 27.0 20.345 140-144 24.67 28.12 26.669999999999998 20.54 145-149 24.72 28.79 26.625 19.865 150-151 25.124999999999996 28.775000000000002 25.6 20.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 2.0 4 1.5 5 0.5 6 1.5 7 2.5 8 2.5 9 2.5 10 2.0 11 0.5 12 1.0 13 1.5 14 1.5 15 1.5 16 1.5 17 1.5 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 2.5 24 1.0 25 1.0 26 3.5 27 5.0 28 5.0 29 8.0 30 9.5 31 14.5 32 22.5 33 27.5 34 39.5 35 52.0 36 71.5 37 95.0 38 116.5 39 130.5 40 164.0 41 195.0 42 217.5 43 237.0 44 255.0 45 265.5 46 273.0 47 281.0 48 242.0 49 200.5 50 173.0 51 148.5 52 135.5 53 121.0 54 107.0 55 81.0 56 59.0 57 50.0 58 32.0 59 24.0 60 19.0 61 15.0 62 13.5 63 10.0 64 4.0 65 1.0 66 1.0 67 1.0 68 1.0 69 2.0 70 1.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.5 76 1.0 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.5 89 1.0 90 2.0 91 1.5 92 1.0 93 1.0 94 0.0 95 0.0 96 1.5 97 2.5 98 1.5 99 1.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.01746603825895 82.075 2 7.8458552813972835 14.149999999999999 3 0.9703354588300527 2.625 4 0.05544774050457444 0.2 5 0.08317161075686166 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02772387025228722 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 23 0.575 No Hit GTTCTCAAGCACTTTGATTGGCCTGAAAGTAAAGCTGATGCATTGAGAGA 5 0.125 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 5 0.125 No Hit ACAAGTTCCTCAGAGCTTTGCTTCCTTTCTGGTCCAGTGCATTACCAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614099 spots for SRR12670964.sra Written 614099 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra Read 614082 spots for SRR12670964.sra Written 614082 spots for SRR12670964.sra SRR ids: ['SRR12670964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3lvzc71o SRR12670964.sra spots: 12281657 blocks: [[1, 614082], [614083, 1228164], [1228165, 1842246], [1842247, 2456328], [2456329, 3070410], [3070411, 3684492], [3684493, 4298574], [4298575, 4912656], [4912657, 5526738], [5526739, 6140820], [6140821, 6754902], [6754903, 7368984], [7368985, 7983066], [7983067, 8597148], [8597149, 9211230], [9211231, 9825312], [9825313, 10439394], [10439395, 11053476], [11053477, 11667558], [11667559, 12281657]] SRR12670964 file size 4152143 SRR12670964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670964 SRR12670964_1.fastq SRR12670964_2.fastq Input file: SRR12670964_1.fastq Paired file: SRR12670964_2.fastq trimmed: SRR12670964-trimmed-pair1.fastq, SRR12670964-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:56:32 2025 >> started Tue Feb 11 09:56:52 2025 >> done (19.988s) 12281657 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 13681 ( 0.11%) empty read pairs filtered out after trimming by size control 12267945 (99.89%) read pairs available; of these: 721832 ( 5.88%) trimmed read pairs available after processing 11546113 (94.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 8 0.00% 21 11 0.00% 22 17 0.00% 23 15 0.00% 24 14 0.00% 25 17 0.00% 26 22 0.00% 27 16 0.00% 28 33 0.00% 29 22 0.00% 30 30 0.00% 31 24 0.00% 32 15 0.00% 33 13 0.00% 34 16 0.00% 35 14 0.00% 36 17 0.00% 37 22 0.00% 38 20 0.00% 39 19 0.00% 40 18 0.00% 41 19 0.00% 42 20 0.00% 43 21 0.00% 44 21 0.00% 45 15 0.00% 46 27 0.00% 47 23 0.00% 48 34 0.00% 49 27 0.00% 50 32 0.00% 51 44 0.00% 52 45 0.00% 53 41 0.00% 54 51 0.00% 55 49 0.00% 56 74 0.00% 57 68 0.00% 58 87 0.00% 59 103 0.00% 60 114 0.00% 61 116 0.00% 62 161 0.00% 63 180 0.00% 64 181 0.00% 65 197 0.00% 66 201 0.00% 67 259 0.00% 68 319 0.00% 69 336 0.00% 70 387 0.00% 71 408 0.00% 72 531 0.00% 73 614 0.01% 74 577 0.00% 75 717 0.01% 76 732 0.01% 77 825 0.01% 78 878 0.01% 79 989 0.01% 80 1105 0.01% 81 1219 0.01% 82 1378 0.01% 83 1531 0.01% 84 1646 0.01% 85 1786 0.01% 86 1925 0.02% 87 2067 0.02% 88 2167 0.02% 89 2260 0.02% 90 2455 0.02% 91 2672 0.02% 92 2908 0.02% 93 3151 0.03% 94 3430 0.03% 95 3630 0.03% 96 3835 0.03% 97 3962 0.03% 98 4104 0.03% 99 4267 0.03% 100 4404 0.04% 101 4681 0.04% 102 4908 0.04% 103 5243 0.04% 104 5517 0.04% 105 5946 0.05% 106 6176 0.05% 107 6405 0.05% 108 6666 0.05% 109 6759 0.06% 110 6860 0.06% 111 7103 0.06% 112 7611 0.06% 113 7729 0.06% 114 8204 0.07% 115 8473 0.07% 116 8998 0.07% 117 9270 0.08% 118 9351 0.08% 119 9791 0.08% 120 10098 0.08% 121 10508 0.09% 122 10894 0.09% 123 11331 0.09% 124 11800 0.10% 125 12283 0.10% 126 12661 0.10% 127 12909 0.11% 128 13283 0.11% 129 14267 0.12% 130 13966 0.11% 131 14252 0.12% 132 15114 0.12% 133 15598 0.13% 134 16143 0.13% 135 16526 0.13% 136 16653 0.14% 137 17424 0.14% 138 18078 0.15% 139 18509 0.15% 140 18973 0.15% 141 19146 0.16% 142 19914 0.16% 143 20186 0.16% 144 21152 0.17% 145 21480 0.18% 146 22475 0.18% 147 22709 0.19% 148 23594 0.19% 149 23703 0.19% 150 24691 0.20% 151 11546113 94.12% 12267945 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=20 prefix-density=1.03 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=53.62 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.72 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.24 sequence-density-rank=23 fanout-score=18.01 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=5.5 sequence=GCAATGGCAGCCTCAGTTATGGCTTCA SRR12670964 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:57:38 Started mapping on | Feb 11 09:57:39 Finished on | Feb 11 09:59:46 Mapping speed, Million of reads per hour | 347.75 Number of input reads | 12267945 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11050564 Uniquely mapped reads % | 90.08% Average mapped length | 297.73 Number of splices: Total | 10649525 Number of splices: Annotated (sjdb) | 10482275 Number of splices: GT/AG | 10407222 Number of splices: GC/AG | 211211 Number of splices: AT/AC | 5821 Number of splices: Non-canonical | 25271 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278560 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 158137 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.91% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 938821 938821 938821 N_multimapping 278560 278560 278560 N_noFeature 284602 10861544 325570 N_ambiguous 228075 723 79744 UnstrandedReadsAssigned:10537887 PositiveStrandReadsAssigned:188297 NegativeStrandReadsAssigned:10645250 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670964 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670964-trimmed-pair1.fastq SRR12670964-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,267,945 reads, 10,848,574 reads pseudoaligned [quant] estimated average fragment length: 268.005 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR12670964.ke.tsv 34699 SRR12670964.se.tsv 87100 total ==> SRR12670964.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751 245 10.0158 Potri.005G024800.1.v4.1 1035 767.995 230 21.4375 Potri.004G059700.1.v4.1 961 694.11 21 2.16569 Potri.007G009000.2.v4.1 1416 1149 0 0 Potri.003G141000.2.v4.1 2943 2676 515 13.7761 Potri.016G087400.1.v4.1 270 72.9347 442 433.803 Potri.015G069301.1.v4.1 564 307.123 0 0 Potri.010G195200.1.v4.1 1773 1506 29 1.37841 Potri.012G127500.1.v4.1 977 710.066 68 6.85511 ==> SRR12670964.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 186 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR12670964 completed mapping pipeline successfully