Starting /dee2/code/volunteer_pipeline.sh SRR12670970 current disk space = 3053033066496 free memory = 1470566368 SRR12670970 SRAfilesize 8813df3742c979e533878b8d745aa2c5 SRR12670970.sra SRR12670970.sra file validated SRR12670970 is paired end SRR12670970 is conventional basespace SRR12670970 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670970_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43575 37.0 37.0 37.0 37.0 37.0 2 36.3285 37.0 37.0 37.0 37.0 37.0 3 36.459 37.0 37.0 37.0 37.0 37.0 4 36.458 37.0 37.0 37.0 37.0 37.0 5 36.599 37.0 37.0 37.0 37.0 37.0 6 36.6 37.0 37.0 37.0 37.0 37.0 7 36.474 37.0 37.0 37.0 37.0 37.0 8 36.5675 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.5553 37.0 37.0 37.0 37.0 37.0 15-19 36.564 37.0 37.0 37.0 37.0 37.0 20-24 36.5567 37.0 37.0 37.0 37.0 37.0 25-29 36.4966 37.0 37.0 37.0 37.0 37.0 30-34 36.4727 37.0 37.0 37.0 37.0 37.0 35-39 36.4856 37.0 37.0 37.0 37.0 37.0 40-44 36.4362 37.0 37.0 37.0 37.0 37.0 45-49 36.411 37.0 37.0 37.0 37.0 37.0 50-54 36.4239 37.0 37.0 37.0 37.0 37.0 55-59 36.3922 37.0 37.0 37.0 37.0 37.0 60-64 36.399899999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3555 37.0 37.0 37.0 37.0 37.0 70-74 36.3052 37.0 37.0 37.0 37.0 37.0 75-79 36.3447 37.0 37.0 37.0 37.0 37.0 80-84 36.294200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1905 37.0 37.0 37.0 37.0 37.0 90-94 36.256600000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.2018 37.0 37.0 37.0 37.0 37.0 100-104 36.2059 37.0 37.0 37.0 37.0 37.0 105-109 36.1049 37.0 37.0 37.0 37.0 37.0 110-114 36.143100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1086 37.0 37.0 37.0 37.0 37.0 120-124 36.02419999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.01610000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.778 37.0 37.0 37.0 37.0 37.0 135-139 35.8737 37.0 37.0 37.0 37.0 37.0 140-144 35.8064 37.0 37.0 37.0 37.0 37.0 145-149 35.6879 37.0 37.0 37.0 37.0 37.0 150-151 35.466 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 3.0 27 14.0 28 17.0 29 15.0 30 36.0 31 32.0 32 74.0 33 79.0 34 119.0 35 300.0 36 2691.0 37 616.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.708927231807955 10.302575643910977 5.3013253313328335 48.687171792948234 2 16.375 11.924999999999999 38.1 33.6 3 16.45 16.1 26.3 41.15 4 21.9 21.175 25.525 31.4 5 25.25 27.925 25.05 21.775 6 20.325 34.0 23.625 22.05 7 14.649999999999999 26.724999999999998 41.275 17.349999999999998 8 16.6 25.75 32.5 25.15 9 17.349999999999998 23.875 34.55 24.224999999999998 10-14 18.884999999999998 29.995 28.345 22.775000000000002 15-19 20.1 28.23 28.044999999999998 23.625 20-24 19.794999999999998 28.96 27.525 23.72 25-29 19.689999999999998 27.845 28.38 24.085 30-34 20.345 27.855 28.27 23.53 35-39 19.35 28.84 27.634999999999998 24.175 40-44 19.925 28.78 27.93 23.365 45-49 19.455 28.294999999999998 27.825 24.425 50-54 19.615 28.405 27.845 24.135 55-59 20.4 27.750000000000004 28.299999999999997 23.549999999999997 60-64 19.355 28.71 27.98 23.955000000000002 65-69 19.875 28.725 27.639999999999997 23.76 70-74 19.54 27.97 27.83 24.66 75-79 19.400000000000002 28.49 28.155 23.955000000000002 80-84 20.095 28.110000000000003 28.084999999999997 23.71 85-89 20.325 29.325000000000003 27.29 23.06 90-94 20.175 28.28 27.6 23.945 95-99 20.745 27.93 28.07 23.255 100-104 20.560000000000002 28.23 28.139999999999997 23.07 105-109 20.825 28.27 27.405 23.5 110-114 20.285 28.410000000000004 28.165000000000003 23.14 115-119 20.615 28.235 27.955000000000002 23.195 120-124 20.5 27.775 27.589999999999996 24.135 125-129 20.415 27.98 27.465 24.14 130-134 20.32 28.595 27.37 23.715 135-139 20.525 27.99 27.785 23.7 140-144 21.115000000000002 28.09 27.075 23.72 145-149 21.21 28.244999999999997 27.38 23.165 150-151 21.212500000000002 28.9125 26.7125 23.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 1.5 20 0.0 21 2.5 22 3.0 23 1.5 24 3.0 25 3.0 26 4.5 27 7.5 28 6.0 29 11.5 30 22.0 31 29.5 32 37.5 33 47.5 34 58.0 35 72.0 36 88.0 37 100.0 38 122.5 39 150.0 40 186.5 41 220.0 42 245.0 43 265.0 44 255.5 45 237.5 46 241.0 47 229.0 48 236.0 49 236.0 50 185.5 51 142.5 52 121.5 53 107.5 54 81.5 55 63.5 56 49.5 57 31.5 58 25.0 59 23.5 60 15.0 61 8.5 62 5.5 63 3.0 64 3.5 65 3.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.45 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71678512848551 83.875 2 7.2990705303444505 13.350000000000001 3 0.9021323127392018 2.475 4 0.08201202843083652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.225 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGCA 10 0.006830828 145.0 7 AAAAAAA 20 0.00593511 29.0 25-29 >>END_MODULE SRR12670970 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670970_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.2415 37.0 37.0 37.0 37.0 37.0 3 36.377 37.0 37.0 37.0 37.0 37.0 4 36.317 37.0 37.0 37.0 37.0 37.0 5 36.551 37.0 37.0 37.0 37.0 37.0 6 36.4605 37.0 37.0 37.0 37.0 37.0 7 36.318 37.0 37.0 37.0 37.0 37.0 8 36.4695 37.0 37.0 37.0 37.0 37.0 9 36.558 37.0 37.0 37.0 37.0 37.0 10-14 36.4396 37.0 37.0 37.0 37.0 37.0 15-19 36.468599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4567 37.0 37.0 37.0 37.0 37.0 25-29 36.3129 37.0 37.0 37.0 37.0 37.0 30-34 36.349399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.271699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.31510000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.255900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2044 37.0 37.0 37.0 37.0 37.0 55-59 36.2155 37.0 37.0 37.0 37.0 37.0 60-64 36.2204 37.0 37.0 37.0 37.0 37.0 65-69 36.1952 37.0 37.0 37.0 37.0 37.0 70-74 36.14960000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.1797 37.0 37.0 37.0 37.0 37.0 80-84 36.122499999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0932 37.0 37.0 37.0 37.0 37.0 90-94 36.0921 37.0 37.0 37.0 37.0 37.0 95-99 36.031400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0889 37.0 37.0 37.0 37.0 37.0 105-109 35.9709 37.0 37.0 37.0 37.0 37.0 110-114 35.9763 37.0 37.0 37.0 37.0 37.0 115-119 35.942 37.0 37.0 37.0 37.0 37.0 120-124 35.8198 37.0 37.0 37.0 37.0 37.0 125-129 35.815999999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.78670000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7303 37.0 37.0 37.0 37.0 37.0 140-144 35.630700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.3665 37.0 37.0 37.0 37.0 37.0 150-151 35.185 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 2.0 21 4.0 22 1.0 23 3.0 24 6.0 25 7.0 26 10.0 27 8.0 28 23.0 29 14.0 30 26.0 31 36.0 32 56.0 33 91.0 34 150.0 35 373.0 36 2646.0 37 538.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.900000000000006 24.075 11.425 30.599999999999998 2 24.675 25.3 33.75 16.275000000000002 3 19.400000000000002 26.724999999999998 33.4 20.474999999999998 4 22.400000000000002 32.975 25.7 18.925 5 26.174999999999997 36.9 21.525 15.4 6 18.75 39.574999999999996 23.65 18.025 7 19.3 23.200000000000003 38.125 19.375 8 18.95 25.825 30.2 25.025 9 20.1 24.575 31.65 23.674999999999997 10-14 22.58 29.315 26.91 21.195 15-19 21.605 28.525 28.02 21.85 20-24 23.125 28.32 27.905 20.65 25-29 22.58 28.294999999999998 28.1 21.025 30-34 22.189999999999998 28.67 28.125 21.015 35-39 22.555 28.16 28.87 20.415 40-44 22.43 28.83 27.775 20.965 45-49 22.07 27.595 28.65 21.685 50-54 21.85 28.645 28.775000000000002 20.73 55-59 23.3 28.485 27.200000000000003 21.015 60-64 22.86 28.000000000000004 28.12 21.02 65-69 22.39 27.834999999999997 28.610000000000003 21.165 70-74 22.400000000000002 28.43 27.584999999999997 21.584999999999997 75-79 22.17 27.994999999999997 28.4 21.435000000000002 80-84 22.845 28.77 27.650000000000002 20.735 85-89 23.09 27.49 27.800000000000004 21.62 90-94 23.195 27.544999999999998 28.125 21.135 95-99 23.0 27.915 27.944999999999997 21.14 100-104 23.25 28.225 27.755000000000003 20.77 105-109 23.265 28.235 27.139999999999997 21.36 110-114 23.54 28.084999999999997 27.865000000000002 20.51 115-119 23.785 28.754999999999995 27.005000000000003 20.455000000000002 120-124 23.82 28.125 27.544999999999998 20.51 125-129 23.93 27.389999999999997 28.01 20.669999999999998 130-134 24.25 27.82 27.92 20.01 135-139 23.849999999999998 27.589999999999996 28.560000000000002 20.0 140-144 24.165 27.839999999999996 27.725 20.27 145-149 24.635 27.779999999999998 27.725 19.86 150-151 24.85 28.4375 26.7125 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 1.5 23 2.5 24 6.5 25 7.5 26 9.5 27 12.0 28 10.5 29 14.5 30 17.5 31 18.5 32 30.0 33 44.0 34 58.5 35 70.0 36 91.5 37 124.0 38 143.5 39 169.5 40 198.5 41 237.5 42 265.0 43 271.0 44 282.5 45 264.5 46 249.0 47 230.5 48 204.5 49 197.0 50 177.0 51 138.0 52 100.0 53 75.5 54 61.5 55 49.5 56 41.0 57 36.0 58 21.5 59 16.5 60 14.0 61 10.0 62 7.5 63 3.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.56361637812586 83.3 2 7.309700467161308 13.3 3 0.934322616103325 2.55 4 0.16488046166529266 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02748007694421544 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.225 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAAA 25 8.7132835E-4 87.0 1 >>END_MODULE Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642952 spots for SRR12670970.sra Written 642952 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra Read 642937 spots for SRR12670970.sra Written 642937 spots for SRR12670970.sra SRR ids: ['SRR12670970.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_87kyu9kj SRR12670970.sra spots: 12858755 blocks: [[1, 642937], [642938, 1285874], [1285875, 1928811], [1928812, 2571748], [2571749, 3214685], [3214686, 3857622], [3857623, 4500559], [4500560, 5143496], [5143497, 5786433], [5786434, 6429370], [6429371, 7072307], [7072308, 7715244], [7715245, 8358181], [8358182, 9001118], [9001119, 9644055], [9644056, 10286992], [10286993, 10929929], [10929930, 11572866], [11572867, 12215803], [12215804, 12858755]] SRR12670970 file size 4348267 SRR12670970 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670970 SRR12670970_1.fastq SRR12670970_2.fastq Input file: SRR12670970_1.fastq Paired file: SRR12670970_2.fastq trimmed: SRR12670970-trimmed-pair1.fastq, SRR12670970-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:37:11 2025 >> started Tue Feb 11 10:37:26 2025 >> done (14.396s) 12858755 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 948 ( 0.01%) empty read pairs filtered out after trimming by size control 12857761 (99.99%) read pairs available; of these: 1155014 ( 8.98%) trimmed read pairs available after processing 11702747 (91.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 2 0.00% 23 6 0.00% 24 1 0.00% 25 2 0.00% 26 7 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 6 0.00% 31 9 0.00% 32 8 0.00% 33 10 0.00% 34 7 0.00% 35 9 0.00% 36 10 0.00% 37 11 0.00% 38 12 0.00% 39 14 0.00% 40 9 0.00% 41 11 0.00% 42 15 0.00% 43 20 0.00% 44 10 0.00% 45 13 0.00% 46 20 0.00% 47 17 0.00% 48 21 0.00% 49 25 0.00% 50 28 0.00% 51 33 0.00% 52 49 0.00% 53 63 0.00% 54 41 0.00% 55 57 0.00% 56 46 0.00% 57 57 0.00% 58 79 0.00% 59 101 0.00% 60 135 0.00% 61 127 0.00% 62 140 0.00% 63 159 0.00% 64 156 0.00% 65 199 0.00% 66 237 0.00% 67 265 0.00% 68 300 0.00% 69 360 0.00% 70 407 0.00% 71 476 0.00% 72 491 0.00% 73 574 0.00% 74 619 0.00% 75 700 0.01% 76 808 0.01% 77 954 0.01% 78 969 0.01% 79 1163 0.01% 80 1195 0.01% 81 1386 0.01% 82 1637 0.01% 83 1731 0.01% 84 2135 0.02% 85 2296 0.02% 86 2434 0.02% 87 2796 0.02% 88 3024 0.02% 89 3285 0.03% 90 3595 0.03% 91 3896 0.03% 92 4165 0.03% 93 4414 0.03% 94 4758 0.04% 95 5263 0.04% 96 5772 0.04% 97 5983 0.05% 98 6366 0.05% 99 6791 0.05% 100 7096 0.06% 101 7447 0.06% 102 8132 0.06% 103 8460 0.07% 104 8989 0.07% 105 9625 0.07% 106 10193 0.08% 107 10489 0.08% 108 11046 0.09% 109 11477 0.09% 110 11777 0.09% 111 12566 0.10% 112 12950 0.10% 113 13287 0.10% 114 14103 0.11% 115 14613 0.11% 116 15236 0.12% 117 15731 0.12% 118 16814 0.13% 119 17527 0.14% 120 17866 0.14% 121 18505 0.14% 122 18690 0.15% 123 19599 0.15% 124 20131 0.16% 125 20434 0.16% 126 21796 0.17% 127 21693 0.17% 128 22388 0.17% 129 22945 0.18% 130 24088 0.19% 131 24333 0.19% 132 24932 0.19% 133 25415 0.20% 134 25687 0.20% 135 26759 0.21% 136 26981 0.21% 137 27919 0.22% 138 28962 0.23% 139 29832 0.23% 140 30403 0.24% 141 30814 0.24% 142 31721 0.25% 143 32046 0.25% 144 32699 0.25% 145 33071 0.26% 146 33556 0.26% 147 33871 0.26% 148 35477 0.28% 149 35290 0.27% 150 36536 0.28% 151 11702747 91.02% 12857761 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=8.96 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=1.5 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=27 prefix-density=0.59 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.56 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACC SRR12670970 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:38:11 Started mapping on | Feb 11 10:38:11 Finished on | Feb 11 10:39:48 Mapping speed, Million of reads per hour | 477.20 Number of input reads | 12857761 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12202786 Uniquely mapped reads % | 94.91% Average mapped length | 296.59 Number of splices: Total | 12345383 Number of splices: Annotated (sjdb) | 12086329 Number of splices: GT/AG | 12095881 Number of splices: GC/AG | 208356 Number of splices: AT/AC | 7062 Number of splices: Non-canonical | 34084 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280286 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 44439 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 374689 374689 374689 N_multimapping 280286 280286 280286 N_noFeature 495878 12033887 548641 N_ambiguous 200459 598 84097 UnstrandedReadsAssigned:11506449 PositiveStrandReadsAssigned:168301 NegativeStrandReadsAssigned:11570048 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670970 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670970-trimmed-pair1.fastq SRR12670970-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,857,761 reads, 11,547,294 reads pseudoaligned [quant] estimated average fragment length: 266.216 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR12670970.ke.tsv 34699 SRR12670970.se.tsv 87100 total ==> SRR12670970.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.78 477 21.5397 Potri.005G024800.1.v4.1 1035 769.784 221 22.7234 Potri.004G059700.1.v4.1 961 695.983 0 0 Potri.007G009000.2.v4.1 1416 1150.78 0 0 Potri.003G141000.2.v4.1 2943 2677.78 594.507 17.5724 Potri.016G087400.1.v4.1 270 82.1761 515 496.034 Potri.015G069301.1.v4.1 564 314.655 0 0 Potri.010G195200.1.v4.1 1773 1507.78 53 2.78219 Potri.012G127500.1.v4.1 977 711.877 116 12.8974 ==> SRR12670970.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 51 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12670970 completed mapping pipeline successfully