Starting /dee2/code/volunteer_pipeline.sh SRR12670969 current disk space = 3053547962368 free memory = 1291188260 SRR12670969 SRAfilesize bd34282e4285ae2845ad940c711b736c SRR12670969.sra SRR12670969.sra file validated SRR12670969 is paired end SRR12670969 is conventional basespace SRR12670969 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670969_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4295 37.0 37.0 37.0 37.0 37.0 2 36.453 37.0 37.0 37.0 37.0 37.0 3 36.597 37.0 37.0 37.0 37.0 37.0 4 36.573 37.0 37.0 37.0 37.0 37.0 5 36.6195 37.0 37.0 37.0 37.0 37.0 6 36.572 37.0 37.0 37.0 37.0 37.0 7 36.562 37.0 37.0 37.0 37.0 37.0 8 36.5815 37.0 37.0 37.0 37.0 37.0 9 36.633 37.0 37.0 37.0 37.0 37.0 10-14 36.6132 37.0 37.0 37.0 37.0 37.0 15-19 36.6221 37.0 37.0 37.0 37.0 37.0 20-24 36.5416 37.0 37.0 37.0 37.0 37.0 25-29 36.5284 37.0 37.0 37.0 37.0 37.0 30-34 36.5067 37.0 37.0 37.0 37.0 37.0 35-39 36.509100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.509499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4123 37.0 37.0 37.0 37.0 37.0 50-54 36.4668 37.0 37.0 37.0 37.0 37.0 55-59 36.4117 37.0 37.0 37.0 37.0 37.0 60-64 36.3808 37.0 37.0 37.0 37.0 37.0 65-69 36.4053 37.0 37.0 37.0 37.0 37.0 70-74 36.3788 37.0 37.0 37.0 37.0 37.0 75-79 36.31 37.0 37.0 37.0 37.0 37.0 80-84 36.32149999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2505 37.0 37.0 37.0 37.0 37.0 90-94 36.277 37.0 37.0 37.0 37.0 37.0 95-99 36.2462 37.0 37.0 37.0 37.0 37.0 100-104 36.198699999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1817 37.0 37.0 37.0 37.0 37.0 110-114 36.197399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1414 37.0 37.0 37.0 37.0 37.0 120-124 36.06490000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.0416 37.0 37.0 37.0 37.0 37.0 130-134 35.8789 37.0 37.0 37.0 37.0 37.0 135-139 35.9009 37.0 37.0 37.0 37.0 37.0 140-144 35.886399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.7293 37.0 37.0 37.0 37.0 37.0 150-151 35.557249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 3.0 25 4.0 26 6.0 27 6.0 28 13.0 29 23.0 30 40.0 31 26.0 32 47.0 33 67.0 34 122.0 35 243.0 36 2755.0 37 641.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.57228614307154 11.230615307653826 5.327663831915959 38.86943471735868 2 17.849999999999998 10.7 38.4 33.050000000000004 3 16.35 15.425 27.150000000000002 41.075 4 23.025000000000002 21.325 24.474999999999998 31.175000000000004 5 24.15 28.549999999999997 24.675 22.625 6 20.275000000000002 33.45 24.675 21.6 7 15.875 27.05 39.7 17.375 8 16.400000000000002 27.325 33.0 23.275000000000002 9 17.525 22.675 36.475 23.325000000000003 10-14 19.035 29.520000000000003 29.205 22.24 15-19 19.759999999999998 27.715 28.185 24.34 20-24 19.8 28.285 28.035 23.880000000000003 25-29 19.655 28.315 28.23 23.799999999999997 30-34 19.525000000000002 28.835 27.845 23.794999999999998 35-39 19.845 28.125 27.689999999999998 24.34 40-44 19.66 29.154999999999998 27.450000000000003 23.735 45-49 19.21 28.110000000000003 28.599999999999998 24.08 50-54 20.095 29.085 27.27 23.549999999999997 55-59 19.595000000000002 28.725 28.125 23.555 60-64 20.169999999999998 27.955000000000002 28.055000000000003 23.82 65-69 19.335 29.255 27.575 23.835 70-74 20.64 28.175 27.465 23.72 75-79 20.275000000000002 28.665000000000003 27.755000000000003 23.305 80-84 20.14 28.485 27.705000000000002 23.669999999999998 85-89 19.985 28.915000000000003 27.6 23.5 90-94 20.995 28.525 26.895000000000003 23.585 95-99 20.03 28.705000000000002 27.229999999999997 24.035 100-104 20.09 28.910000000000004 27.41 23.59 105-109 20.665 28.310000000000002 27.125 23.9 110-114 20.49 28.1 27.855 23.555 115-119 21.13 27.884999999999998 27.48 23.505000000000003 120-124 20.385 28.64 26.784999999999997 24.19 125-129 20.435 28.095 27.73 23.74 130-134 20.315 28.535 27.48 23.669999999999998 135-139 20.705000000000002 27.215 28.005000000000003 24.075 140-144 20.805 27.91 27.705000000000002 23.580000000000002 145-149 20.435 27.925 27.965 23.674999999999997 150-151 21.625 28.625 27.3875 22.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.0 25 4.0 26 3.0 27 3.5 28 10.0 29 14.0 30 19.0 31 24.5 32 29.0 33 40.5 34 53.5 35 72.0 36 100.5 37 124.5 38 140.5 39 155.5 40 176.0 41 198.0 42 220.0 43 249.5 44 271.5 45 269.0 46 267.5 47 263.0 48 231.5 49 192.0 50 175.5 51 149.5 52 116.0 53 102.0 54 76.0 55 56.0 56 51.0 57 39.0 58 22.0 59 17.5 60 17.5 61 11.5 62 7.5 63 5.0 64 1.0 65 0.5 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.35 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42612064194799 81.69999999999999 2 8.550083010514665 15.45 3 0.9407858328721639 2.55 4 0.08301051466519092 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTATT 10 0.006830828 145.0 6 >>END_MODULE SRR12670969 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670969_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2205 37.0 37.0 37.0 37.0 37.0 2 36.0925 37.0 37.0 37.0 37.0 37.0 3 36.2075 37.0 37.0 37.0 37.0 37.0 4 36.196 37.0 37.0 37.0 37.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 36.275 37.0 37.0 37.0 37.0 37.0 7 36.325 37.0 37.0 37.0 37.0 37.0 8 36.3795 37.0 37.0 37.0 37.0 37.0 9 36.322 37.0 37.0 37.0 37.0 37.0 10-14 36.347300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.345 37.0 37.0 37.0 37.0 37.0 20-24 36.3686 37.0 37.0 37.0 37.0 37.0 25-29 36.3189 37.0 37.0 37.0 37.0 37.0 30-34 36.3474 37.0 37.0 37.0 37.0 37.0 35-39 36.288199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.209 37.0 37.0 37.0 37.0 37.0 45-49 36.2464 37.0 37.0 37.0 37.0 37.0 50-54 36.224599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.2019 37.0 37.0 37.0 37.0 37.0 60-64 36.20739999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1828 37.0 37.0 37.0 37.0 37.0 70-74 36.1334 37.0 37.0 37.0 37.0 37.0 75-79 36.0833 37.0 37.0 37.0 37.0 37.0 80-84 36.14639999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.0651 37.0 37.0 37.0 37.0 37.0 90-94 36.06259999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.03959999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.043600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.9658 37.0 37.0 37.0 37.0 37.0 110-114 35.92280000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.90560000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.812599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.7278 37.0 37.0 37.0 37.0 37.0 130-134 35.730000000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6776 37.0 37.0 37.0 37.0 37.0 140-144 35.6594 37.0 37.0 37.0 37.0 37.0 145-149 35.4378 37.0 37.0 37.0 37.0 37.0 150-151 35.18175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 1.0 22 1.0 23 4.0 24 5.0 25 5.0 26 13.0 27 12.0 28 14.0 29 23.0 30 29.0 31 50.0 32 47.0 33 98.0 34 171.0 35 408.0 36 2601.0 37 513.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 24.75 8.85 26.025 2 25.624999999999996 25.974999999999998 33.225 15.174999999999999 3 19.5 26.700000000000003 35.125 18.675 4 24.3 33.6 23.200000000000003 18.9 5 26.200000000000003 36.925000000000004 20.75 16.125 6 19.375 40.8 22.125 17.7 7 21.05 23.0 37.4 18.55 8 19.675 26.1 32.025 22.2 9 22.6 23.75 30.95 22.7 10-14 22.345000000000002 30.235 26.700000000000003 20.72 15-19 22.98 28.660000000000004 27.345000000000002 21.015 20-24 23.165 28.515 27.415 20.905 25-29 21.88 28.28 28.595 21.245 30-34 22.62 28.155 28.615000000000002 20.61 35-39 22.125 28.425 28.535 20.915 40-44 22.770000000000003 28.470000000000002 27.92 20.84 45-49 22.465 27.584999999999997 28.515 21.435000000000002 50-54 22.655 28.095 28.21 21.04 55-59 22.495 28.59 28.23 20.685000000000002 60-64 23.355 26.919999999999998 28.499999999999996 21.224999999999998 65-69 23.335 27.644999999999996 27.97 21.05 70-74 23.155 27.800000000000004 27.675 21.37 75-79 23.294999999999998 26.715 28.599999999999998 21.39 80-84 22.515 28.599999999999998 27.61 21.275 85-89 23.369999999999997 27.61 27.93 21.09 90-94 23.43 27.750000000000004 27.665 21.154999999999998 95-99 22.78 27.939999999999998 28.044999999999998 21.235 100-104 23.53 27.57 27.955000000000002 20.945 105-109 23.91 27.810000000000002 27.334999999999997 20.945 110-114 23.22 28.32 28.035 20.424999999999997 115-119 23.669999999999998 28.58 27.650000000000002 20.1 120-124 23.990000000000002 27.884999999999998 28.084999999999997 20.04 125-129 23.895 28.105000000000004 27.68 20.32 130-134 24.3 27.985 27.305 20.41 135-139 24.055 28.044999999999998 27.250000000000004 20.65 140-144 23.985 28.125 27.405 20.485 145-149 24.224999999999998 26.88 28.18 20.715 150-151 24.375 27.325 28.012500000000003 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 1.0 17 0.5 18 1.0 19 1.0 20 2.5 21 3.5 22 3.0 23 2.5 24 3.0 25 5.5 26 6.5 27 10.5 28 11.5 29 11.5 30 20.0 31 27.5 32 32.5 33 44.0 34 59.5 35 69.0 36 89.5 37 104.0 38 122.5 39 154.0 40 197.5 41 242.5 42 256.5 43 260.5 44 262.0 45 256.5 46 261.5 47 247.0 48 230.0 49 217.5 50 168.5 51 126.0 52 96.5 53 81.0 54 72.0 55 62.0 56 56.5 57 38.0 58 22.5 59 17.0 60 9.0 61 6.5 62 5.5 63 3.0 64 2.0 65 1.5 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.40981321438528 81.075 2 8.363534987454697 15.0 3 0.9199888486200167 2.475 4 0.16727069974909395 0.6 5 0.0 0.0 6 0.05575689991636465 0.3 7 0.05575689991636465 0.35000000000000003 8 0.027878449958182325 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 8 0.2 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit AGGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGGA 10 0.006830828 145.0 1 >>END_MODULE Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659868 spots for SRR12670969.sra Written 659868 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra Read 659853 spots for SRR12670969.sra Written 659853 spots for SRR12670969.sra SRR ids: ['SRR12670969.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lhqjfaz9 SRR12670969.sra spots: 13197075 blocks: [[1, 659853], [659854, 1319706], [1319707, 1979559], [1979560, 2639412], [2639413, 3299265], [3299266, 3959118], [3959119, 4618971], [4618972, 5278824], [5278825, 5938677], [5938678, 6598530], [6598531, 7258383], [7258384, 7918236], [7918237, 8578089], [8578090, 9237942], [9237943, 9897795], [9897796, 10557648], [10557649, 11217501], [11217502, 11877354], [11877355, 12537207], [12537208, 13197075]] SRR12670969 file size 4463243 SRR12670969 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670969 SRR12670969_1.fastq SRR12670969_2.fastq Input file: SRR12670969_1.fastq Paired file: SRR12670969_2.fastq trimmed: SRR12670969-trimmed-pair1.fastq, SRR12670969-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:12:29 2025 >> started Tue Feb 11 10:12:50 2025 >> done (21.577s) 13197075 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 1350 ( 0.01%) empty read pairs filtered out after trimming by size control 13195661 (99.99%) read pairs available; of these: 712061 ( 5.40%) trimmed read pairs available after processing 12483600 (94.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 5 0.00% 21 7 0.00% 22 3 0.00% 23 8 0.00% 24 7 0.00% 25 9 0.00% 26 11 0.00% 27 10 0.00% 28 11 0.00% 29 10 0.00% 30 9 0.00% 31 8 0.00% 32 14 0.00% 33 11 0.00% 34 11 0.00% 35 7 0.00% 36 16 0.00% 37 13 0.00% 38 19 0.00% 39 19 0.00% 40 9 0.00% 41 9 0.00% 42 8 0.00% 43 35 0.00% 44 21 0.00% 45 21 0.00% 46 22 0.00% 47 28 0.00% 48 32 0.00% 49 26 0.00% 50 42 0.00% 51 47 0.00% 52 39 0.00% 53 44 0.00% 54 49 0.00% 55 49 0.00% 56 59 0.00% 57 69 0.00% 58 76 0.00% 59 78 0.00% 60 100 0.00% 61 107 0.00% 62 131 0.00% 63 136 0.00% 64 145 0.00% 65 212 0.00% 66 221 0.00% 67 205 0.00% 68 258 0.00% 69 340 0.00% 70 365 0.00% 71 361 0.00% 72 458 0.00% 73 420 0.00% 74 554 0.00% 75 639 0.00% 76 687 0.01% 77 681 0.01% 78 799 0.01% 79 915 0.01% 80 985 0.01% 81 1088 0.01% 82 1308 0.01% 83 1414 0.01% 84 1476 0.01% 85 1622 0.01% 86 1807 0.01% 87 1904 0.01% 88 2089 0.02% 89 2194 0.02% 90 2318 0.02% 91 2521 0.02% 92 2666 0.02% 93 2954 0.02% 94 3065 0.02% 95 3560 0.03% 96 3606 0.03% 97 3957 0.03% 98 3896 0.03% 99 4300 0.03% 100 4457 0.03% 101 4557 0.03% 102 5031 0.04% 103 5001 0.04% 104 5471 0.04% 105 5703 0.04% 106 5922 0.04% 107 6264 0.05% 108 6426 0.05% 109 6639 0.05% 110 6926 0.05% 111 7232 0.05% 112 7481 0.06% 113 7846 0.06% 114 8086 0.06% 115 8442 0.06% 116 8798 0.07% 117 9251 0.07% 118 9688 0.07% 119 9828 0.07% 120 10359 0.08% 121 10756 0.08% 122 10729 0.08% 123 11398 0.09% 124 11711 0.09% 125 12078 0.09% 126 12752 0.10% 127 13022 0.10% 128 13406 0.10% 129 13745 0.10% 130 14258 0.11% 131 14559 0.11% 132 14675 0.11% 133 15277 0.12% 134 15637 0.12% 135 16008 0.12% 136 16674 0.13% 137 16725 0.13% 138 17842 0.14% 139 18591 0.14% 140 18880 0.14% 141 19585 0.15% 142 19775 0.15% 143 20061 0.15% 144 21076 0.16% 145 20837 0.16% 146 21630 0.16% 147 22379 0.17% 148 23057 0.17% 149 23499 0.18% 150 24582 0.19% 151 12483600 94.60% 13195661 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=9.48 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.2 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=1.29 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=1.28 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=80.62 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.6 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12670969 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:13:48 Started mapping on | Feb 11 10:13:49 Finished on | Feb 11 10:15:18 Mapping speed, Million of reads per hour | 533.76 Number of input reads | 13195661 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12492576 Uniquely mapped reads % | 94.67% Average mapped length | 298.13 Number of splices: Total | 12577352 Number of splices: Annotated (sjdb) | 12308165 Number of splices: GT/AG | 12329197 Number of splices: GC/AG | 203362 Number of splices: AT/AC | 7627 Number of splices: Non-canonical | 37166 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289170 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 45200 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413915 413915 413915 N_multimapping 289170 289170 289170 N_noFeature 538091 12283586 600225 N_ambiguous 228048 781 80886 UnstrandedReadsAssigned:11726437 PositiveStrandReadsAssigned:208209 NegativeStrandReadsAssigned:11811465 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670969 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670969-trimmed-pair1.fastq SRR12670969-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,195,661 reads, 11,756,018 reads pseudoaligned [quant] estimated average fragment length: 282.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR12670969.ke.tsv 34699 SRR12670969.se.tsv 87100 total ==> SRR12670969.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.85 371 14.4905 Potri.005G024800.1.v4.1 1035 753.846 248 22.3172 Potri.004G059700.1.v4.1 961 680.093 0 0 Potri.007G009000.2.v4.1 1416 1134.85 0 0 Potri.003G141000.2.v4.1 2943 2661.85 640.069 16.3122 Potri.016G087400.1.v4.1 270 72.3857 501 469.521 Potri.015G069301.1.v4.1 564 299.048 0 0 Potri.010G195200.1.v4.1 1773 1491.85 51 2.31908 Potri.012G127500.1.v4.1 977 695.968 41 3.99636 ==> SRR12670969.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 180 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670969 completed mapping pipeline successfully