Starting /dee2/code/volunteer_pipeline.sh SRR12670971 current disk space = 3052562841600 free memory = 1487130264 SRR12670971 SRAfilesize 6022fe67f6899a8a1a29cab7b05d8fa6 SRR12670971.sra SRR12670971.sra file validated SRR12670971 is paired end SRR12670971 is conventional basespace SRR12670971 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670971_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44 37.0 37.0 37.0 37.0 37.0 2 36.4125 37.0 37.0 37.0 37.0 37.0 3 36.5385 37.0 37.0 37.0 37.0 37.0 4 36.5605 37.0 37.0 37.0 37.0 37.0 5 36.5315 37.0 37.0 37.0 37.0 37.0 6 36.565 37.0 37.0 37.0 37.0 37.0 7 36.4785 37.0 37.0 37.0 37.0 37.0 8 36.616 37.0 37.0 37.0 37.0 37.0 9 36.553 37.0 37.0 37.0 37.0 37.0 10-14 36.6158 37.0 37.0 37.0 37.0 37.0 15-19 36.5935 37.0 37.0 37.0 37.0 37.0 20-24 36.529399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5046 37.0 37.0 37.0 37.0 37.0 30-34 36.471799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.461499999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4354 37.0 37.0 37.0 37.0 37.0 45-49 36.392799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3928 37.0 37.0 37.0 37.0 37.0 55-59 36.3793 37.0 37.0 37.0 37.0 37.0 60-64 36.3817 37.0 37.0 37.0 37.0 37.0 65-69 36.3722 37.0 37.0 37.0 37.0 37.0 70-74 36.322199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.29 37.0 37.0 37.0 37.0 37.0 80-84 36.2595 37.0 37.0 37.0 37.0 37.0 85-89 36.2342 37.0 37.0 37.0 37.0 37.0 90-94 36.2036 37.0 37.0 37.0 37.0 37.0 95-99 36.1528 37.0 37.0 37.0 37.0 37.0 100-104 36.1533 37.0 37.0 37.0 37.0 37.0 105-109 36.1109 37.0 37.0 37.0 37.0 37.0 110-114 36.101 37.0 37.0 37.0 37.0 37.0 115-119 36.0815 37.0 37.0 37.0 37.0 37.0 120-124 36.0218 37.0 37.0 37.0 37.0 37.0 125-129 35.9656 37.0 37.0 37.0 37.0 37.0 130-134 35.881099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.884499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8173 37.0 37.0 37.0 37.0 37.0 145-149 35.731700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.5095 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 1.0 20 2.0 21 1.0 22 0.0 23 2.0 24 2.0 25 7.0 26 3.0 27 7.0 28 14.0 29 23.0 30 34.0 31 39.0 32 52.0 33 88.0 34 103.0 35 261.0 36 2721.0 37 638.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.45 12.425 6.7250000000000005 36.4 2 18.875 10.475 39.925 30.725 3 17.1 13.750000000000002 28.549999999999997 40.6 4 21.075 23.375 25.75 29.799999999999997 5 23.9 29.049999999999997 25.275 21.775 6 21.425 32.475 24.325 21.775 7 15.55 27.875 40.75 15.825 8 17.825 26.5 32.7 22.975 9 16.55 22.95 36.725 23.775 10-14 19.725 30.04 28.439999999999998 21.795 15-19 19.57 28.199999999999996 27.97 24.26 20-24 20.04 28.205000000000002 28.15 23.605 25-29 20.45 28.555000000000003 27.735 23.26 30-34 20.200000000000003 28.23 28.155 23.415 35-39 19.85 28.199999999999996 28.155 23.794999999999998 40-44 20.200000000000003 28.49 27.775 23.535 45-49 20.05 29.15 26.855 23.945 50-54 19.895 28.494999999999997 28.185 23.425 55-59 19.759999999999998 28.88 27.97 23.39 60-64 19.79 28.749999999999996 27.77 23.69 65-69 20.03 28.84 27.51 23.62 70-74 19.64 28.854999999999997 27.72 23.785 75-79 19.945 29.125 27.54 23.39 80-84 19.71 29.03 27.400000000000002 23.86 85-89 20.075000000000003 28.299999999999997 27.71 23.915 90-94 20.095 28.560000000000002 27.455000000000002 23.89 95-99 20.325 27.82 28.205000000000002 23.65 100-104 20.075000000000003 28.675 27.57 23.68 105-109 20.325 28.505000000000003 28.12 23.05 110-114 20.415 27.955000000000002 28.199999999999996 23.43 115-119 19.74 28.505000000000003 27.955000000000002 23.799999999999997 120-124 20.13 28.43 27.67 23.77 125-129 20.185 28.335 27.555000000000003 23.925 130-134 20.685000000000002 28.13 27.584999999999997 23.599999999999998 135-139 20.53 28.57 27.584999999999997 23.315 140-144 20.495 28.055000000000003 27.839999999999996 23.61 145-149 20.990000000000002 28.410000000000004 27.560000000000002 23.04 150-151 20.837500000000002 28.0875 27.925 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.5 22 1.5 23 1.5 24 2.5 25 3.0 26 5.0 27 7.0 28 10.5 29 15.0 30 21.0 31 33.0 32 42.0 33 47.0 34 50.5 35 65.5 36 80.0 37 92.0 38 131.5 39 161.5 40 181.5 41 221.0 42 260.5 43 262.0 44 259.5 45 262.5 46 254.5 47 247.0 48 237.5 49 219.0 50 169.5 51 132.5 52 114.5 53 97.5 54 85.0 55 61.5 56 42.5 57 33.5 58 24.5 59 17.0 60 10.5 61 7.0 62 5.0 63 4.0 64 2.0 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.63031624863686 84.025 2 7.715376226826609 14.149999999999999 3 0.6270447110141767 1.725 4 0.02726281352235551 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.3875 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4 0.0 0.0 0.0 0.0 136-137 2.7249999999999996 0.0 0.0 0.0 0.0 138-139 3.0250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGAT 10 0.006830828 145.0 6 TAGATAC 10 0.006830828 145.0 8 CAAGTAG 10 0.006830828 145.0 4 AGATACT 10 0.006830828 145.0 9 CTATTCT 10 0.006830828 145.0 3 >>END_MODULE SRR12670971 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670971_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.228 37.0 37.0 37.0 37.0 37.0 2 36.271 37.0 37.0 37.0 37.0 37.0 3 36.345 37.0 37.0 37.0 37.0 37.0 4 36.2785 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.347 37.0 37.0 37.0 37.0 37.0 7 36.322 37.0 37.0 37.0 37.0 37.0 8 36.347 37.0 37.0 37.0 37.0 37.0 9 36.3225 37.0 37.0 37.0 37.0 37.0 10-14 36.326800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.330799999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3454 37.0 37.0 37.0 37.0 37.0 25-29 36.2922 37.0 37.0 37.0 37.0 37.0 30-34 36.236599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.226000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.23389999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1944 37.0 37.0 37.0 37.0 37.0 50-54 36.1868 37.0 37.0 37.0 37.0 37.0 55-59 36.172599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.118399999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.1138 37.0 37.0 37.0 37.0 37.0 70-74 36.143899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0929 37.0 37.0 37.0 37.0 37.0 80-84 36.0776 37.0 37.0 37.0 37.0 37.0 85-89 36.0217 37.0 37.0 37.0 37.0 37.0 90-94 36.0916 37.0 37.0 37.0 37.0 37.0 95-99 35.9797 37.0 37.0 37.0 37.0 37.0 100-104 36.0218 37.0 37.0 37.0 37.0 37.0 105-109 35.9523 37.0 37.0 37.0 37.0 37.0 110-114 35.9437 37.0 37.0 37.0 37.0 37.0 115-119 35.925599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.8332 37.0 37.0 37.0 37.0 37.0 125-129 35.7104 37.0 37.0 37.0 37.0 37.0 130-134 35.770399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.6626 37.0 37.0 37.0 37.0 37.0 140-144 35.634 37.0 37.0 37.0 37.0 37.0 145-149 35.3987 37.0 37.0 37.0 37.0 37.0 150-151 35.23725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 2.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 3.0 24 8.0 25 9.0 26 7.0 27 23.0 28 17.0 29 16.0 30 25.0 31 37.0 32 59.0 33 81.0 34 159.0 35 352.0 36 2672.0 37 518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 25.374999999999996 9.575 26.35 2 25.424999999999997 26.424999999999997 32.65 15.5 3 21.0 27.575 33.425 18.0 4 23.150000000000002 33.125 23.849999999999998 19.875 5 24.775 37.8 21.325 16.1 6 20.75 38.45 23.1 17.7 7 20.349999999999998 21.675 39.15 18.825 8 19.25 25.05 31.65 24.05 9 21.7 24.85 30.85 22.6 10-14 22.925 29.134999999999998 27.395000000000003 20.544999999999998 15-19 22.91 28.494999999999997 27.474999999999998 21.12 20-24 22.745 28.765 27.845 20.645 25-29 23.165 27.779999999999998 28.494999999999997 20.560000000000002 30-34 22.900000000000002 28.28 28.144999999999996 20.674999999999997 35-39 22.365 28.63 27.865000000000002 21.14 40-44 22.395 28.51 28.465 20.630000000000003 45-49 22.46 28.044999999999998 28.225 21.27 50-54 22.595000000000002 28.27 27.97 21.165 55-59 22.96 27.650000000000002 28.1 21.29 60-64 22.68 27.935 27.955000000000002 21.43 65-69 23.31 27.639999999999997 28.060000000000002 20.990000000000002 70-74 23.44 28.155 27.32 21.085 75-79 22.905 28.199999999999996 27.515 21.38 80-84 23.01 28.310000000000002 27.134999999999998 21.545 85-89 23.669999999999998 27.435 27.644999999999996 21.25 90-94 22.775000000000002 28.7 27.169999999999998 21.355 95-99 23.375 28.544999999999998 27.68 20.4 100-104 23.044999999999998 28.075 27.445000000000004 21.435000000000002 105-109 22.965 28.249999999999996 28.26 20.525 110-114 23.54 28.43 27.415 20.615 115-119 23.71 28.65 27.49 20.150000000000002 120-124 23.345 28.185 27.52 20.95 125-129 23.815 28.660000000000004 27.284999999999997 20.24 130-134 23.955000000000002 27.834999999999997 28.025 20.185 135-139 24.055 28.015 27.965 19.965 140-144 23.51 28.21 27.275 21.005 145-149 24.235 27.85 27.79 20.125 150-151 24.2375 27.800000000000004 27.250000000000004 20.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.5 18 2.0 19 2.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 5.0 26 7.0 27 7.5 28 11.0 29 16.0 30 18.0 31 23.0 32 32.5 33 43.0 34 54.0 35 65.0 36 86.5 37 114.5 38 141.0 39 174.0 40 212.0 41 235.0 42 243.0 43 243.0 44 253.5 45 264.5 46 259.0 47 236.0 48 222.0 49 202.5 50 165.0 51 139.0 52 112.5 53 96.5 54 77.5 55 56.0 56 52.5 57 41.0 58 22.0 59 14.5 60 11.5 61 9.0 62 4.5 63 1.5 64 0.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.78941625750137 84.125 2 7.501363884342608 13.750000000000002 3 0.6273867975995636 1.725 4 0.05455537370430987 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027277686852154936 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.375 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra Read 733912 spots for SRR12670971.sra Written 733912 spots for SRR12670971.sra Read 733894 spots for SRR12670971.sra Written 733894 spots for SRR12670971.sra SRR ids: ['SRR12670971.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bxuauhqh SRR12670971.sra spots: 14677898 blocks: [[1, 733894], [733895, 1467788], [1467789, 2201682], [2201683, 2935576], [2935577, 3669470], [3669471, 4403364], [4403365, 5137258], [5137259, 5871152], [5871153, 6605046], [6605047, 7338940], [7338941, 8072834], [8072835, 8806728], [8806729, 9540622], [9540623, 10274516], [10274517, 11008410], [11008411, 11742304], [11742305, 12476198], [12476199, 13210092], [13210093, 13943986], [13943987, 14677898]] SRR12670971 file size 4966491 SRR12670971 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670971 SRR12670971_1.fastq SRR12670971_2.fastq Input file: SRR12670971_1.fastq Paired file: SRR12670971_2.fastq trimmed: SRR12670971-trimmed-pair1.fastq, SRR12670971-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:59:47 2025 >> started Tue Feb 11 11:00:03 2025 >> done (16.272s) 14677898 read pairs processed; of these: 64 ( 0.00%) short read pairs filtered out after trimming by size control 4265 ( 0.03%) empty read pairs filtered out after trimming by size control 14673569 (99.97%) read pairs available; of these: 551124 ( 3.76%) trimmed read pairs available after processing 14122445 (96.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 3 0.00% 24 8 0.00% 25 8 0.00% 26 7 0.00% 27 6 0.00% 28 11 0.00% 29 10 0.00% 30 10 0.00% 31 12 0.00% 32 7 0.00% 33 14 0.00% 34 10 0.00% 35 3 0.00% 36 9 0.00% 37 9 0.00% 38 10 0.00% 39 10 0.00% 40 10 0.00% 41 14 0.00% 42 10 0.00% 43 9 0.00% 44 7 0.00% 45 15 0.00% 46 13 0.00% 47 19 0.00% 48 20 0.00% 49 14 0.00% 50 29 0.00% 51 29 0.00% 52 45 0.00% 53 46 0.00% 54 34 0.00% 55 45 0.00% 56 46 0.00% 57 34 0.00% 58 46 0.00% 59 66 0.00% 60 74 0.00% 61 66 0.00% 62 92 0.00% 63 114 0.00% 64 125 0.00% 65 143 0.00% 66 145 0.00% 67 140 0.00% 68 162 0.00% 69 204 0.00% 70 224 0.00% 71 268 0.00% 72 287 0.00% 73 316 0.00% 74 360 0.00% 75 408 0.00% 76 441 0.00% 77 481 0.00% 78 558 0.00% 79 594 0.00% 80 654 0.00% 81 729 0.00% 82 816 0.01% 83 933 0.01% 84 1027 0.01% 85 1133 0.01% 86 1223 0.01% 87 1311 0.01% 88 1430 0.01% 89 1542 0.01% 90 1676 0.01% 91 1850 0.01% 92 1907 0.01% 93 2055 0.01% 94 2296 0.02% 95 2530 0.02% 96 2621 0.02% 97 2843 0.02% 98 2784 0.02% 99 3085 0.02% 100 3199 0.02% 101 3368 0.02% 102 3617 0.02% 103 3823 0.03% 104 3906 0.03% 105 4117 0.03% 106 4351 0.03% 107 4569 0.03% 108 4863 0.03% 109 5146 0.04% 110 5200 0.04% 111 5380 0.04% 112 5592 0.04% 113 5848 0.04% 114 6192 0.04% 115 6444 0.04% 116 6830 0.05% 117 6886 0.05% 118 7078 0.05% 119 7631 0.05% 120 7838 0.05% 121 8304 0.06% 122 8412 0.06% 123 8593 0.06% 124 8824 0.06% 125 9258 0.06% 126 9820 0.07% 127 10123 0.07% 128 10517 0.07% 129 10758 0.07% 130 11050 0.08% 131 11222 0.08% 132 11572 0.08% 133 12262 0.08% 134 12251 0.08% 135 12499 0.09% 136 13008 0.09% 137 13398 0.09% 138 13783 0.09% 139 14567 0.10% 140 14851 0.10% 141 15486 0.11% 142 15613 0.11% 143 16193 0.11% 144 16602 0.11% 145 17030 0.12% 146 17840 0.12% 147 17782 0.12% 148 18595 0.13% 149 18756 0.13% 150 19906 0.14% 151 14122445 96.24% 14673569 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=75.23 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.7 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=97.75 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12670971 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:00:43 Started mapping on | Feb 11 11:00:43 Finished on | Feb 11 11:02:26 Mapping speed, Million of reads per hour | 512.86 Number of input reads | 14673569 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13815653 Uniquely mapped reads % | 94.15% Average mapped length | 298.90 Number of splices: Total | 14036843 Number of splices: Annotated (sjdb) | 13770797 Number of splices: GT/AG | 13759438 Number of splices: GC/AG | 233171 Number of splices: AT/AC | 8172 Number of splices: Non-canonical | 36062 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343899 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 40171 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.12% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 514017 514017 514017 N_multimapping 343899 343899 343899 N_noFeature 495228 13629686 549137 N_ambiguous 238594 789 106083 UnstrandedReadsAssigned:13081831 PositiveStrandReadsAssigned:185178 NegativeStrandReadsAssigned:13160433 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670971 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670971-trimmed-pair1.fastq SRR12670971-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,673,569 reads, 13,134,594 reads pseudoaligned [quant] estimated average fragment length: 298.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12670971.ke.tsv 34699 SRR12670971.se.tsv 87100 total ==> SRR12670971.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1720.96 433 16.9298 Potri.005G024800.1.v4.1 1035 737.965 244 22.2479 Potri.004G059700.1.v4.1 961 664.236 23 2.32992 Potri.007G009000.2.v4.1 1416 1118.96 0 0 Potri.003G141000.2.v4.1 2943 2645.96 509.131 12.9473 Potri.016G087400.1.v4.1 270 67.2372 556 556.416 Potri.015G069301.1.v4.1 564 285.369 0 0 Potri.010G195200.1.v4.1 1773 1475.96 61.8572 2.82 Potri.012G127500.1.v4.1 977 680.081 95 9.39935 ==> SRR12670971.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 435 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12670971 completed mapping pipeline successfully