Starting /dee2/code/volunteer_pipeline.sh SRR12670965 current disk space = 3052996534272 free memory = 1517196840 SRR12670965 SRAfilesize 1823f816ed876e3d9a8c40fbb9b2448e SRR12670965.sra SRR12670965.sra file validated SRR12670965 is paired end SRR12670965 is conventional basespace SRR12670965 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47475 37.0 37.0 37.0 37.0 37.0 2 36.448 37.0 37.0 37.0 37.0 37.0 3 36.5395 37.0 37.0 37.0 37.0 37.0 4 36.6315 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.6885 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.661 37.0 37.0 37.0 37.0 37.0 9 36.65 37.0 37.0 37.0 37.0 37.0 10-14 36.6408 37.0 37.0 37.0 37.0 37.0 15-19 36.55349999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4779 37.0 37.0 37.0 37.0 37.0 25-29 36.494099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.417899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.425599999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3768 37.0 37.0 37.0 37.0 37.0 45-49 36.14979999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.1118 37.0 37.0 37.0 37.0 37.0 55-59 35.9748 37.0 37.0 37.0 37.0 37.0 60-64 35.955499999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.8728 37.0 37.0 37.0 37.0 37.0 70-74 36.035999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.1516 37.0 37.0 37.0 37.0 37.0 80-84 36.161 37.0 37.0 37.0 37.0 37.0 85-89 36.148999999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.11710000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.108799999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.06699999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.053700000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.0509 37.0 37.0 37.0 37.0 37.0 115-119 35.9966 37.0 37.0 37.0 37.0 37.0 120-124 35.9723 37.0 37.0 37.0 37.0 37.0 125-129 35.971199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.8172 37.0 37.0 37.0 37.0 37.0 135-139 35.796499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7158 37.0 37.0 37.0 37.0 37.0 145-149 35.642199999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.32775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 5.0 22 5.0 23 5.0 24 8.0 25 10.0 26 5.0 27 14.0 28 20.0 29 20.0 30 25.0 31 35.0 32 70.0 33 118.0 34 115.0 35 226.0 36 2699.0 37 618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.91247811952989 13.12828207051763 7.9019754938734685 29.057264316079017 2 19.85 12.25 34.775 33.125 3 17.275 15.1 31.7 35.925000000000004 4 20.875 22.225 26.674999999999997 30.225 5 25.5 27.375 24.45 22.675 6 22.475 33.15 23.150000000000002 21.224999999999998 7 14.75 31.2 38.875 15.174999999999999 8 14.85 28.799999999999997 32.0 24.349999999999998 9 17.424999999999997 24.45 35.449999999999996 22.675 10-14 18.795 30.459999999999997 28.62 22.125 15-19 20.11 29.03 27.935 22.925 20-24 19.695 29.01 28.155 23.14 25-29 19.689999999999998 28.965000000000003 28.21 23.135 30-34 19.415 28.92 28.365000000000002 23.3 35-39 19.650000000000002 29.735 27.71 22.905 40-44 19.62 29.770000000000003 27.115000000000002 23.494999999999997 45-49 20.474999999999998 28.93 28.005000000000003 22.59 50-54 20.549999999999997 28.144999999999996 28.04 23.265 55-59 20.5 28.395 27.384999999999998 23.72 60-64 20.39 28.595 27.73 23.285 65-69 20.27 28.95 27.384999999999998 23.395 70-74 21.2 28.165000000000003 27.860000000000003 22.775000000000002 75-79 21.19 28.265 27.155 23.39 80-84 21.02 28.325 27.224999999999998 23.43 85-89 21.36 28.610000000000003 26.595000000000002 23.435 90-94 21.285 28.139999999999997 26.97 23.605 95-99 21.285 27.810000000000002 27.07 23.835 100-104 22.105 27.87 27.134999999999998 22.89 105-109 22.255 27.779999999999998 27.224999999999998 22.74 110-114 21.315 27.985 27.445000000000004 23.255 115-119 21.875 28.384999999999998 26.584999999999997 23.155 120-124 22.43 27.045 26.91 23.615 125-129 22.095000000000002 27.58 26.99 23.335 130-134 22.415 27.11 26.455000000000002 24.02 135-139 21.725 27.42 26.884999999999998 23.97 140-144 21.93 27.310000000000002 26.845000000000002 23.915 145-149 21.755 27.52 27.224999999999998 23.5 150-151 21.725 28.012500000000003 26.474999999999998 23.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 4.0 2 2.5 3 0.5 4 1.0 5 1.5 6 1.0 7 1.5 8 3.0 9 2.5 10 1.0 11 0.5 12 1.5 13 2.0 14 1.0 15 0.5 16 1.5 17 2.5 18 1.5 19 0.5 20 2.0 21 4.0 22 3.5 23 3.5 24 3.5 25 5.5 26 11.5 27 16.0 28 17.0 29 17.5 30 29.0 31 40.5 32 44.0 33 52.5 34 65.0 35 82.5 36 117.0 37 139.0 38 136.5 39 139.5 40 157.5 41 181.5 42 188.5 43 202.0 44 214.0 45 223.5 46 226.5 47 234.5 48 228.0 49 206.0 50 184.0 51 136.5 52 113.0 53 112.5 54 96.0 55 69.0 56 55.0 57 46.5 58 32.0 59 20.5 60 19.5 61 12.0 62 7.0 63 6.5 64 5.5 65 9.5 66 11.0 67 10.0 68 13.0 69 10.0 70 3.5 71 2.5 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.50951847704367 80.825 2 8.314669652855542 14.85 3 0.8398656215005599 2.25 4 0.13997760358342665 0.5 5 0.08398656215005598 0.375 6 0.0 0.0 7 0.027995520716685332 0.17500000000000002 8 0.055991041433370664 0.4 9 0.0 0.0 >10 0.027995520716685332 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCACAGCAATCTCGTTT 25 0.625 TruSeq Adapter, Index 4 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCACAGCAATCTCGGTT 8 0.2 TruSeq Adapter, Index 4 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCACAGCAATCGCGTTT 7 0.17500000000000002 TruSeq Adapter, Index 4 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCACAGCAATCTCGTAT 5 0.125 TruSeq Adapter, Index 4 (97% over 37bp) GCGGGAAAGCCTGGATGACATGACTCGAGAGAGCAGCGACAAATTGACTC 5 0.125 No Hit GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.2375 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.05 0.0 0.0 0.0 0.0 138-139 4.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACAC 10 0.006830828 145.0 1 ACCATTC 10 0.006830828 145.0 4 ACTCCTG 10 0.006830828 145.0 145 >>END_MODULE SRR12670965 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670965_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.185 37.0 37.0 37.0 37.0 37.0 2 36.1055 37.0 37.0 37.0 37.0 37.0 3 36.149 37.0 37.0 37.0 37.0 37.0 4 36.2815 37.0 37.0 37.0 37.0 37.0 5 36.2705 37.0 37.0 37.0 37.0 37.0 6 36.4235 37.0 37.0 37.0 37.0 37.0 7 36.2805 37.0 37.0 37.0 37.0 37.0 8 36.247 37.0 37.0 37.0 37.0 37.0 9 36.323 37.0 37.0 37.0 37.0 37.0 10-14 36.2401 37.0 37.0 37.0 37.0 37.0 15-19 36.2101 37.0 37.0 37.0 37.0 37.0 20-24 36.14 37.0 37.0 37.0 37.0 37.0 25-29 36.01239999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9895 37.0 37.0 37.0 37.0 37.0 35-39 35.929199999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.9056 37.0 37.0 37.0 37.0 37.0 45-49 35.9055 37.0 37.0 37.0 37.0 37.0 50-54 35.8729 37.0 37.0 37.0 37.0 37.0 55-59 35.901500000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.932 37.0 37.0 37.0 37.0 37.0 65-69 35.9071 37.0 37.0 37.0 37.0 37.0 70-74 35.846500000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.865700000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.876400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8779 37.0 37.0 37.0 37.0 37.0 90-94 35.9006 37.0 37.0 37.0 37.0 37.0 95-99 36.0009 37.0 37.0 37.0 37.0 37.0 100-104 35.977199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8515 37.0 37.0 37.0 37.0 37.0 110-114 35.885400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.9278 37.0 37.0 37.0 37.0 37.0 120-124 35.854499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.8395 37.0 37.0 37.0 37.0 37.0 130-134 35.803900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.7316 37.0 37.0 37.0 37.0 37.0 140-144 35.7257 37.0 37.0 37.0 37.0 37.0 145-149 35.544399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.292249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 3.0 15 6.0 16 9.0 17 3.0 18 2.0 19 5.0 20 5.0 21 9.0 22 9.0 23 4.0 24 9.0 25 7.0 26 14.0 27 8.0 28 25.0 29 18.0 30 17.0 31 36.0 32 40.0 33 79.0 34 106.0 35 327.0 36 2627.0 37 623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.3 27.575 8.225 20.9 2 33.074999999999996 23.674999999999997 26.974999999999998 16.275000000000002 3 22.925 25.775 33.2 18.099999999999998 4 26.25 31.8 24.25 17.7 5 27.625 35.65 20.474999999999998 16.25 6 23.65 38.775 19.75 17.825 7 23.474999999999998 23.175 34.4 18.95 8 23.7 25.124999999999996 27.675 23.5 9 24.2 22.900000000000002 29.65 23.25 10-14 26.495 28.74 25.074999999999996 19.689999999999998 15-19 25.44 27.63 26.085 20.845 20-24 25.069999999999997 28.15 26.25 20.53 25-29 24.855 27.805000000000003 26.555 20.785 30-34 24.95 27.145000000000003 27.060000000000002 20.845 35-39 24.345 27.72 26.825 21.11 40-44 23.855 28.215 26.8 21.13 45-49 24.099999999999998 28.294999999999998 26.729999999999997 20.875 50-54 24.07 27.91 27.134999999999998 20.885 55-59 24.185000000000002 26.889999999999997 27.529999999999998 21.395 60-64 24.815 27.450000000000003 26.58 21.154999999999998 65-69 25.025 26.875 27.505000000000003 20.595 70-74 24.675 27.68 26.919999999999998 20.724999999999998 75-79 24.295 27.845 27.3 20.560000000000002 80-84 24.965 27.54 26.68 20.815 85-89 24.945 27.700000000000003 26.900000000000002 20.455000000000002 90-94 24.81 27.29 26.66 21.240000000000002 95-99 24.88 27.529999999999998 26.540000000000003 21.05 100-104 25.095 27.544999999999998 27.250000000000004 20.11 105-109 25.174999999999997 26.955000000000002 27.084999999999997 20.785 110-114 25.405 27.560000000000002 27.295 19.74 115-119 24.985 28.355000000000004 26.275 20.385 120-124 25.355 27.58 26.525 20.54 125-129 25.16 27.634999999999998 27.0 20.205000000000002 130-134 26.215 26.995 26.8 19.99 135-139 25.885 27.63 26.755000000000003 19.73 140-144 25.61 27.775 26.6 20.015 145-149 25.75 27.79 26.35 20.11 150-151 26.0625 27.8125 26.5125 19.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 1.5 6 1.0 7 1.5 8 1.0 9 0.5 10 1.0 11 0.5 12 2.0 13 2.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.5 21 2.0 22 3.0 23 2.0 24 1.0 25 3.0 26 4.0 27 5.5 28 8.0 29 8.5 30 11.0 31 15.0 32 22.0 33 31.0 34 39.0 35 50.0 36 63.0 37 86.0 38 108.5 39 137.5 40 167.5 41 194.5 42 242.5 43 256.0 44 246.0 45 259.5 46 259.5 47 246.5 48 236.5 49 209.5 50 187.5 51 162.0 52 129.0 53 108.5 54 102.0 55 81.5 56 60.0 57 51.5 58 29.0 59 18.5 60 15.0 61 11.5 62 12.0 63 9.0 64 6.0 65 5.0 66 2.5 67 3.5 68 3.0 69 1.5 70 1.5 71 0.5 72 0.5 73 1.0 74 1.5 75 2.0 76 2.0 77 1.0 78 0.5 79 1.0 80 1.0 81 1.5 82 2.0 83 2.0 84 1.0 85 0.5 86 1.0 87 1.0 88 1.0 89 2.0 90 1.5 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 1.0 97 1.5 98 3.0 99 8.0 100 14.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37787635153867 82.39999999999999 2 7.429997227612975 13.4 3 0.9703354588300527 2.625 4 0.08317161075686166 0.3 5 0.08317161075686166 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05544774050457444 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 26 0.65 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit GTTTGAAGATAGGCAAATTTTATTGACATCAGAAATTATGGTTTGCATAG 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0125 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.1875 0.0 0.0 0.025 0.0 92-93 0.2375 0.0 0.0 0.025 0.0 94-95 0.375 0.0 0.0 0.025 0.0 96-97 0.5125 0.0 0.0 0.025 0.0 98-99 0.5625 0.0 0.0 0.025 0.0 100-101 0.65 0.0 0.0 0.025 0.0 102-103 0.75 0.0 0.0 0.025 0.0 104-105 0.8875 0.0 0.0 0.025 0.0 106-107 1.025 0.0 0.0 0.025 0.0 108-109 1.1375 0.0 0.0 0.025 0.0 110-111 1.2625000000000002 0.0 0.0 0.025 0.0 112-113 1.3625 0.0 0.0 0.025 0.0 114-115 1.5125000000000002 0.0 0.0 0.025 0.0 116-117 1.6625 0.0 0.0 0.025 0.0 118-119 1.9125 0.0 0.0 0.025 0.0 120-121 2.1125 0.0 0.0 0.025 0.0 122-123 2.35 0.0 0.0 0.025 0.0 124-125 2.6125 0.0 0.0 0.025 0.0 126-127 2.825 0.0 0.0 0.025 0.0 128-129 3.0125 0.0 0.0 0.025 0.0 130-131 3.3125 0.0 0.0 0.025 0.0 132-133 3.6500000000000004 0.0 0.0 0.025 0.0 134-135 3.8499999999999996 0.0 0.0 0.025 0.0 136-137 4.15 0.0 0.0 0.025 0.0 138-139 4.5 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 3 AGGAACA 10 0.006830828 145.0 1 ACTCCAA 10 0.006830828 145.0 8 GAACAGA 10 0.006830828 145.0 3 CAGACGA 10 0.006830828 145.0 6 ATACTCC 10 0.006830828 145.0 6 AGCCGAA 10 0.006830828 145.0 145 TACTCCA 10 0.006830828 145.0 7 CATACTC 10 0.006830828 145.0 5 ATTCATA 10 0.006830828 145.0 2 TCATACT 10 0.006830828 145.0 4 >>END_MODULE Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551081 spots for SRR12670965.sra Written 551081 spots for SRR12670965.sra Read 551084 spots for SRR12670965.sra Written 551084 spots for SRR12670965.sra SRR ids: ['SRR12670965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rsipitwh SRR12670965.sra spots: 11021623 blocks: [[1, 551081], [551082, 1102162], [1102163, 1653243], [1653244, 2204324], [2204325, 2755405], [2755406, 3306486], [3306487, 3857567], [3857568, 4408648], [4408649, 4959729], [4959730, 5510810], [5510811, 6061891], [6061892, 6612972], [6612973, 7164053], [7164054, 7715134], [7715135, 8266215], [8266216, 8817296], [8817297, 9368377], [9368378, 9919458], [9919459, 10470539], [10470540, 11021623]] SRR12670965 file size 3723929 SRR12670965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670965 SRR12670965_1.fastq SRR12670965_2.fastq Input file: SRR12670965_1.fastq Paired file: SRR12670965_2.fastq trimmed: SRR12670965-trimmed-pair1.fastq, SRR12670965-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:39:45 2025 >> started Tue Feb 11 10:39:59 2025 >> done (13.417s) 11021623 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 116709 ( 1.06%) empty read pairs filtered out after trimming by size control 10904865 (98.94%) read pairs available; of these: 805561 ( 7.39%) trimmed read pairs available after processing 10099304 (92.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 6 0.00% 21 12 0.00% 22 7 0.00% 23 14 0.00% 24 24 0.00% 25 24 0.00% 26 15 0.00% 27 21 0.00% 28 20 0.00% 29 23 0.00% 30 19 0.00% 31 23 0.00% 32 31 0.00% 33 23 0.00% 34 22 0.00% 35 16 0.00% 36 24 0.00% 37 23 0.00% 38 19 0.00% 39 24 0.00% 40 20 0.00% 41 23 0.00% 42 25 0.00% 43 17 0.00% 44 25 0.00% 45 38 0.00% 46 44 0.00% 47 33 0.00% 48 40 0.00% 49 43 0.00% 50 60 0.00% 51 62 0.00% 52 59 0.00% 53 59 0.00% 54 76 0.00% 55 67 0.00% 56 78 0.00% 57 80 0.00% 58 90 0.00% 59 144 0.00% 60 146 0.00% 61 156 0.00% 62 204 0.00% 63 199 0.00% 64 260 0.00% 65 275 0.00% 66 308 0.00% 67 309 0.00% 68 374 0.00% 69 383 0.00% 70 507 0.00% 71 529 0.00% 72 640 0.01% 73 706 0.01% 74 777 0.01% 75 848 0.01% 76 976 0.01% 77 1023 0.01% 78 1022 0.01% 79 1215 0.01% 80 1407 0.01% 81 1558 0.01% 82 1728 0.02% 83 1833 0.02% 84 2095 0.02% 85 2292 0.02% 86 2442 0.02% 87 2470 0.02% 88 2689 0.02% 89 2959 0.03% 90 3177 0.03% 91 3329 0.03% 92 3534 0.03% 93 4002 0.04% 94 4196 0.04% 95 4686 0.04% 96 4537 0.04% 97 4938 0.05% 98 5065 0.05% 99 5211 0.05% 100 5622 0.05% 101 5596 0.05% 102 5901 0.05% 103 6327 0.06% 104 6582 0.06% 105 7048 0.06% 106 7223 0.07% 107 7551 0.07% 108 7635 0.07% 109 7959 0.07% 110 8252 0.08% 111 8464 0.08% 112 9061 0.08% 113 9209 0.08% 114 9695 0.09% 115 10065 0.09% 116 10176 0.09% 117 10883 0.10% 118 10928 0.10% 119 11283 0.10% 120 11785 0.11% 121 11922 0.11% 122 12394 0.11% 123 12945 0.12% 124 13638 0.13% 125 13828 0.13% 126 14057 0.13% 127 14510 0.13% 128 15161 0.14% 129 15405 0.14% 130 15987 0.15% 131 16103 0.15% 132 16489 0.15% 133 16860 0.15% 134 17217 0.16% 135 18038 0.17% 136 18408 0.17% 137 18429 0.17% 138 19216 0.18% 139 20193 0.19% 140 20293 0.19% 141 20717 0.19% 142 21071 0.19% 143 21491 0.20% 144 22545 0.21% 145 22897 0.21% 146 23131 0.21% 147 23816 0.22% 148 24455 0.22% 149 24930 0.23% 150 25678 0.24% 151 10099304 92.61% 10904865 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.49 prefix-fanout=2.0 sequence=GTACAGCCTTCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=32.03 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=38 fanout-score=29.51 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=5.3 sequence=AAGGGAAAGGGTGTGTACCAATATGTCGACAAATATGGTGCTAATGTGGATGGCTACAGCCCTATCTACAACACTGATGAATGGTCCCCAACTGGCGAT SRR12670965 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:40:45 Started mapping on | Feb 11 10:40:45 Finished on | Feb 11 10:42:22 Mapping speed, Million of reads per hour | 404.72 Number of input reads | 10904865 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 9923334 Uniquely mapped reads % | 91.00% Average mapped length | 296.93 Number of splices: Total | 8885798 Number of splices: Annotated (sjdb) | 8731124 Number of splices: GT/AG | 8690793 Number of splices: GC/AG | 162597 Number of splices: AT/AC | 6599 Number of splices: Non-canonical | 25809 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.03% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269185 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 118841 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.09% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712346 712346 712346 N_multimapping 269185 269185 269185 N_noFeature 266365 9720779 317198 N_ambiguous 216943 1027 64848 UnstrandedReadsAssigned:9440026 PositiveStrandReadsAssigned:201528 NegativeStrandReadsAssigned:9541288 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670965 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670965-trimmed-pair1.fastq SRR12670965-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,904,865 reads, 9,696,581 reads pseudoaligned [quant] estimated average fragment length: 255.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52401 SRR12670965.ke.tsv 34699 SRR12670965.se.tsv 87100 total ==> SRR12670965.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.02 284 12.274 Potri.005G024800.1.v4.1 1035 780.021 381 37.2172 Potri.004G059700.1.v4.1 961 706.061 1 0.107915 Potri.007G009000.2.v4.1 1416 1161.02 0 0 Potri.003G141000.2.v4.1 2943 2688.02 532 15.0801 Potri.016G087400.1.v4.1 270 76.5871 500.589 498.023 Potri.015G069301.1.v4.1 564 316.374 0 0 Potri.010G195200.1.v4.1 1773 1518.02 70 3.51354 Potri.012G127500.1.v4.1 977 722.038 173 18.2562 ==> SRR12670965.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 104 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR12670965 completed mapping pipeline successfully