Starting /dee2/code/volunteer_pipeline.sh SRR12670967 current disk space = 3053479239680 free memory = 1152800544 SRR12670967 SRAfilesize 2e7aa2c7082322d54072c58b369a3696 SRR12670967.sra SRR12670967.sra file validated SRR12670967 is paired end SRR12670967 is conventional basespace SRR12670967 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670967_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36875 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.4965 37.0 37.0 37.0 37.0 37.0 4 36.5525 37.0 37.0 37.0 37.0 37.0 5 36.5965 37.0 37.0 37.0 37.0 37.0 6 36.601 37.0 37.0 37.0 37.0 37.0 7 36.574 37.0 37.0 37.0 37.0 37.0 8 36.6085 37.0 37.0 37.0 37.0 37.0 9 36.6735 37.0 37.0 37.0 37.0 37.0 10-14 36.602999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5954 37.0 37.0 37.0 37.0 37.0 20-24 36.5267 37.0 37.0 37.0 37.0 37.0 25-29 36.5207 37.0 37.0 37.0 37.0 37.0 30-34 36.48700000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4651 37.0 37.0 37.0 37.0 37.0 40-44 36.46750000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.421499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.380300000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3874 37.0 37.0 37.0 37.0 37.0 60-64 36.325 37.0 37.0 37.0 37.0 37.0 65-69 36.38119999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.34590000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2571 37.0 37.0 37.0 37.0 37.0 80-84 36.2288 37.0 37.0 37.0 37.0 37.0 85-89 36.2398 37.0 37.0 37.0 37.0 37.0 90-94 36.2307 37.0 37.0 37.0 37.0 37.0 95-99 36.1765 37.0 37.0 37.0 37.0 37.0 100-104 36.1676 37.0 37.0 37.0 37.0 37.0 105-109 36.112 37.0 37.0 37.0 37.0 37.0 110-114 36.06849999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.080799999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0444 37.0 37.0 37.0 37.0 37.0 125-129 36.021100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.842 37.0 37.0 37.0 37.0 37.0 135-139 35.908 37.0 37.0 37.0 37.0 37.0 140-144 35.8095 37.0 37.0 37.0 37.0 37.0 145-149 35.714 37.0 37.0 37.0 37.0 37.0 150-151 35.53775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 3.0 22 0.0 23 3.0 24 1.0 25 5.0 26 6.0 27 8.0 28 9.0 29 21.0 30 34.0 31 39.0 32 50.0 33 74.0 34 122.0 35 276.0 36 2714.0 37 633.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.13528382095524 10.152538134533634 6.526631657914479 42.18554638659665 2 19.05 11.4 37.875 31.674999999999997 3 17.599999999999998 15.1 26.474999999999998 40.825 4 21.775 22.400000000000002 25.424999999999997 30.4 5 23.474999999999998 29.075 25.45 22.0 6 20.025000000000002 33.050000000000004 24.5 22.425 7 14.75 26.025 42.05 17.175 8 16.975 25.1 33.125 24.8 9 16.725 23.125 37.3 22.85 10-14 19.13 30.14 27.884999999999998 22.845 15-19 19.64 28.065 28.249999999999996 24.044999999999998 20-24 19.96 27.950000000000003 28.02 24.07 25-29 20.0 28.285 28.055000000000003 23.66 30-34 20.135 27.794999999999998 28.43 23.64 35-39 20.445 27.785 27.750000000000004 24.02 40-44 20.294999999999998 28.16 27.450000000000003 24.095 45-49 20.244999999999997 28.455000000000002 27.685 23.615 50-54 20.18 28.355000000000004 27.52 23.945 55-59 20.330000000000002 28.965000000000003 27.13 23.575 60-64 20.880000000000003 27.644999999999996 27.71 23.765 65-69 20.349999999999998 28.68 27.644999999999996 23.325000000000003 70-74 20.61 28.275 27.195000000000004 23.919999999999998 75-79 20.549999999999997 28.505000000000003 27.38 23.565 80-84 20.995 27.685 27.529999999999998 23.79 85-89 20.665 27.800000000000004 27.445000000000004 24.09 90-94 20.87 28.050000000000004 27.72 23.36 95-99 20.445 28.249999999999996 27.765 23.54 100-104 20.87 28.625 27.275 23.23 105-109 20.055 28.13 27.47 24.345 110-114 20.39 28.08 27.49 24.04 115-119 20.53 28.110000000000003 27.950000000000003 23.41 120-124 20.905 27.450000000000003 27.905 23.74 125-129 20.055 28.255000000000003 27.615000000000002 24.075 130-134 20.61 27.750000000000004 27.834999999999997 23.805 135-139 20.915 27.435 27.685 23.965 140-144 21.21 27.894999999999996 27.310000000000002 23.585 145-149 21.044999999999998 27.305 27.839999999999996 23.810000000000002 150-151 21.1125 28.175 27.187499999999996 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 0.5 22 1.5 23 2.0 24 3.0 25 3.5 26 4.0 27 8.0 28 10.0 29 10.0 30 17.0 31 26.0 32 34.5 33 39.5 34 51.0 35 72.0 36 84.0 37 101.0 38 115.0 39 134.0 40 182.0 41 216.0 42 218.0 43 229.0 44 255.5 45 262.5 46 245.0 47 235.0 48 235.0 49 231.5 50 195.0 51 150.5 52 130.0 53 115.0 54 88.5 55 67.5 56 61.0 57 44.5 58 34.0 59 26.5 60 16.5 61 11.5 62 8.0 63 6.0 64 3.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.60763606823721 85.5 2 6.607094503114 12.2 3 0.676956404007582 1.875 4 0.08123476848090982 0.3 5 0.027078256160303276 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGCCAGATGCAGAAAACACCATGAGAGCAATCTCAGCATCACATAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.8500000000000001 0.0 0.0 0.0 0.0 114-115 0.9874999999999999 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670967 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670967_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.156 37.0 37.0 37.0 37.0 37.0 2 36.384 37.0 37.0 37.0 37.0 37.0 3 36.2665 37.0 37.0 37.0 37.0 37.0 4 36.3535 37.0 37.0 37.0 37.0 37.0 5 36.3995 37.0 37.0 37.0 37.0 37.0 6 36.445 37.0 37.0 37.0 37.0 37.0 7 36.3795 37.0 37.0 37.0 37.0 37.0 8 36.3625 37.0 37.0 37.0 37.0 37.0 9 36.4325 37.0 37.0 37.0 37.0 37.0 10-14 36.45989999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4365 37.0 37.0 37.0 37.0 37.0 20-24 36.4349 37.0 37.0 37.0 37.0 37.0 25-29 36.3534 37.0 37.0 37.0 37.0 37.0 30-34 36.393899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3135 37.0 37.0 37.0 37.0 37.0 40-44 36.298500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3236 37.0 37.0 37.0 37.0 37.0 50-54 36.2915 37.0 37.0 37.0 37.0 37.0 55-59 36.26129999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2303 37.0 37.0 37.0 37.0 37.0 65-69 36.267700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.232000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.17059999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1641 37.0 37.0 37.0 37.0 37.0 85-89 36.159000000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1045 37.0 37.0 37.0 37.0 37.0 95-99 36.1759 37.0 37.0 37.0 37.0 37.0 100-104 36.0849 37.0 37.0 37.0 37.0 37.0 105-109 36.0173 37.0 37.0 37.0 37.0 37.0 110-114 36.0728 37.0 37.0 37.0 37.0 37.0 115-119 36.0153 37.0 37.0 37.0 37.0 37.0 120-124 35.904399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.894 37.0 37.0 37.0 37.0 37.0 130-134 35.8351 37.0 37.0 37.0 37.0 37.0 135-139 35.8409 37.0 37.0 37.0 37.0 37.0 140-144 35.7925 37.0 37.0 37.0 37.0 37.0 145-149 35.638400000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.36525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 0.0 16 1.0 17 1.0 18 2.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 5.0 25 6.0 26 9.0 27 7.0 28 15.0 29 12.0 30 26.0 31 29.0 32 55.0 33 94.0 34 135.0 35 359.0 36 2672.0 37 563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.5 22.975 11.425 27.1 2 26.5 25.75 31.674999999999997 16.075 3 21.5 27.675 30.925000000000004 19.900000000000002 4 24.349999999999998 32.775 22.975 19.900000000000002 5 25.2 37.25 22.1 15.45 6 19.275000000000002 40.45 22.425 17.849999999999998 7 21.224999999999998 21.95 38.25 18.575 8 20.674999999999997 25.474999999999998 29.375 24.474999999999998 9 21.3 24.025 30.2 24.474999999999998 10-14 22.63 28.82 26.974999999999998 21.575 15-19 22.88 27.985 27.339999999999996 21.795 20-24 22.685 29.085 27.275 20.955 25-29 23.115 27.875 28.015 20.995 30-34 22.16 27.665 28.235 21.94 35-39 22.415 27.889999999999997 28.02 21.675 40-44 22.93 27.955000000000002 27.800000000000004 21.315 45-49 22.5 28.125 27.644999999999996 21.73 50-54 22.715 27.575 27.825 21.884999999999998 55-59 22.689999999999998 27.155 28.485 21.67 60-64 22.34 27.345000000000002 28.07 22.245 65-69 23.035 27.845 27.21 21.91 70-74 23.415 28.015 27.3 21.27 75-79 22.79 27.644999999999996 27.755000000000003 21.81 80-84 23.705000000000002 27.644999999999996 26.85 21.8 85-89 23.425 27.615000000000002 27.36 21.6 90-94 23.97 27.384999999999998 27.145000000000003 21.5 95-99 23.385 27.725 27.685 21.205 100-104 23.575 28.415000000000003 26.779999999999998 21.23 105-109 23.415 27.77 27.505000000000003 21.310000000000002 110-114 23.125 28.365000000000002 27.465 21.044999999999998 115-119 23.494999999999997 28.349999999999998 27.105 21.05 120-124 23.585 28.1 27.095000000000002 21.22 125-129 24.055 27.93 26.810000000000002 21.205 130-134 23.965 28.144999999999996 27.439999999999998 20.45 135-139 24.43 27.76 26.915 20.895 140-144 24.740000000000002 28.299999999999997 26.75 20.21 145-149 25.174999999999997 27.395000000000003 26.810000000000002 20.62 150-151 24.2875 28.1625 27.1 20.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 2.0 20 2.0 21 1.0 22 2.0 23 2.0 24 3.5 25 4.5 26 5.5 27 7.0 28 7.5 29 9.0 30 12.5 31 23.0 32 26.0 33 29.5 34 51.0 35 65.0 36 78.5 37 104.0 38 119.5 39 155.0 40 187.5 41 206.0 42 248.0 43 269.0 44 258.5 45 250.0 46 259.0 47 260.0 48 226.0 49 205.5 50 183.0 51 158.0 52 135.5 53 97.5 54 74.5 55 58.5 56 51.5 57 44.5 58 26.0 59 19.0 60 21.0 61 14.5 62 11.5 63 7.5 64 2.0 65 1.5 66 2.5 67 1.5 68 1.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.50610915014933 85.175 2 6.706489275047516 12.35 3 0.65164268259571 1.7999999999999998 4 0.0 0.0 5 0.10860711376595167 0.5 6 0.0 0.0 7 0.027151778441487917 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit GAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACA 5 0.125 No Hit AAAGATCCCTTCTTGATTTCTTGCAATTAAGATCCACTGCTGTACATTAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.2625 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.65 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459278 spots for SRR12670967.sra Written 459278 spots for SRR12670967.sra Read 459282 spots for SRR12670967.sra Written 459282 spots for SRR12670967.sra SRR ids: ['SRR12670967.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8p3ihg0 SRR12670967.sra spots: 9185564 blocks: [[1, 459278], [459279, 918556], [918557, 1377834], [1377835, 1837112], [1837113, 2296390], [2296391, 2755668], [2755669, 3214946], [3214947, 3674224], [3674225, 4133502], [4133503, 4592780], [4592781, 5052058], [5052059, 5511336], [5511337, 5970614], [5970615, 6429892], [6429893, 6889170], [6889171, 7348448], [7348449, 7807726], [7807727, 8267004], [8267005, 8726282], [8726283, 9185564]] SRR12670967 file size 3101546 SRR12670967 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670967 SRR12670967_1.fastq SRR12670967_2.fastq Input file: SRR12670967_1.fastq Paired file: SRR12670967_2.fastq trimmed: SRR12670967-trimmed-pair1.fastq, SRR12670967-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:15:19 2025 >> started Tue Feb 11 10:15:30 2025 >> done (10.282s) 9185564 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1345 ( 0.01%) empty read pairs filtered out after trimming by size control 9184198 (99.99%) read pairs available; of these: 431465 ( 4.70%) trimmed read pairs available after processing 8752733 (95.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 5 0.00% 29 7 0.00% 30 5 0.00% 31 3 0.00% 32 6 0.00% 33 10 0.00% 34 0 0.00% 35 4 0.00% 36 3 0.00% 37 2 0.00% 38 7 0.00% 39 6 0.00% 40 5 0.00% 41 9 0.00% 42 7 0.00% 43 13 0.00% 44 5 0.00% 45 8 0.00% 46 11 0.00% 47 11 0.00% 48 13 0.00% 49 13 0.00% 50 17 0.00% 51 20 0.00% 52 22 0.00% 53 21 0.00% 54 32 0.00% 55 28 0.00% 56 28 0.00% 57 29 0.00% 58 45 0.00% 59 45 0.00% 60 33 0.00% 61 66 0.00% 62 71 0.00% 63 76 0.00% 64 72 0.00% 65 96 0.00% 66 76 0.00% 67 99 0.00% 68 132 0.00% 69 148 0.00% 70 154 0.00% 71 176 0.00% 72 222 0.00% 73 253 0.00% 74 257 0.00% 75 279 0.00% 76 329 0.00% 77 358 0.00% 78 391 0.00% 79 468 0.01% 80 534 0.01% 81 587 0.01% 82 581 0.01% 83 724 0.01% 84 790 0.01% 85 851 0.01% 86 982 0.01% 87 1066 0.01% 88 1201 0.01% 89 1194 0.01% 90 1311 0.01% 91 1371 0.01% 92 1484 0.02% 93 1676 0.02% 94 1820 0.02% 95 1957 0.02% 96 2033 0.02% 97 2182 0.02% 98 2215 0.02% 99 2362 0.03% 100 2547 0.03% 101 2613 0.03% 102 2771 0.03% 103 3016 0.03% 104 3135 0.03% 105 3281 0.04% 106 3426 0.04% 107 3616 0.04% 108 3770 0.04% 109 3910 0.04% 110 4070 0.04% 111 4186 0.05% 112 4493 0.05% 113 4523 0.05% 114 4626 0.05% 115 5068 0.06% 116 5413 0.06% 117 5557 0.06% 118 5721 0.06% 119 5873 0.06% 120 6186 0.07% 121 6279 0.07% 122 6442 0.07% 123 6930 0.08% 124 7164 0.08% 125 7498 0.08% 126 7490 0.08% 127 7889 0.09% 128 8093 0.09% 129 8355 0.09% 130 8718 0.09% 131 9093 0.10% 132 9152 0.10% 133 9420 0.10% 134 9698 0.11% 135 9893 0.11% 136 10360 0.11% 137 10608 0.12% 138 10877 0.12% 139 11573 0.13% 140 11452 0.12% 141 12074 0.13% 142 12266 0.13% 143 12737 0.14% 144 12944 0.14% 145 13183 0.14% 146 13510 0.15% 147 14126 0.15% 148 14587 0.16% 149 14860 0.16% 150 15255 0.17% 151 8752733 95.30% 9184198 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=9.52 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=2.3 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=35.24 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.3 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670967 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:16:14 Started mapping on | Feb 11 10:16:15 Finished on | Feb 11 10:17:23 Mapping speed, Million of reads per hour | 486.22 Number of input reads | 9184198 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 8579399 Uniquely mapped reads % | 93.41% Average mapped length | 298.60 Number of splices: Total | 8857162 Number of splices: Annotated (sjdb) | 8693778 Number of splices: GT/AG | 8679868 Number of splices: GC/AG | 147233 Number of splices: AT/AC | 4728 Number of splices: Non-canonical | 25333 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212691 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 115233 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 392108 392108 392108 N_multimapping 212691 212691 212691 N_noFeature 319444 8442487 353283 N_ambiguous 160105 523 56785 UnstrandedReadsAssigned:8099850 PositiveStrandReadsAssigned:136389 NegativeStrandReadsAssigned:8169331 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670967 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670967-trimmed-pair1.fastq SRR12670967-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,184,198 reads, 8,194,352 reads pseudoaligned [quant] estimated average fragment length: 290.874 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR12670967.ke.tsv 34699 SRR12670967.se.tsv 87100 total ==> SRR12670967.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.13 460 26.3857 Potri.005G024800.1.v4.1 1035 745.126 118 15.6978 Potri.004G059700.1.v4.1 961 671.311 1 0.14766 Potri.007G009000.2.v4.1 1416 1126.13 0 0 Potri.003G141000.2.v4.1 2943 2653.13 498.566 18.6274 Potri.016G087400.1.v4.1 270 71.171 430 598.897 Potri.015G069301.1.v4.1 564 292.446 0 0 Potri.010G195200.1.v4.1 1773 1483.13 61 4.07698 Potri.012G127500.1.v4.1 977 687.254 42 6.05785 ==> SRR12670967.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12670967 completed mapping pipeline successfully