Starting /dee2/code/volunteer_pipeline.sh SRR12670966 current disk space = 3053504929792 free memory = 1411521112 SRR12670966 SRAfilesize 431bddc2180787ee53adc5457e355638 SRR12670966.sra SRR12670966.sra file validated SRR12670966 is paired end SRR12670966 is conventional basespace SRR12670966 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4555 37.0 37.0 37.0 37.0 37.0 2 36.466 37.0 37.0 37.0 37.0 37.0 3 36.6465 37.0 37.0 37.0 37.0 37.0 4 36.6435 37.0 37.0 37.0 37.0 37.0 5 36.647 37.0 37.0 37.0 37.0 37.0 6 36.606 37.0 37.0 37.0 37.0 37.0 7 36.5825 37.0 37.0 37.0 37.0 37.0 8 36.6435 37.0 37.0 37.0 37.0 37.0 9 36.694 37.0 37.0 37.0 37.0 37.0 10-14 36.6421 37.0 37.0 37.0 37.0 37.0 15-19 36.613600000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.53 37.0 37.0 37.0 37.0 37.0 25-29 36.5111 37.0 37.0 37.0 37.0 37.0 30-34 36.4717 37.0 37.0 37.0 37.0 37.0 35-39 36.445800000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.473 37.0 37.0 37.0 37.0 37.0 45-49 36.432 37.0 37.0 37.0 37.0 37.0 50-54 36.390699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.396 37.0 37.0 37.0 37.0 37.0 60-64 36.3549 37.0 37.0 37.0 37.0 37.0 65-69 36.35730000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3266 37.0 37.0 37.0 37.0 37.0 75-79 36.3246 37.0 37.0 37.0 37.0 37.0 80-84 36.25750000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2082 37.0 37.0 37.0 37.0 37.0 90-94 36.2716 37.0 37.0 37.0 37.0 37.0 95-99 36.211 37.0 37.0 37.0 37.0 37.0 100-104 36.1716 37.0 37.0 37.0 37.0 37.0 105-109 36.1451 37.0 37.0 37.0 37.0 37.0 110-114 36.1429 37.0 37.0 37.0 37.0 37.0 115-119 36.087900000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0736 37.0 37.0 37.0 37.0 37.0 125-129 36.079699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.8842 37.0 37.0 37.0 37.0 37.0 135-139 35.988800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.876799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.696799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.55825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 0.0 22 1.0 23 5.0 24 5.0 25 5.0 26 5.0 27 8.0 28 16.0 29 9.0 30 28.0 31 49.0 32 57.0 33 73.0 34 91.0 35 238.0 36 2741.0 37 665.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.949999999999996 12.950000000000001 5.25 40.849999999999994 2 19.625 10.65 36.05 33.675 3 15.925 14.099999999999998 29.725 40.25 4 20.424999999999997 21.099999999999998 25.924999999999997 32.550000000000004 5 25.2 26.8 24.375 23.625 6 21.55 32.675 22.8 22.975 7 16.025 27.85 39.975 16.150000000000002 8 15.875 26.650000000000002 33.550000000000004 23.925 9 16.825000000000003 24.55 35.4 23.225 10-14 19.24 29.830000000000002 29.21 21.72 15-19 20.0 27.485 28.21 24.305 20-24 19.775000000000002 28.110000000000003 28.255000000000003 23.86 25-29 20.16 28.13 28.225 23.485 30-34 19.61 28.395 27.905 24.09 35-39 19.509999999999998 28.58 28.13 23.78 40-44 19.794999999999998 29.57 27.060000000000002 23.575 45-49 20.225 28.599999999999998 27.58 23.595 50-54 20.119999999999997 29.13 27.634999999999998 23.115 55-59 19.935 28.744999999999997 27.634999999999998 23.685000000000002 60-64 20.349999999999998 28.1 27.345000000000002 24.205 65-69 20.5 28.105000000000004 27.584999999999997 23.810000000000002 70-74 20.355 28.945 26.700000000000003 24.0 75-79 20.385 28.355000000000004 27.32 23.94 80-84 20.54 28.115000000000002 27.72 23.625 85-89 20.565 28.470000000000002 26.855 24.11 90-94 20.895 28.58 26.685 23.84 95-99 20.599999999999998 27.165 27.865000000000002 24.37 100-104 20.495 27.815 27.72 23.97 105-109 20.585 28.285 27.365000000000002 23.765 110-114 20.555 28.16 27.694999999999997 23.59 115-119 20.855 27.375 27.83 23.94 120-124 20.505000000000003 27.655 27.43 24.41 125-129 21.165 27.74 27.095000000000002 24.0 130-134 21.27 27.42 27.134999999999998 24.175 135-139 21.535 27.339999999999996 26.915 24.21 140-144 21.529999999999998 28.65 26.395000000000003 23.425 145-149 20.97 27.68 26.965 24.385 150-151 20.6625 26.987499999999997 27.0 25.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.5 20 2.0 21 3.0 22 2.0 23 1.0 24 2.0 25 5.0 26 7.5 27 6.5 28 9.0 29 15.5 30 20.5 31 22.5 32 35.0 33 48.5 34 58.5 35 74.0 36 91.5 37 106.0 38 120.0 39 131.0 40 161.5 41 183.5 42 188.0 43 232.0 44 253.5 45 258.0 46 261.0 47 254.5 48 244.5 49 216.0 50 197.0 51 162.0 52 132.0 53 125.0 54 102.0 55 74.0 56 58.5 57 40.5 58 20.5 59 18.0 60 16.5 61 10.5 62 6.5 63 3.0 64 2.0 65 3.0 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.9 #Duplication Level Percentage of deduplicated Percentage of total 1 90.43381535038932 81.3 2 8.120133481646272 14.6 3 1.2235817575083427 3.3000000000000003 4 0.22246941045606228 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.8624999999999998 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.2125000000000004 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAA 10 0.006830828 145.0 8 AAAAAAA 125 2.2566765E-6 12.76 115-119 >>END_MODULE SRR12670966 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670966_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2685 37.0 37.0 37.0 37.0 37.0 2 36.334 37.0 37.0 37.0 37.0 37.0 3 36.28 37.0 37.0 37.0 37.0 37.0 4 36.367 37.0 37.0 37.0 37.0 37.0 5 36.4375 37.0 37.0 37.0 37.0 37.0 6 36.4295 37.0 37.0 37.0 37.0 37.0 7 36.42 37.0 37.0 37.0 37.0 37.0 8 36.4765 37.0 37.0 37.0 37.0 37.0 9 36.5345 37.0 37.0 37.0 37.0 37.0 10-14 36.4796 37.0 37.0 37.0 37.0 37.0 15-19 36.4769 37.0 37.0 37.0 37.0 37.0 20-24 36.4658 37.0 37.0 37.0 37.0 37.0 25-29 36.3917 37.0 37.0 37.0 37.0 37.0 30-34 36.4045 37.0 37.0 37.0 37.0 37.0 35-39 36.3917 37.0 37.0 37.0 37.0 37.0 40-44 36.3887 37.0 37.0 37.0 37.0 37.0 45-49 36.38889999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.336 37.0 37.0 37.0 37.0 37.0 55-59 36.2932 37.0 37.0 37.0 37.0 37.0 60-64 36.3316 37.0 37.0 37.0 37.0 37.0 65-69 36.304 37.0 37.0 37.0 37.0 37.0 70-74 36.3018 37.0 37.0 37.0 37.0 37.0 75-79 36.250099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2884 37.0 37.0 37.0 37.0 37.0 85-89 36.1652 37.0 37.0 37.0 37.0 37.0 90-94 36.1979 37.0 37.0 37.0 37.0 37.0 95-99 36.2141 37.0 37.0 37.0 37.0 37.0 100-104 36.284299999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.15 37.0 37.0 37.0 37.0 37.0 110-114 36.185199999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1356 37.0 37.0 37.0 37.0 37.0 120-124 36.0218 37.0 37.0 37.0 37.0 37.0 125-129 36.036 37.0 37.0 37.0 37.0 37.0 130-134 36.05579999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9705 37.0 37.0 37.0 37.0 37.0 140-144 35.981700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.8106 37.0 37.0 37.0 37.0 37.0 150-151 35.536 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 2.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.0 22 4.0 23 0.0 24 1.0 25 7.0 26 3.0 27 16.0 28 12.0 29 25.0 30 17.0 31 21.0 32 35.0 33 59.0 34 107.0 35 289.0 36 2762.0 37 630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05 25.525 9.125 27.3 2 26.35 23.549999999999997 32.95 17.150000000000002 3 18.875 26.775 35.125 19.225 4 24.65 32.824999999999996 23.875 18.65 5 26.775 36.35 21.175 15.7 6 20.925 40.275 22.225 16.575 7 22.375 22.575 36.225 18.825 8 21.325 26.650000000000002 28.575 23.45 9 23.0 24.375 29.075 23.549999999999997 10-14 23.59 28.525 26.72 21.165 15-19 23.810000000000002 27.915 26.97 21.305 20-24 23.405 27.839999999999996 27.505000000000003 21.25 25-29 23.674999999999997 28.405 26.779999999999998 21.14 30-34 23.085 28.294999999999998 27.450000000000003 21.17 35-39 23.44 28.26 27.279999999999998 21.02 40-44 23.835 28.335 26.75 21.08 45-49 23.405 28.315 27.315 20.965 50-54 23.419999999999998 27.22 27.665 21.695 55-59 23.345 27.975 26.905 21.775 60-64 23.705000000000002 27.82 26.884999999999998 21.59 65-69 24.099999999999998 27.529999999999998 27.1 21.27 70-74 23.645 27.875 26.884999999999998 21.595 75-79 23.544999999999998 27.694999999999997 27.055 21.705 80-84 23.095 27.43 27.810000000000002 21.665 85-89 24.14 27.77 27.095000000000002 20.995 90-94 23.595 27.975 27.565 20.865000000000002 95-99 23.810000000000002 28.13 27.07 20.990000000000002 100-104 23.74 27.500000000000004 27.235 21.525 105-109 23.7 27.93 27.224999999999998 21.145 110-114 23.155 28.470000000000002 26.77 21.605 115-119 23.93 28.655 26.46 20.955 120-124 24.63 28.155 26.619999999999997 20.595 125-129 23.51 28.050000000000004 27.544999999999998 20.895 130-134 24.63 28.050000000000004 26.645000000000003 20.674999999999997 135-139 23.695 28.18 27.250000000000004 20.875 140-144 24.345 27.54 27.43 20.685000000000002 145-149 25.045 28.050000000000004 26.165 20.74 150-151 25.2125 29.299999999999997 25.3 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 2.0 23 4.0 24 4.0 25 3.0 26 3.0 27 5.0 28 6.5 29 5.0 30 6.5 31 12.5 32 19.0 33 24.5 34 32.5 35 55.5 36 77.0 37 92.5 38 110.0 39 154.5 40 186.0 41 199.0 42 212.0 43 248.0 44 278.0 45 272.0 46 271.0 47 256.5 48 246.5 49 238.0 50 198.0 51 151.5 52 126.5 53 109.5 54 101.5 55 81.0 56 56.5 57 41.0 58 28.0 59 23.0 60 16.0 61 10.0 62 8.0 63 3.0 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51843637371778 81.625 2 8.344884945938453 15.049999999999999 3 0.9426115885777655 2.55 4 0.1386193512614361 0.5 5 0.02772387025228722 0.125 6 0.02772387025228722 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CAGTTATCTAGCCAACGAGGTTTCTTAGCTCTACTGATAATATGGATTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.11249999999999999 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.2874999999999996 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTTCG 10 0.006830828 145.0 9 TTTTTTT 50 2.0994885E-6 23.199999 125-129 >>END_MODULE Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575438 spots for SRR12670966.sra Written 575438 spots for SRR12670966.sra Read 575448 spots for SRR12670966.sra Written 575448 spots for SRR12670966.sra SRR ids: ['SRR12670966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t04cn3k3 SRR12670966.sra spots: 11508770 blocks: [[1, 575438], [575439, 1150876], [1150877, 1726314], [1726315, 2301752], [2301753, 2877190], [2877191, 3452628], [3452629, 4028066], [4028067, 4603504], [4603505, 5178942], [5178943, 5754380], [5754381, 6329818], [6329819, 6905256], [6905257, 7480694], [7480695, 8056132], [8056133, 8631570], [8631571, 9207008], [9207009, 9782446], [9782447, 10357884], [10357885, 10933322], [10933323, 11508770]] SRR12670966 file size 3889483 SRR12670966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670966 SRR12670966_1.fastq SRR12670966_2.fastq Input file: SRR12670966_1.fastq Paired file: SRR12670966_2.fastq trimmed: SRR12670966-trimmed-pair1.fastq, SRR12670966-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:14:51 2025 >> started Tue Feb 11 10:15:03 2025 >> done (12.277s) 11508770 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 4694 ( 0.04%) empty read pairs filtered out after trimming by size control 11504057 (99.96%) read pairs available; of these: 756807 ( 6.58%) trimmed read pairs available after processing 10747250 (93.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 6 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 9 0.00% 31 3 0.00% 32 5 0.00% 33 7 0.00% 34 7 0.00% 35 7 0.00% 36 3 0.00% 37 6 0.00% 38 14 0.00% 39 9 0.00% 40 5 0.00% 41 9 0.00% 42 20 0.00% 43 12 0.00% 44 13 0.00% 45 12 0.00% 46 18 0.00% 47 19 0.00% 48 29 0.00% 49 27 0.00% 50 34 0.00% 51 27 0.00% 52 49 0.00% 53 25 0.00% 54 28 0.00% 55 31 0.00% 56 52 0.00% 57 52 0.00% 58 60 0.00% 59 88 0.00% 60 88 0.00% 61 105 0.00% 62 127 0.00% 63 112 0.00% 64 166 0.00% 65 153 0.00% 66 178 0.00% 67 192 0.00% 68 225 0.00% 69 256 0.00% 70 288 0.00% 71 309 0.00% 72 388 0.00% 73 406 0.00% 74 472 0.00% 75 569 0.00% 76 605 0.01% 77 627 0.01% 78 767 0.01% 79 881 0.01% 80 889 0.01% 81 1021 0.01% 82 1140 0.01% 83 1223 0.01% 84 1372 0.01% 85 1499 0.01% 86 1729 0.02% 87 1822 0.02% 88 1952 0.02% 89 2163 0.02% 90 2321 0.02% 91 2582 0.02% 92 2613 0.02% 93 2875 0.02% 94 3129 0.03% 95 3550 0.03% 96 3638 0.03% 97 3993 0.03% 98 4065 0.04% 99 4307 0.04% 100 4461 0.04% 101 4649 0.04% 102 5024 0.04% 103 5213 0.05% 104 5676 0.05% 105 6050 0.05% 106 6322 0.05% 107 6490 0.06% 108 6801 0.06% 109 7305 0.06% 110 7378 0.06% 111 7561 0.07% 112 8147 0.07% 113 8319 0.07% 114 8740 0.08% 115 9022 0.08% 116 9407 0.08% 117 9849 0.09% 118 10409 0.09% 119 10363 0.09% 120 11169 0.10% 121 11191 0.10% 122 11512 0.10% 123 12042 0.10% 124 12666 0.11% 125 12837 0.11% 126 13330 0.12% 127 14080 0.12% 128 14535 0.13% 129 14531 0.13% 130 15221 0.13% 131 15860 0.14% 132 16072 0.14% 133 16677 0.14% 134 16625 0.14% 135 17143 0.15% 136 18037 0.16% 137 18457 0.16% 138 18893 0.16% 139 19942 0.17% 140 20576 0.18% 141 20994 0.18% 142 21482 0.19% 143 21613 0.19% 144 22567 0.20% 145 22709 0.20% 146 23243 0.20% 147 23942 0.21% 148 24649 0.21% 149 25188 0.22% 150 26325 0.23% 151 10747250 93.42% 11504057 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.79 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=79.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.61 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=18.03 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR12670966 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:15:46 Started mapping on | Feb 11 10:15:47 Finished on | Feb 11 10:16:58 Mapping speed, Million of reads per hour | 583.30 Number of input reads | 11504057 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 10939415 Uniquely mapped reads % | 95.09% Average mapped length | 297.92 Number of splices: Total | 10834688 Number of splices: Annotated (sjdb) | 10667783 Number of splices: GT/AG | 10591482 Number of splices: GC/AG | 212325 Number of splices: AT/AC | 6262 Number of splices: Non-canonical | 24619 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254247 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 63009 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310395 310395 310395 N_multimapping 254247 254247 254247 N_noFeature 274933 10744215 324721 N_ambiguous 220431 748 74742 UnstrandedReadsAssigned:10444051 PositiveStrandReadsAssigned:194452 NegativeStrandReadsAssigned:10539952 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670966 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670966-trimmed-pair1.fastq SRR12670966-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,504,057 reads, 10,574,152 reads pseudoaligned [quant] estimated average fragment length: 261.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,271 rounds 52401 SRR12670966.ke.tsv 34699 SRR12670966.se.tsv 87100 total ==> SRR12670966.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.3 234 9.47475 Potri.005G024800.1.v4.1 1035 774.302 218 20.0329 Potri.004G059700.1.v4.1 961 700.385 3 0.304778 Potri.007G009000.2.v4.1 1416 1155.3 0 0 Potri.003G141000.2.v4.1 2943 2682.3 471 12.4943 Potri.016G087400.1.v4.1 270 74.0939 590 566.589 Potri.015G069301.1.v4.1 564 312.287 0 0 Potri.010G195200.1.v4.1 1773 1512.3 16 0.7528 Potri.012G127500.1.v4.1 977 716.341 44 4.3705 ==> SRR12670966.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 101 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12670966 completed mapping pipeline successfully