Starting /dee2/code/volunteer_pipeline.sh SRR12670968 current disk space = 3053315731456 free memory = 1470852876 SRR12670968 SRAfilesize 7fa95782957441131818d003c79722ba SRR12670968.sra SRR12670968.sra file validated SRR12670968 is paired end SRR12670968 is conventional basespace SRR12670968 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43 37.0 37.0 37.0 37.0 37.0 2 36.392 37.0 37.0 37.0 37.0 37.0 3 36.509 37.0 37.0 37.0 37.0 37.0 4 36.681 37.0 37.0 37.0 37.0 37.0 5 36.541 37.0 37.0 37.0 37.0 37.0 6 36.658 37.0 37.0 37.0 37.0 37.0 7 36.552 37.0 37.0 37.0 37.0 37.0 8 36.6205 37.0 37.0 37.0 37.0 37.0 9 36.6295 37.0 37.0 37.0 37.0 37.0 10-14 36.631 37.0 37.0 37.0 37.0 37.0 15-19 36.577000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.538 37.0 37.0 37.0 37.0 37.0 25-29 36.5138 37.0 37.0 37.0 37.0 37.0 30-34 36.4617 37.0 37.0 37.0 37.0 37.0 35-39 36.49230000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4681 37.0 37.0 37.0 37.0 37.0 45-49 36.4168 37.0 37.0 37.0 37.0 37.0 50-54 36.4054 37.0 37.0 37.0 37.0 37.0 55-59 36.3789 37.0 37.0 37.0 37.0 37.0 60-64 36.348800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.345000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3488 37.0 37.0 37.0 37.0 37.0 75-79 36.3233 37.0 37.0 37.0 37.0 37.0 80-84 36.2966 37.0 37.0 37.0 37.0 37.0 85-89 36.2192 37.0 37.0 37.0 37.0 37.0 90-94 36.2513 37.0 37.0 37.0 37.0 37.0 95-99 36.1736 37.0 37.0 37.0 37.0 37.0 100-104 36.2317 37.0 37.0 37.0 37.0 37.0 105-109 36.135299999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1279 37.0 37.0 37.0 37.0 37.0 115-119 36.0734 37.0 37.0 37.0 37.0 37.0 120-124 36.054700000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.004099999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.906800000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8417 37.0 37.0 37.0 37.0 37.0 140-144 35.8395 37.0 37.0 37.0 37.0 37.0 145-149 35.6609 37.0 37.0 37.0 37.0 37.0 150-151 35.531499999999994 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 1.0 27 11.0 28 17.0 29 21.0 30 26.0 31 46.0 32 58.0 33 73.0 34 138.0 35 276.0 36 2685.0 37 641.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.84284284284284 9.75975975975976 4.754754754754755 42.64264264264264 2 17.0 10.65 41.875 30.475 3 16.55 15.0 28.225 40.225 4 21.975 21.775 24.75 31.5 5 24.474999999999998 29.475 25.124999999999996 20.925 6 19.15 33.6 23.95 23.3 7 15.9 26.0 42.4 15.7 8 17.549999999999997 25.55 33.975 22.925 9 16.575 22.625 37.2 23.599999999999998 10-14 19.785 30.135 27.725 22.355 15-19 19.485 28.83 27.97 23.715 20-24 20.075000000000003 27.860000000000003 28.53 23.535 25-29 19.759999999999998 28.205000000000002 28.075 23.96 30-34 19.31 28.84 27.755000000000003 24.095 35-39 20.13 28.050000000000004 28.13 23.69 40-44 20.04 28.915000000000003 27.74 23.305 45-49 19.445 28.29 28.625 23.64 50-54 20.215 27.88 28.03 23.875 55-59 20.085 28.74 27.66 23.515 60-64 19.744999999999997 29.049999999999997 27.57 23.635 65-69 20.064999999999998 28.825 26.875 24.235 70-74 20.46 28.549999999999997 27.85 23.14 75-79 19.545 28.765 27.639999999999997 24.05 80-84 19.89 28.71 27.939999999999998 23.46 85-89 20.03 28.405 27.85 23.715 90-94 19.634999999999998 28.315 28.32 23.73 95-99 19.925 28.37 28.175 23.53 100-104 20.115 29.154999999999998 27.26 23.47 105-109 20.48 29.020000000000003 27.229999999999997 23.27 110-114 19.935 28.73 27.615000000000002 23.72 115-119 19.855 28.89 27.534999999999997 23.72 120-124 20.395 27.93 28.07 23.605 125-129 20.62 28.53 28.075 22.775000000000002 130-134 20.79 28.349999999999998 27.200000000000003 23.66 135-139 20.075000000000003 28.505000000000003 27.305 24.115000000000002 140-144 20.74 28.48 27.58 23.200000000000003 145-149 20.529105821164233 28.235647129425885 27.650530106021204 23.584716943388678 150-151 20.275000000000002 28.712500000000002 27.5625 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.5 19 1.5 20 0.5 21 2.0 22 3.0 23 2.5 24 2.0 25 2.5 26 4.0 27 8.5 28 10.0 29 13.0 30 18.5 31 25.0 32 34.0 33 43.0 34 61.0 35 76.5 36 91.0 37 105.5 38 127.5 39 152.0 40 177.0 41 204.5 42 239.5 43 266.0 44 278.0 45 282.0 46 270.5 47 264.0 48 236.0 49 205.0 50 181.5 51 137.0 52 99.5 53 82.0 54 68.0 55 53.0 56 44.5 57 37.0 58 23.0 59 12.0 60 10.0 61 9.5 62 9.0 63 9.0 64 6.0 65 3.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.06306061429737 84.675 2 7.257406904050014 13.350000000000001 3 0.5708072845882034 1.575 4 0.10872519706441967 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCATT 10 0.006830828 145.0 1 >>END_MODULE SRR12670968 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670968_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1525 37.0 37.0 37.0 37.0 37.0 2 36.219 37.0 37.0 37.0 37.0 37.0 3 36.27 37.0 37.0 37.0 37.0 37.0 4 36.284 37.0 37.0 37.0 37.0 37.0 5 36.389 37.0 37.0 37.0 37.0 37.0 6 36.34 37.0 37.0 37.0 37.0 37.0 7 36.282 37.0 37.0 37.0 37.0 37.0 8 36.3615 37.0 37.0 37.0 37.0 37.0 9 36.422 37.0 37.0 37.0 37.0 37.0 10-14 36.398700000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.390499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3817 37.0 37.0 37.0 37.0 37.0 25-29 36.281800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.254000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.203599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.1793 37.0 37.0 37.0 37.0 37.0 45-49 36.2221 37.0 37.0 37.0 37.0 37.0 50-54 36.184799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1623 37.0 37.0 37.0 37.0 37.0 60-64 36.0646 37.0 37.0 37.0 37.0 37.0 65-69 36.1203 37.0 37.0 37.0 37.0 37.0 70-74 36.0723 37.0 37.0 37.0 37.0 37.0 75-79 36.093599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0646 37.0 37.0 37.0 37.0 37.0 85-89 35.9668 37.0 37.0 37.0 37.0 37.0 90-94 36.0553 37.0 37.0 37.0 37.0 37.0 95-99 36.029900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.97559999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.908699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9426 37.0 37.0 37.0 37.0 37.0 115-119 35.90345 37.0 37.0 37.0 37.0 37.0 120-124 35.8184 37.0 37.0 37.0 37.0 37.0 125-129 35.7622 37.0 37.0 37.0 37.0 37.0 130-134 35.7154 37.0 37.0 37.0 37.0 37.0 135-139 35.694300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.67465000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.488699999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.111999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 3.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 7.0 22 2.0 23 7.0 24 4.0 25 10.0 26 6.0 27 10.0 28 11.0 29 30.0 30 22.0 31 42.0 32 49.0 33 82.0 34 147.0 35 422.0 36 2591.0 37 548.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 25.95 8.975 26.8 2 26.8 26.200000000000003 32.95 14.05 3 18.825 28.449999999999996 32.550000000000004 20.175 4 23.0 34.125 23.425 19.45 5 25.674999999999997 36.775000000000006 21.6 15.950000000000001 6 21.425 39.074999999999996 21.925 17.575 7 20.5 22.55 39.300000000000004 17.65 8 18.7 25.75 31.874999999999996 23.674999999999997 9 20.849999999999998 24.375 31.25 23.525 10-14 22.25 30.12 27.589999999999996 20.04 15-19 23.585 28.68 27.750000000000004 19.985 20-24 23.175 29.415000000000003 26.985 20.424999999999997 25-29 22.8 28.720000000000002 27.615000000000002 20.865000000000002 30-34 22.515 28.965000000000003 27.615000000000002 20.905 35-39 23.525 28.305000000000003 27.505000000000003 20.665 40-44 22.875 28.625 28.115000000000002 20.385 45-49 22.93 28.384999999999998 28.720000000000002 19.965 50-54 22.485 29.005 27.694999999999997 20.815 55-59 22.770000000000003 28.110000000000003 28.505000000000003 20.615 60-64 22.575 28.32 28.23 20.875 65-69 23.055 27.810000000000002 27.96 21.175 70-74 23.47 27.705000000000002 27.644999999999996 21.18 75-79 23.075000000000003 28.015 28.265 20.645 80-84 23.294999999999998 28.38 27.35 20.974999999999998 85-89 23.549999999999997 27.889999999999997 27.884999999999998 20.674999999999997 90-94 23.41 28.46 27.38 20.75 95-99 23.244999999999997 27.785 28.115000000000002 20.855 100-104 23.815 27.505000000000003 28.34 20.34 105-109 23.674999999999997 27.755000000000003 28.08 20.49 110-114 23.68 28.115000000000002 28.18 20.025000000000002 115-119 23.918587788168225 28.359253888083213 27.394109116367453 20.328049207381106 120-124 24.125 27.27 28.1 20.505000000000003 125-129 24.035 28.665000000000003 26.93 20.369999999999997 130-134 24.310000000000002 28.465 27.275 19.950000000000003 135-139 24.585 28.425 27.11 19.88 140-144 24.64369655448317 28.454268140221036 26.999049857478624 19.902985447817173 145-149 24.385 28.349999999999998 27.555000000000003 19.71 150-151 25.2125 27.825 27.0125 19.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 3.5 26 5.0 27 11.0 28 13.0 29 14.0 30 22.5 31 29.0 32 34.5 33 46.5 34 53.0 35 71.5 36 102.0 37 127.0 38 148.5 39 177.0 40 214.0 41 247.5 42 255.0 43 261.5 44 284.0 45 269.0 46 243.0 47 231.5 48 215.0 49 174.0 50 134.5 51 115.5 52 93.5 53 87.0 54 82.5 55 59.5 56 37.0 57 27.0 58 18.5 59 14.0 60 12.5 61 8.0 62 11.0 63 8.5 64 1.5 65 1.0 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.0 98 1.0 99 0.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.01967750751572 84.175 2 7.105766602896966 13.0 3 0.7105766602896966 1.95 4 0.08198961464881116 0.3 5 0.0 0.0 6 0.0 0.0 7 0.027329871549603715 0.17500000000000002 8 0.05465974309920743 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.5875 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTTA 10 0.006830828 145.0 145 >>END_MODULE Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796751 spots for SRR12670968.sra Written 796751 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra Read 796736 spots for SRR12670968.sra Written 796736 spots for SRR12670968.sra SRR ids: ['SRR12670968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6tck5tg SRR12670968.sra spots: 15934735 blocks: [[1, 796736], [796737, 1593472], [1593473, 2390208], [2390209, 3186944], [3186945, 3983680], [3983681, 4780416], [4780417, 5577152], [5577153, 6373888], [6373889, 7170624], [7170625, 7967360], [7967361, 8764096], [8764097, 9560832], [9560833, 10357568], [10357569, 11154304], [11154305, 11951040], [11951041, 12747776], [12747777, 13544512], [13544513, 14341248], [14341249, 15137984], [15137985, 15934735]] SRR12670968 file size 5393619 SRR12670968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670968 SRR12670968_1.fastq SRR12670968_2.fastq Input file: SRR12670968_1.fastq Paired file: SRR12670968_2.fastq trimmed: SRR12670968-trimmed-pair1.fastq, SRR12670968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:24:01 2025 >> started Tue Feb 11 10:24:19 2025 >> done (18.795s) 15934735 read pairs processed; of these: 88 ( 0.00%) short read pairs filtered out after trimming by size control 8076 ( 0.05%) empty read pairs filtered out after trimming by size control 15926571 (99.95%) read pairs available; of these: 1022527 ( 6.42%) trimmed read pairs available after processing 14904044 (93.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 13 0.00% 21 5 0.00% 22 5 0.00% 23 8 0.00% 24 9 0.00% 25 8 0.00% 26 18 0.00% 27 11 0.00% 28 20 0.00% 29 13 0.00% 30 12 0.00% 31 20 0.00% 32 11 0.00% 33 23 0.00% 34 18 0.00% 35 28 0.00% 36 19 0.00% 37 16 0.00% 38 12 0.00% 39 16 0.00% 40 21 0.00% 41 21 0.00% 42 19 0.00% 43 29 0.00% 44 32 0.00% 45 15 0.00% 46 29 0.00% 47 27 0.00% 48 28 0.00% 49 33 0.00% 50 38 0.00% 51 42 0.00% 52 43 0.00% 53 55 0.00% 54 63 0.00% 55 57 0.00% 56 78 0.00% 57 83 0.00% 58 92 0.00% 59 100 0.00% 60 117 0.00% 61 148 0.00% 62 167 0.00% 63 163 0.00% 64 199 0.00% 65 206 0.00% 66 241 0.00% 67 271 0.00% 68 315 0.00% 69 329 0.00% 70 407 0.00% 71 471 0.00% 72 516 0.00% 73 614 0.00% 74 707 0.00% 75 752 0.00% 76 889 0.01% 77 963 0.01% 78 1014 0.01% 79 1049 0.01% 80 1225 0.01% 81 1449 0.01% 82 1537 0.01% 83 1727 0.01% 84 1957 0.01% 85 2056 0.01% 86 2436 0.02% 87 2564 0.02% 88 2761 0.02% 89 2804 0.02% 90 3087 0.02% 91 3491 0.02% 92 3723 0.02% 93 4034 0.03% 94 4248 0.03% 95 4663 0.03% 96 4938 0.03% 97 5225 0.03% 98 5474 0.03% 99 5833 0.04% 100 6085 0.04% 101 6350 0.04% 102 6652 0.04% 103 7386 0.05% 104 7433 0.05% 105 8114 0.05% 106 8359 0.05% 107 8814 0.06% 108 9220 0.06% 109 9580 0.06% 110 9727 0.06% 111 10306 0.06% 112 10726 0.07% 113 11083 0.07% 114 11753 0.07% 115 12235 0.08% 116 12577 0.08% 117 13267 0.08% 118 13887 0.09% 119 14223 0.09% 120 14952 0.09% 121 15217 0.10% 122 16054 0.10% 123 16226 0.10% 124 17065 0.11% 125 17425 0.11% 126 18469 0.12% 127 18859 0.12% 128 19351 0.12% 129 20003 0.13% 130 20973 0.13% 131 21311 0.13% 132 21851 0.14% 133 22463 0.14% 134 23033 0.14% 135 23699 0.15% 136 24201 0.15% 137 24851 0.16% 138 26058 0.16% 139 26850 0.17% 140 27505 0.17% 141 27823 0.17% 142 28756 0.18% 143 28820 0.18% 144 30349 0.19% 145 30462 0.19% 146 31210 0.20% 147 32128 0.20% 148 33430 0.21% 149 33922 0.21% 150 35463 0.22% 151 14904044 93.58% 15926571 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=27.24 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.5 sequence=CTCATCAAATCTT criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=0.84 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=43.41 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12670968 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:25:04 Started mapping on | Feb 11 10:25:04 Finished on | Feb 11 10:27:00 Mapping speed, Million of reads per hour | 494.27 Number of input reads | 15926571 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14869003 Uniquely mapped reads % | 93.36% Average mapped length | 297.68 Number of splices: Total | 14967774 Number of splices: Annotated (sjdb) | 14612265 Number of splices: GT/AG | 14684819 Number of splices: GC/AG | 226208 Number of splices: AT/AC | 9791 Number of splices: Non-canonical | 46956 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377531 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 55935 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.78% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680037 680037 680037 N_multimapping 377531 377531 377531 N_noFeature 636619 14661610 702121 N_ambiguous 242522 1210 100041 UnstrandedReadsAssigned:13989862 PositiveStrandReadsAssigned:206183 NegativeStrandReadsAssigned:14066841 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670968 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670968-trimmed-pair1.fastq SRR12670968-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,926,571 reads, 14,037,907 reads pseudoaligned [quant] estimated average fragment length: 275.447 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR12670968.ke.tsv 34699 SRR12670968.se.tsv 87100 total ==> SRR12670968.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.55 766 27.2248 Potri.005G024800.1.v4.1 1035 760.553 292 23.7917 Potri.004G059700.1.v4.1 961 686.743 5 0.451178 Potri.007G009000.2.v4.1 1416 1141.55 0 0 Potri.003G141000.2.v4.1 2943 2668.55 726.847 16.8787 Potri.016G087400.1.v4.1 270 75.504 856.438 702.907 Potri.015G069301.1.v4.1 564 304.944 0 0 Potri.010G195200.1.v4.1 1773 1498.55 149.95 6.20077 Potri.012G127500.1.v4.1 977 702.652 100 8.81925 ==> SRR12670968.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR12670968 completed mapping pipeline successfully