Starting /dee2/code/volunteer_pipeline.sh SRR12670972 current disk space = 3051739353088 free memory = 1579788204 SRR12670972 SRAfilesize 8ece45f48405dc29eab26edd8df201b8 SRR12670972.sra SRR12670972.sra file validated SRR12670972 is paired end SRR12670972 is conventional basespace SRR12670972 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670972_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43475 37.0 37.0 37.0 37.0 37.0 2 36.3315 37.0 37.0 37.0 37.0 37.0 3 36.4465 37.0 37.0 37.0 37.0 37.0 4 36.5815 37.0 37.0 37.0 37.0 37.0 5 36.56 37.0 37.0 37.0 37.0 37.0 6 36.5245 37.0 37.0 37.0 37.0 37.0 7 36.566 37.0 37.0 37.0 37.0 37.0 8 36.5325 37.0 37.0 37.0 37.0 37.0 9 36.6065 37.0 37.0 37.0 37.0 37.0 10-14 36.599900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.546400000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5116 37.0 37.0 37.0 37.0 37.0 25-29 36.474799999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4453 37.0 37.0 37.0 37.0 37.0 35-39 36.49059999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.479 37.0 37.0 37.0 37.0 37.0 45-49 36.41709999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.405 37.0 37.0 37.0 37.0 37.0 55-59 36.395 37.0 37.0 37.0 37.0 37.0 60-64 36.330499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.291 37.0 37.0 37.0 37.0 37.0 70-74 36.287400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.243 37.0 37.0 37.0 37.0 37.0 80-84 36.203700000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.218 37.0 37.0 37.0 37.0 37.0 90-94 36.2139 37.0 37.0 37.0 37.0 37.0 95-99 36.160399999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1569 37.0 37.0 37.0 37.0 37.0 105-109 36.1288 37.0 37.0 37.0 37.0 37.0 110-114 36.085499999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.07025 37.0 37.0 37.0 37.0 37.0 120-124 36.0293 37.0 37.0 37.0 37.0 37.0 125-129 36.011700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.842699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8805 37.0 37.0 37.0 37.0 37.0 140-144 35.8525 37.0 37.0 37.0 37.0 37.0 145-149 35.6545 37.0 37.0 37.0 37.0 37.0 150-151 35.42175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 0.0 26 6.0 27 18.0 28 17.0 29 21.0 30 37.0 31 43.0 32 55.0 33 74.0 34 127.0 35 272.0 36 2707.0 37 620.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.81120280070017 12.728182045511376 5.076269067266817 37.38434608652163 2 18.475 11.425 38.324999999999996 31.775 3 17.299999999999997 17.299999999999997 28.375 37.025000000000006 4 22.775000000000002 23.674999999999997 23.9 29.65 5 23.200000000000003 31.874999999999996 24.55 20.375 6 19.425 34.825 23.5 22.25 7 16.425 26.05 40.675 16.85 8 16.650000000000002 26.3 32.625 24.425 9 17.150000000000002 23.075000000000003 35.925000000000004 23.849999999999998 10-14 19.34 30.69 27.834999999999997 22.134999999999998 15-19 19.875 27.99 28.110000000000003 24.025 20-24 19.78 28.37 27.800000000000004 24.05 25-29 19.825 28.439999999999998 27.450000000000003 24.285 30-34 19.8 28.005000000000003 28.144999999999996 24.05 35-39 19.96 28.035 28.235 23.77 40-44 19.535 28.744999999999997 27.694999999999997 24.025 45-49 20.205000000000002 27.944999999999997 27.79 24.060000000000002 50-54 19.525000000000002 28.694999999999997 27.93 23.849999999999998 55-59 19.64 28.32 27.775 24.265 60-64 20.294999999999998 27.58 27.98 24.145 65-69 20.455000000000002 28.055000000000003 27.725 23.765 70-74 19.57 29.005 27.605 23.82 75-79 20.150000000000002 28.044999999999998 27.500000000000004 24.305 80-84 20.155 28.095 28.194999999999997 23.555 85-89 20.59 28.439999999999998 27.125 23.845 90-94 20.355 28.425 27.025 24.195 95-99 20.29 28.225 27.0 24.485 100-104 20.335 27.88 27.810000000000002 23.974999999999998 105-109 20.32 28.165000000000003 27.345000000000002 24.169999999999998 110-114 20.305 27.865000000000002 27.805000000000003 24.025 115-119 20.24601230061503 27.771388569428474 27.736386819340968 24.24621231061553 120-124 20.18 28.115000000000002 27.950000000000003 23.755000000000003 125-129 20.41 28.660000000000004 27.200000000000003 23.73 130-134 20.015 28.34 27.47 24.175 135-139 20.915 28.244999999999997 27.185 23.655 140-144 21.09 28.235 27.265 23.41 145-149 20.689137827565514 28.285657131426284 27.3004600920184 23.724744948989798 150-151 20.875 26.974999999999998 27.35 24.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 1.0 21 1.5 22 3.0 23 3.0 24 3.0 25 5.0 26 6.0 27 9.0 28 10.5 29 11.5 30 15.0 31 22.5 32 27.5 33 40.5 34 52.0 35 65.0 36 83.5 37 105.0 38 138.5 39 159.5 40 174.5 41 202.0 42 233.0 43 244.0 44 255.0 45 261.5 46 252.5 47 247.5 48 252.5 49 216.5 50 186.0 51 159.5 52 116.0 53 105.5 54 82.5 55 62.0 56 51.0 57 37.5 58 25.0 59 20.0 60 17.0 61 13.0 62 8.0 63 3.5 64 2.0 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.29958960328317 83.42500000000001 2 8.071135430916552 14.75 3 0.5471956224350205 1.5 4 0.05471956224350205 0.2 5 0.027359781121751026 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACTGTAAACCATAATCATCTAGTCAATAAAATCTCTTGAAAGTTAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670972 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670972_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2605 37.0 37.0 37.0 37.0 37.0 2 36.1795 37.0 37.0 37.0 37.0 37.0 3 36.338 37.0 37.0 37.0 37.0 37.0 4 36.342 37.0 37.0 37.0 37.0 37.0 5 36.3465 37.0 37.0 37.0 37.0 37.0 6 36.3595 37.0 37.0 37.0 37.0 37.0 7 36.389 37.0 37.0 37.0 37.0 37.0 8 36.488 37.0 37.0 37.0 37.0 37.0 9 36.4145 37.0 37.0 37.0 37.0 37.0 10-14 36.3756 37.0 37.0 37.0 37.0 37.0 15-19 36.3829 37.0 37.0 37.0 37.0 37.0 20-24 36.380700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.326299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.327099999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2798 37.0 37.0 37.0 37.0 37.0 40-44 36.2174 37.0 37.0 37.0 37.0 37.0 45-49 36.245 37.0 37.0 37.0 37.0 37.0 50-54 36.2294 37.0 37.0 37.0 37.0 37.0 55-59 36.1694 37.0 37.0 37.0 37.0 37.0 60-64 36.1927 37.0 37.0 37.0 37.0 37.0 65-69 36.168 37.0 37.0 37.0 37.0 37.0 70-74 36.181 37.0 37.0 37.0 37.0 37.0 75-79 36.1312 37.0 37.0 37.0 37.0 37.0 80-84 36.113099999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.07234999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.041399999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.04639999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.97879999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.94969999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.98909999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.9588 37.0 37.0 37.0 37.0 37.0 120-124 35.8628 37.0 37.0 37.0 37.0 37.0 125-129 35.7423 37.0 37.0 37.0 37.0 37.0 130-134 35.7602 37.0 37.0 37.0 37.0 37.0 135-139 35.7166 37.0 37.0 37.0 37.0 37.0 140-144 35.7062 37.0 37.0 37.0 37.0 37.0 145-149 35.5286 37.0 37.0 37.0 37.0 37.0 150-151 35.29375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 3.0 22 0.0 23 4.0 24 3.0 25 11.0 26 10.0 27 13.0 28 18.0 29 20.0 30 31.0 31 36.0 32 44.0 33 89.0 34 138.0 35 389.0 36 2621.0 37 561.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.575 24.5 8.125 24.8 2 26.450000000000003 25.025 32.425 16.1 3 20.8 24.925 34.525 19.75 4 24.95 34.55 22.15 18.35 5 26.0 36.95 20.95 16.1 6 20.8 39.574999999999996 20.825 18.8 7 20.0 22.85 38.25 18.9 8 20.1 25.224999999999998 29.575000000000003 25.1 9 22.225 24.725 30.8 22.25 10-14 24.09 29.24 26.47 20.200000000000003 15-19 23.330000000000002 27.694999999999997 27.744999999999997 21.23 20-24 22.785 29.744999999999997 27.310000000000002 20.16 25-29 23.46 27.735 27.944999999999997 20.86 30-34 23.615 27.939999999999998 28.000000000000004 20.445 35-39 22.725 28.384999999999998 27.54 21.349999999999998 40-44 23.225 27.93 27.810000000000002 21.035 45-49 23.105 27.985 27.66 21.25 50-54 23.064999999999998 28.825 27.200000000000003 20.91 55-59 23.14 28.139999999999997 27.46 21.26 60-64 23.615 28.01 27.505000000000003 20.87 65-69 23.119999999999997 27.815 28.115000000000002 20.95 70-74 22.95 28.32 27.07 21.66 75-79 23.27 27.98 27.034999999999997 21.715 80-84 23.05 28.615000000000002 27.345000000000002 20.990000000000002 85-89 23.771188559427973 28.136406820341016 27.341367068353417 20.751037551877594 90-94 24.055 28.005000000000003 27.315 20.625 95-99 23.54 28.945 26.99 20.525 100-104 23.580000000000002 28.299999999999997 27.13 20.990000000000002 105-109 23.385 27.534999999999997 28.51 20.57 110-114 23.635 27.12 28.32 20.925 115-119 23.552355235523553 27.382738273827385 28.217821782178216 20.84708470847085 120-124 24.025 28.09 27.634999999999998 20.25 125-129 23.78 28.09 27.825 20.305 130-134 24.529999999999998 27.485 27.965 20.02 135-139 23.895 28.22 27.55 20.335 140-144 24.46744674467447 28.217821782178216 26.962696269626964 20.35203520352035 145-149 24.84 27.735 27.355 20.07 150-151 24.725 27.0125 26.987499999999997 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.5 23 3.0 24 1.5 25 1.0 26 3.0 27 6.0 28 8.0 29 13.0 30 16.5 31 19.0 32 26.5 33 35.0 34 44.5 35 61.5 36 86.0 37 107.0 38 133.5 39 169.0 40 196.5 41 218.5 42 239.5 43 261.0 44 283.5 45 272.0 46 266.0 47 254.0 48 231.0 49 226.0 50 180.0 51 127.5 52 101.5 53 83.5 54 74.0 55 62.0 56 44.5 57 34.5 58 25.5 59 26.0 60 18.0 61 5.0 62 6.5 63 5.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.52030735455543 83.375 2 7.601536772777168 13.850000000000001 3 0.6586169045005488 1.7999999999999998 4 0.10976948408342481 0.4 5 0.054884742041712405 0.25 6 0.027442371020856202 0.15 7 0.027442371020856202 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GTGCTCTAATGATTTTTGATTGAGGGGCAAACAGGTTTATATTGTACTTG 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.6 0.0 0.0 0.0 0.0 138-139 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCTC 10 0.006830828 145.0 1 >>END_MODULE Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681102 spots for SRR12670972.sra Written 681102 spots for SRR12670972.sra Read 681111 spots for SRR12670972.sra Written 681111 spots for SRR12670972.sra SRR ids: ['SRR12670972.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rf41wc3j SRR12670972.sra spots: 13622049 blocks: [[1, 681102], [681103, 1362204], [1362205, 2043306], [2043307, 2724408], [2724409, 3405510], [3405511, 4086612], [4086613, 4767714], [4767715, 5448816], [5448817, 6129918], [6129919, 6811020], [6811021, 7492122], [7492123, 8173224], [8173225, 8854326], [8854327, 9535428], [9535429, 10216530], [10216531, 10897632], [10897633, 11578734], [11578735, 12259836], [12259837, 12940938], [12940939, 13622049]] SRR12670972 file size 4607667 SRR12670972 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670972 SRR12670972_1.fastq SRR12670972_2.fastq Input file: SRR12670972_1.fastq Paired file: SRR12670972_2.fastq trimmed: SRR12670972-trimmed-pair1.fastq, SRR12670972-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:30:37 2025 >> started Tue Feb 11 11:30:51 2025 >> done (14.253s) 13622049 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 1501 ( 0.01%) empty read pairs filtered out after trimming by size control 13620493 (99.99%) read pairs available; of these: 548777 ( 4.03%) trimmed read pairs available after processing 13071716 (95.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 6 0.00% 23 7 0.00% 24 5 0.00% 25 8 0.00% 26 5 0.00% 27 5 0.00% 28 9 0.00% 29 5 0.00% 30 9 0.00% 31 5 0.00% 32 14 0.00% 33 10 0.00% 34 9 0.00% 35 12 0.00% 36 9 0.00% 37 14 0.00% 38 13 0.00% 39 15 0.00% 40 16 0.00% 41 22 0.00% 42 9 0.00% 43 18 0.00% 44 18 0.00% 45 18 0.00% 46 21 0.00% 47 26 0.00% 48 24 0.00% 49 22 0.00% 50 27 0.00% 51 39 0.00% 52 43 0.00% 53 40 0.00% 54 37 0.00% 55 44 0.00% 56 47 0.00% 57 59 0.00% 58 63 0.00% 59 72 0.00% 60 68 0.00% 61 90 0.00% 62 80 0.00% 63 118 0.00% 64 111 0.00% 65 135 0.00% 66 138 0.00% 67 173 0.00% 68 189 0.00% 69 243 0.00% 70 244 0.00% 71 310 0.00% 72 346 0.00% 73 398 0.00% 74 419 0.00% 75 471 0.00% 76 524 0.00% 77 585 0.00% 78 623 0.00% 79 689 0.01% 80 737 0.01% 81 851 0.01% 82 980 0.01% 83 1041 0.01% 84 1126 0.01% 85 1307 0.01% 86 1363 0.01% 87 1403 0.01% 88 1528 0.01% 89 1599 0.01% 90 1784 0.01% 91 1846 0.01% 92 1989 0.01% 93 2151 0.02% 94 2342 0.02% 95 2587 0.02% 96 2737 0.02% 97 2848 0.02% 98 2964 0.02% 99 3092 0.02% 100 3356 0.02% 101 3553 0.03% 102 3666 0.03% 103 3841 0.03% 104 4023 0.03% 105 4245 0.03% 106 4564 0.03% 107 4697 0.03% 108 4743 0.03% 109 4849 0.04% 110 5202 0.04% 111 5289 0.04% 112 5506 0.04% 113 5837 0.04% 114 5996 0.04% 115 6309 0.05% 116 6559 0.05% 117 6899 0.05% 118 7301 0.05% 119 7246 0.05% 120 7698 0.06% 121 7916 0.06% 122 8130 0.06% 123 8552 0.06% 124 8700 0.06% 125 9014 0.07% 126 9612 0.07% 127 9826 0.07% 128 10223 0.08% 129 10575 0.08% 130 10868 0.08% 131 11191 0.08% 132 11563 0.08% 133 11995 0.09% 134 12370 0.09% 135 12634 0.09% 136 13131 0.10% 137 13202 0.10% 138 13646 0.10% 139 14519 0.11% 140 14705 0.11% 141 15021 0.11% 142 15696 0.12% 143 15904 0.12% 144 16430 0.12% 145 17106 0.13% 146 17234 0.13% 147 17722 0.13% 148 18463 0.14% 149 18892 0.14% 150 19489 0.14% 151 13071716 95.97% 13620493 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.20 sequence-density-rank=19 fanout-score=7.63 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=2.1 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=24 prefix-density=0.81 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=29 fanout-score=16.35 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=7.3 sequence=AAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAAC SRR12670972 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:31:34 Started mapping on | Feb 11 11:31:34 Finished on | Feb 11 11:33:01 Mapping speed, Million of reads per hour | 563.61 Number of input reads | 13620493 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 12703966 Uniquely mapped reads % | 93.27% Average mapped length | 298.74 Number of splices: Total | 12787192 Number of splices: Annotated (sjdb) | 12541278 Number of splices: GT/AG | 12525977 Number of splices: GC/AG | 214750 Number of splices: AT/AC | 7804 Number of splices: Non-canonical | 38661 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317678 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 118507 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598849 598849 598849 N_multimapping 317678 317678 317678 N_noFeature 487900 12479712 546284 N_ambiguous 253607 826 87293 UnstrandedReadsAssigned:11962459 PositiveStrandReadsAssigned:223428 NegativeStrandReadsAssigned:12070389 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670972 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670972-trimmed-pair1.fastq SRR12670972-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,620,493 reads, 12,083,534 reads pseudoaligned [quant] estimated average fragment length: 292.943 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR12670972.ke.tsv 34699 SRR12670972.se.tsv 87100 total ==> SRR12670972.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.06 438 17.026 Potri.005G024800.1.v4.1 1035 743.057 210 18.9623 Potri.004G059700.1.v4.1 961 669.262 9 0.902277 Potri.007G009000.2.v4.1 1416 1124.06 0 0 Potri.003G141000.2.v4.1 2943 2651.06 746.531 18.8939 Potri.016G087400.1.v4.1 270 68.0745 614 605.17 Potri.015G069301.1.v4.1 564 289.893 0 0 Potri.010G195200.1.v4.1 1773 1481.06 133 6.02522 Potri.012G127500.1.v4.1 977 685.136 147 14.3957 ==> SRR12670972.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670972 completed mapping pipeline successfully