Starting /dee2/code/volunteer_pipeline.sh SRR12670973 current disk space = 3052997591040 free memory = 1476010492 SRR12670973 SRAfilesize 0fcaa709963bf0d9914cfb48c346bf56 SRR12670973.sra SRR12670973.sra file validated SRR12670973 is paired end SRR12670973 is conventional basespace SRR12670973 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670973_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43175 37.0 37.0 37.0 37.0 37.0 2 36.448 37.0 37.0 37.0 37.0 37.0 3 36.5055 37.0 37.0 37.0 37.0 37.0 4 36.557 37.0 37.0 37.0 37.0 37.0 5 36.5345 37.0 37.0 37.0 37.0 37.0 6 36.587 37.0 37.0 37.0 37.0 37.0 7 36.5285 37.0 37.0 37.0 37.0 37.0 8 36.5785 37.0 37.0 37.0 37.0 37.0 9 36.6035 37.0 37.0 37.0 37.0 37.0 10-14 36.5678 37.0 37.0 37.0 37.0 37.0 15-19 36.5503 37.0 37.0 37.0 37.0 37.0 20-24 36.497 37.0 37.0 37.0 37.0 37.0 25-29 36.5164 37.0 37.0 37.0 37.0 37.0 30-34 36.4568 37.0 37.0 37.0 37.0 37.0 35-39 36.448699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.470299999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.3782 37.0 37.0 37.0 37.0 37.0 50-54 36.4097 37.0 37.0 37.0 37.0 37.0 55-59 36.3729 37.0 37.0 37.0 37.0 37.0 60-64 36.3321 37.0 37.0 37.0 37.0 37.0 65-69 36.33389999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.335899999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2773 37.0 37.0 37.0 37.0 37.0 80-84 36.2351 37.0 37.0 37.0 37.0 37.0 85-89 36.208999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2328 37.0 37.0 37.0 37.0 37.0 95-99 36.214 37.0 37.0 37.0 37.0 37.0 100-104 36.184000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.15840000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.11659999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0712 37.0 37.0 37.0 37.0 37.0 120-124 36.0444 37.0 37.0 37.0 37.0 37.0 125-129 36.037 37.0 37.0 37.0 37.0 37.0 130-134 35.8296 37.0 37.0 37.0 37.0 37.0 135-139 35.892700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8069 37.0 37.0 37.0 37.0 37.0 145-149 35.7658 37.0 37.0 37.0 37.0 37.0 150-151 35.50975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 2.0 25 3.0 26 7.0 27 8.0 28 20.0 29 16.0 30 30.0 31 52.0 32 62.0 33 83.0 34 114.0 35 245.0 36 2717.0 37 637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.285821455363845 12.653163290822706 6.176544136034009 37.88447111777945 2 18.5 12.7 37.025000000000006 31.775 3 16.55 13.900000000000002 27.625 41.925000000000004 4 21.375 22.650000000000002 24.575 31.4 5 25.25 30.55 23.125 21.075 6 20.125 33.4 24.125 22.35 7 15.675 26.3 41.325 16.7 8 15.9 26.75 33.75 23.599999999999998 9 17.474999999999998 23.724999999999998 35.375 23.425 10-14 18.96 30.485 28.144999999999996 22.41 15-19 19.63 28.83 27.495000000000005 24.044999999999998 20-24 19.505 28.615000000000002 28.294999999999998 23.585 25-29 19.485 29.080000000000002 28.115000000000002 23.32 30-34 19.425 29.185 27.57 23.82 35-39 20.275000000000002 28.23 27.634999999999998 23.86 40-44 19.625 29.29 27.560000000000002 23.525 45-49 20.335 28.465 27.694999999999997 23.505000000000003 50-54 20.14 28.310000000000002 28.095 23.455000000000002 55-59 20.515 28.215 27.615000000000002 23.655 60-64 20.424999999999997 28.615000000000002 27.3 23.66 65-69 19.89 28.29 27.584999999999997 24.235 70-74 20.015 28.249999999999996 27.38 24.355 75-79 20.25 28.494999999999997 27.22 24.035 80-84 20.365 28.62 27.169999999999998 23.845 85-89 20.8 28.275 27.295 23.630000000000003 90-94 20.77 28.110000000000003 27.500000000000004 23.62 95-99 20.03 28.095 27.755000000000003 24.12 100-104 20.61 28.194999999999997 27.134999999999998 24.060000000000002 105-109 20.419999999999998 28.355000000000004 27.55 23.674999999999997 110-114 20.36 27.815 27.93 23.895 115-119 20.665 27.894999999999996 27.384999999999998 24.055 120-124 20.525 27.605 28.095 23.775 125-129 21.08 27.73 27.41 23.78 130-134 20.51 28.17 27.555000000000003 23.765 135-139 20.64 28.515 26.5 24.345 140-144 20.915 27.825 27.544999999999998 23.715 145-149 20.73 27.88 27.765 23.625 150-151 20.9375 27.400000000000002 27.3875 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 5.0 26 6.0 27 9.5 28 11.5 29 11.5 30 17.0 31 26.0 32 36.0 33 49.5 34 57.5 35 70.5 36 87.5 37 99.0 38 136.5 39 155.0 40 169.5 41 209.5 42 222.5 43 235.5 44 273.0 45 274.5 46 249.5 47 235.0 48 232.5 49 213.0 50 177.5 51 145.5 52 126.0 53 116.5 54 86.5 55 59.5 56 53.5 57 46.5 58 30.5 59 19.5 60 11.5 61 8.5 62 5.5 63 3.5 64 3.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.18858083996706 83.05 2 7.987922042272852 14.549999999999999 3 0.7136975020587428 1.95 4 0.05489980785067252 0.2 5 0.05489980785067252 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.4124999999999996 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12670973 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670973_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1145 37.0 37.0 37.0 37.0 37.0 2 36.194 37.0 37.0 37.0 37.0 37.0 3 36.3575 37.0 37.0 37.0 37.0 37.0 4 36.3035 37.0 37.0 37.0 37.0 37.0 5 36.279 37.0 37.0 37.0 37.0 37.0 6 36.391 37.0 37.0 37.0 37.0 37.0 7 36.3095 37.0 37.0 37.0 37.0 37.0 8 36.3765 37.0 37.0 37.0 37.0 37.0 9 36.284 37.0 37.0 37.0 37.0 37.0 10-14 36.3231 37.0 37.0 37.0 37.0 37.0 15-19 36.4117 37.0 37.0 37.0 37.0 37.0 20-24 36.382799999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3546 37.0 37.0 37.0 37.0 37.0 30-34 36.2706 37.0 37.0 37.0 37.0 37.0 35-39 36.291000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2478 37.0 37.0 37.0 37.0 37.0 45-49 36.277699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.23870000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.243700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.166 37.0 37.0 37.0 37.0 37.0 65-69 36.2036 37.0 37.0 37.0 37.0 37.0 70-74 36.19359999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.1243 37.0 37.0 37.0 37.0 37.0 80-84 36.122400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.0837 37.0 37.0 37.0 37.0 37.0 90-94 36.108799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1112 37.0 37.0 37.0 37.0 37.0 100-104 36.1202 37.0 37.0 37.0 37.0 37.0 105-109 36.0053 37.0 37.0 37.0 37.0 37.0 110-114 35.977 37.0 37.0 37.0 37.0 37.0 115-119 35.9779 37.0 37.0 37.0 37.0 37.0 120-124 35.909800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8869 37.0 37.0 37.0 37.0 37.0 130-134 35.8717 37.0 37.0 37.0 37.0 37.0 135-139 35.8527 37.0 37.0 37.0 37.0 37.0 140-144 35.77139999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.5637 37.0 37.0 37.0 37.0 37.0 150-151 35.35375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 3.0 22 2.0 23 6.0 24 4.0 25 12.0 26 5.0 27 12.0 28 12.0 29 12.0 30 25.0 31 41.0 32 51.0 33 80.0 34 168.0 35 321.0 36 2697.0 37 542.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.550000000000004 24.474999999999998 10.375 26.6 2 28.025 25.324999999999996 30.55 16.1 3 19.825 27.3 34.125 18.75 4 23.65 32.025 25.474999999999998 18.85 5 25.474999999999998 36.8 20.75 16.975 6 19.675 40.625 21.525 18.175 7 19.950000000000003 23.05 38.25 18.75 8 19.45 27.450000000000003 29.275000000000002 23.825 9 22.025 23.799999999999997 30.375000000000004 23.799999999999997 10-14 23.01 29.275000000000002 26.945000000000004 20.77 15-19 22.7 28.485 27.500000000000004 21.315 20-24 22.075 29.115000000000002 27.650000000000002 21.16 25-29 22.905 28.105000000000004 27.355 21.634999999999998 30-34 22.54 28.360000000000003 27.435 21.665 35-39 21.85 28.64 27.700000000000003 21.81 40-44 22.53 28.835 27.894999999999996 20.74 45-49 22.41 27.935 28.194999999999997 21.46 50-54 23.025000000000002 28.494999999999997 27.455000000000002 21.025 55-59 22.105 28.665000000000003 27.725 21.505 60-64 23.044999999999998 27.92 27.700000000000003 21.335 65-69 23.294999999999998 27.88 27.779999999999998 21.044999999999998 70-74 23.119999999999997 28.24 27.555000000000003 21.085 75-79 23.435 28.075 27.495000000000005 20.995 80-84 23.294999999999998 27.655 27.439999999999998 21.61 85-89 22.994999999999997 27.900000000000002 27.855 21.25 90-94 23.544999999999998 27.91 26.779999999999998 21.765 95-99 23.79 28.025 27.18 21.005 100-104 24.325 27.73 27.33 20.615 105-109 23.87 28.194999999999997 27.389999999999997 20.544999999999998 110-114 23.775 28.425 27.295 20.505000000000003 115-119 23.715 28.13 27.49 20.665 120-124 23.57 27.965 27.584999999999997 20.880000000000003 125-129 23.87 28.165000000000003 27.139999999999997 20.825 130-134 24.474999999999998 27.965 26.805 20.755000000000003 135-139 24.66 27.034999999999997 27.55 20.755000000000003 140-144 24.4 28.03 27.595 19.975 145-149 24.779999999999998 28.46 27.1 19.66 150-151 25.5125 27.825 26.974999999999998 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.5 21 2.5 22 2.5 23 2.5 24 1.0 25 1.0 26 3.0 27 7.0 28 8.0 29 11.0 30 15.5 31 22.5 32 27.5 33 36.0 34 62.5 35 73.0 36 86.0 37 108.0 38 116.0 39 139.5 40 183.5 41 226.5 42 265.5 43 274.5 44 263.5 45 266.5 46 266.0 47 247.5 48 228.5 49 224.0 50 186.5 51 141.0 52 112.0 53 74.0 54 65.5 55 64.0 56 43.5 57 33.0 58 27.5 59 22.0 60 16.0 61 8.5 62 6.5 63 8.0 64 5.0 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27922971114167 82.95 2 7.81292984869326 14.2 3 0.7427785419532325 2.025 4 0.08253094910591473 0.3 5 0.0 0.0 6 0.027510316368638238 0.15 7 0.027510316368638238 0.17500000000000002 8 0.027510316368638238 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592843 spots for SRR12670973.sra Written 592843 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra Read 592842 spots for SRR12670973.sra Written 592842 spots for SRR12670973.sra SRR ids: ['SRR12670973.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dq3ks0ix SRR12670973.sra spots: 11856841 blocks: [[1, 592842], [592843, 1185684], [1185685, 1778526], [1778527, 2371368], [2371369, 2964210], [2964211, 3557052], [3557053, 4149894], [4149895, 4742736], [4742737, 5335578], [5335579, 5928420], [5928421, 6521262], [6521263, 7114104], [7114105, 7706946], [7706947, 8299788], [8299789, 8892630], [8892631, 9485472], [9485473, 10078314], [10078315, 10671156], [10671157, 11263998], [11263999, 11856841]] SRR12670973 file size 4007772 SRR12670973 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670973 SRR12670973_1.fastq SRR12670973_2.fastq Input file: SRR12670973_1.fastq Paired file: SRR12670973_2.fastq trimmed: SRR12670973-trimmed-pair1.fastq, SRR12670973-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:43:49 2025 >> started Tue Feb 11 10:44:08 2025 >> done (19.777s) 11856841 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 3589 ( 0.03%) empty read pairs filtered out after trimming by size control 11853204 (99.97%) read pairs available; of these: 634469 ( 5.35%) trimmed read pairs available after processing 11218735 (94.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 10 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 8 0.00% 31 4 0.00% 32 2 0.00% 33 11 0.00% 34 12 0.00% 35 9 0.00% 36 8 0.00% 37 11 0.00% 38 12 0.00% 39 7 0.00% 40 12 0.00% 41 13 0.00% 42 21 0.00% 43 13 0.00% 44 14 0.00% 45 23 0.00% 46 17 0.00% 47 22 0.00% 48 24 0.00% 49 24 0.00% 50 42 0.00% 51 42 0.00% 52 37 0.00% 53 56 0.00% 54 50 0.00% 55 59 0.00% 56 46 0.00% 57 71 0.00% 58 67 0.00% 59 83 0.00% 60 95 0.00% 61 110 0.00% 62 121 0.00% 63 128 0.00% 64 162 0.00% 65 154 0.00% 66 198 0.00% 67 223 0.00% 68 226 0.00% 69 246 0.00% 70 281 0.00% 71 388 0.00% 72 428 0.00% 73 474 0.00% 74 517 0.00% 75 543 0.00% 76 611 0.01% 77 695 0.01% 78 712 0.01% 79 838 0.01% 80 871 0.01% 81 1004 0.01% 82 1075 0.01% 83 1206 0.01% 84 1379 0.01% 85 1556 0.01% 86 1620 0.01% 87 1810 0.02% 88 1940 0.02% 89 2136 0.02% 90 2144 0.02% 91 2406 0.02% 92 2476 0.02% 93 2678 0.02% 94 2949 0.02% 95 3155 0.03% 96 3330 0.03% 97 3609 0.03% 98 3778 0.03% 99 3919 0.03% 100 4036 0.03% 101 4281 0.04% 102 4488 0.04% 103 4680 0.04% 104 5091 0.04% 105 5235 0.04% 106 5627 0.05% 107 5731 0.05% 108 6006 0.05% 109 6351 0.05% 110 6325 0.05% 111 6585 0.06% 112 6856 0.06% 113 7038 0.06% 114 7269 0.06% 115 7683 0.06% 116 8021 0.07% 117 8259 0.07% 118 8799 0.07% 119 9055 0.08% 120 9359 0.08% 121 9747 0.08% 122 9692 0.08% 123 9987 0.08% 124 10261 0.09% 125 10720 0.09% 126 10834 0.09% 127 11407 0.10% 128 12004 0.10% 129 12455 0.11% 130 12618 0.11% 131 12946 0.11% 132 13224 0.11% 133 13478 0.11% 134 13941 0.12% 135 14194 0.12% 136 14767 0.12% 137 15190 0.13% 138 15534 0.13% 139 16260 0.14% 140 16591 0.14% 141 16993 0.14% 142 17327 0.15% 143 17616 0.15% 144 18431 0.16% 145 18342 0.15% 146 18767 0.16% 147 19177 0.16% 148 20125 0.17% 149 20522 0.17% 150 21481 0.18% 151 11218735 94.65% 11853204 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=10.95 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=2.6 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=31 prefix-density=0.86 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=31.51 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=7.8 sequence=AAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGC SRR12670973 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:44:57 Started mapping on | Feb 11 10:44:57 Finished on | Feb 11 10:47:04 Mapping speed, Million of reads per hour | 336.00 Number of input reads | 11853204 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 11224840 Uniquely mapped reads % | 94.70% Average mapped length | 298.21 Number of splices: Total | 11273626 Number of splices: Annotated (sjdb) | 11057708 Number of splices: GT/AG | 11047867 Number of splices: GC/AG | 188744 Number of splices: AT/AC | 6941 Number of splices: Non-canonical | 30074 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286009 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 56687 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 342355 342355 342355 N_multimapping 286009 286009 286009 N_noFeature 408186 11048959 459750 N_ambiguous 197293 760 72572 UnstrandedReadsAssigned:10619361 PositiveStrandReadsAssigned:175121 NegativeStrandReadsAssigned:10692518 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670973 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670973-trimmed-pair1.fastq SRR12670973-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,853,204 reads, 10,664,983 reads pseudoaligned [quant] estimated average fragment length: 278.96 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR12670973.ke.tsv 34699 SRR12670973.se.tsv 87100 total ==> SRR12670973.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.04 367 16.0756 Potri.005G024800.1.v4.1 1035 757.04 282 28.3916 Potri.004G059700.1.v4.1 961 683.146 7 0.780988 Potri.007G009000.2.v4.1 1416 1138.04 0 0 Potri.003G141000.2.v4.1 2943 2665.04 724 20.7059 Potri.016G087400.1.v4.1 270 71.5075 514 547.863 Potri.015G069301.1.v4.1 564 299.267 0 0 Potri.010G195200.1.v4.1 1773 1495.04 43 2.19218 Potri.012G127500.1.v4.1 977 699.076 109 11.884 ==> SRR12670973.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12670973 completed mapping pipeline successfully