Starting /dee2/code/volunteer_pipeline.sh SRR12670974 current disk space = 3053103583232 free memory = 1305181312 SRR12670974 SRAfilesize ad92b4c2db02b27e730dd1b5defb1928 SRR12670974.sra SRR12670974.sra file validated SRR12670974 is paired end SRR12670974 is conventional basespace SRR12670974 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670974_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3605 37.0 37.0 37.0 37.0 37.0 2 36.321 37.0 37.0 37.0 37.0 37.0 3 36.557 37.0 37.0 37.0 37.0 37.0 4 36.641 37.0 37.0 37.0 37.0 37.0 5 36.612 37.0 37.0 37.0 37.0 37.0 6 36.548 37.0 37.0 37.0 37.0 37.0 7 36.5005 37.0 37.0 37.0 37.0 37.0 8 36.5805 37.0 37.0 37.0 37.0 37.0 9 36.6315 37.0 37.0 37.0 37.0 37.0 10-14 36.63 37.0 37.0 37.0 37.0 37.0 15-19 36.6132 37.0 37.0 37.0 37.0 37.0 20-24 36.5164 37.0 37.0 37.0 37.0 37.0 25-29 36.5386 37.0 37.0 37.0 37.0 37.0 30-34 36.4419 37.0 37.0 37.0 37.0 37.0 35-39 36.485200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4523 37.0 37.0 37.0 37.0 37.0 45-49 36.4031 37.0 37.0 37.0 37.0 37.0 50-54 36.3776 37.0 37.0 37.0 37.0 37.0 55-59 36.3848 37.0 37.0 37.0 37.0 37.0 60-64 36.3285 37.0 37.0 37.0 37.0 37.0 65-69 36.3582 37.0 37.0 37.0 37.0 37.0 70-74 36.3534 37.0 37.0 37.0 37.0 37.0 75-79 36.25170000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.275800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.218999999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.1892 37.0 37.0 37.0 37.0 37.0 95-99 36.1814 37.0 37.0 37.0 37.0 37.0 100-104 36.1568 37.0 37.0 37.0 37.0 37.0 105-109 36.150800000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.160999999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1002 37.0 37.0 37.0 37.0 37.0 120-124 36.07640000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.060500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.882600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.9387 37.0 37.0 37.0 37.0 37.0 140-144 35.880399999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.746 37.0 37.0 37.0 37.0 37.0 150-151 35.5175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 2.0 25 6.0 26 5.0 27 7.0 28 12.0 29 25.0 30 25.0 31 41.0 32 52.0 33 80.0 34 129.0 35 255.0 36 2698.0 37 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.7 11.725 5.8999999999999995 43.675000000000004 2 19.475 11.600000000000001 38.95 29.975 3 17.025000000000002 15.65 27.650000000000002 39.675 4 22.75 21.45 23.200000000000003 32.6 5 23.625 30.275000000000002 23.724999999999998 22.375 6 20.3 32.675 24.7 22.325 7 15.15 27.650000000000002 40.6 16.6 8 15.5 24.55 35.075 24.875 9 17.375 22.85 37.574999999999996 22.2 10-14 19.03 29.845 28.720000000000002 22.405 15-19 20.580000000000002 28.110000000000003 27.884999999999998 23.425 20-24 20.16 28.375 27.985 23.48 25-29 19.77 28.470000000000002 28.155 23.605 30-34 20.25 28.1 28.03 23.62 35-39 19.805 28.125 27.98 24.09 40-44 19.645000000000003 28.29 28.42 23.645 45-49 19.79 28.444999999999997 27.67 24.095 50-54 19.675 28.060000000000002 28.51 23.755000000000003 55-59 20.02 28.735 27.375 23.87 60-64 19.975 28.46 27.875 23.69 65-69 20.150000000000002 27.810000000000002 28.025 24.015 70-74 20.044999999999998 27.900000000000002 28.125 23.93 75-79 19.81 27.97 28.315 23.905 80-84 20.05 28.03 28.325 23.595 85-89 20.515 28.625 27.279999999999998 23.580000000000002 90-94 20.275000000000002 27.985 28.105000000000004 23.635 95-99 19.99 28.134999999999998 28.03 23.845 100-104 20.53 28.58 27.634999999999998 23.255 105-109 20.16 28.084999999999997 28.21 23.544999999999998 110-114 20.125 28.294999999999998 28.005000000000003 23.575 115-119 20.630000000000003 28.299999999999997 27.560000000000002 23.51 120-124 20.474999999999998 28.125 27.47 23.93 125-129 20.115 27.925 27.834999999999997 24.125 130-134 20.46 27.91 27.725 23.905 135-139 20.424999999999997 28.125 27.915 23.535 140-144 20.21 28.325 27.685 23.78 145-149 20.64 27.97 27.68 23.71 150-151 19.9875 28.175 28.125 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.5 17 1.5 18 0.0 19 0.5 20 1.5 21 1.5 22 2.5 23 3.0 24 3.0 25 5.5 26 6.5 27 5.5 28 7.5 29 14.0 30 20.5 31 29.5 32 39.0 33 42.5 34 49.0 35 71.0 36 83.5 37 95.5 38 135.0 39 172.5 40 183.5 41 187.5 42 220.5 43 259.5 44 274.5 45 267.5 46 251.5 47 239.5 48 219.0 49 209.5 50 202.5 51 169.0 52 128.5 53 90.0 54 73.0 55 64.0 56 48.0 57 37.5 58 26.0 59 16.5 60 12.0 61 8.5 62 5.0 63 2.5 64 2.0 65 3.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.08883953359245 81.125 2 8.883953359244865 16.0 3 0.9439200444197668 2.55 4 0.055524708495280406 0.2 5 0.027762354247640203 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTACCACTTGGCGAGCTCCACATCAGCTGGTGAAACAGCAGAAGGCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0125 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.15 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.175 0.0 0.0 0.025 0.0 88-89 0.175 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.21250000000000002 0.0 0.0 0.025 0.0 94-95 0.275 0.0 0.0 0.025 0.0 96-97 0.35 0.0 0.0 0.025 0.0 98-99 0.3625 0.0 0.0 0.025 0.0 100-101 0.375 0.0 0.0 0.025 0.0 102-103 0.3875 0.0 0.0 0.025 0.0 104-105 0.4 0.0 0.0 0.025 0.0 106-107 0.5 0.0 0.0 0.025 0.0 108-109 0.5375000000000001 0.0 0.0 0.025 0.0 110-111 0.5625 0.0 0.0 0.025 0.0 112-113 0.6 0.0 0.0 0.025 0.0 114-115 0.65 0.0 0.0 0.025 0.0 116-117 0.725 0.0 0.0 0.025 0.0 118-119 0.875 0.0 0.0 0.025 0.0 120-121 0.9874999999999999 0.0 0.0 0.025 0.0 122-123 1.125 0.0 0.0 0.025 0.0 124-125 1.225 0.0 0.0 0.025 0.0 126-127 1.2875 0.0 0.0 0.025 0.0 128-129 1.4375 0.0 0.0 0.025 0.0 130-131 1.5625 0.0 0.0 0.025 0.0 132-133 1.65 0.0 0.0 0.025 0.0 134-135 1.7625000000000002 0.0 0.0 0.025 0.0 136-137 1.875 0.0 0.0 0.025 0.0 138-139 2.1125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTTC 10 0.006830828 145.0 5 TTTTTTT 35 0.0035366106 20.714287 110-114 >>END_MODULE SRR12670974 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670974_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2115 37.0 37.0 37.0 37.0 37.0 2 36.0705 37.0 37.0 37.0 37.0 37.0 3 36.143 37.0 37.0 37.0 37.0 37.0 4 36.216 37.0 37.0 37.0 37.0 37.0 5 36.208 37.0 37.0 37.0 37.0 37.0 6 36.2705 37.0 37.0 37.0 37.0 37.0 7 36.118 37.0 37.0 37.0 37.0 37.0 8 36.262 37.0 37.0 37.0 37.0 37.0 9 36.293 37.0 37.0 37.0 37.0 37.0 10-14 36.3365 37.0 37.0 37.0 37.0 37.0 15-19 36.3156 37.0 37.0 37.0 37.0 37.0 20-24 36.2671 37.0 37.0 37.0 37.0 37.0 25-29 36.2265 37.0 37.0 37.0 37.0 37.0 30-34 36.2178 37.0 37.0 37.0 37.0 37.0 35-39 36.170300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1716 37.0 37.0 37.0 37.0 37.0 45-49 36.1066 37.0 37.0 37.0 37.0 37.0 50-54 36.12859999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.083299999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0651 37.0 37.0 37.0 37.0 37.0 65-69 36.0259 37.0 37.0 37.0 37.0 37.0 70-74 35.997099999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9228 37.0 37.0 37.0 37.0 37.0 80-84 36.017700000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.916999999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.888 37.0 37.0 37.0 37.0 37.0 95-99 35.9777 37.0 37.0 37.0 37.0 37.0 100-104 35.9267 37.0 37.0 37.0 37.0 37.0 105-109 35.8137 37.0 37.0 37.0 37.0 37.0 110-114 35.7898 37.0 37.0 37.0 37.0 37.0 115-119 35.7686 37.0 37.0 37.0 37.0 37.0 120-124 35.6618 37.0 37.0 37.0 37.0 37.0 125-129 35.6789 37.0 37.0 37.0 37.0 37.0 130-134 35.6774 37.0 37.0 37.0 37.0 37.0 135-139 35.616 37.0 37.0 37.0 37.0 37.0 140-144 35.583600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.321400000000004 37.0 37.0 37.0 32.2 37.0 150-151 35.08025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 0.0 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 9.0 26 9.0 27 17.0 28 18.0 29 29.0 30 39.0 31 48.0 32 65.0 33 101.0 34 187.0 35 459.0 36 2627.0 37 381.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.725 23.925 10.549999999999999 29.799999999999997 2 25.4 25.900000000000002 33.900000000000006 14.799999999999999 3 18.325 28.299999999999997 33.95 19.425 4 23.125 33.550000000000004 23.599999999999998 19.725 5 26.3 35.199999999999996 22.675 15.825 6 19.400000000000002 38.875 23.125 18.6 7 20.025000000000002 23.125 36.275 20.575 8 19.25 26.375 30.15 24.224999999999998 9 20.849999999999998 25.924999999999997 31.1 22.125 10-14 22.575 30.099999999999998 26.245 21.08 15-19 22.71 28.249999999999996 28.199999999999996 20.84 20-24 22.900000000000002 28.23 27.68 21.19 25-29 22.75 28.499999999999996 27.389999999999997 21.36 30-34 22.62 28.235 28.225 20.919999999999998 35-39 22.395 28.470000000000002 27.63 21.505 40-44 22.900000000000002 28.804999999999996 27.794999999999998 20.5 45-49 22.74 27.994999999999997 28.544999999999998 20.72 50-54 22.665 28.405 28.060000000000002 20.87 55-59 22.919999999999998 28.544999999999998 27.905 20.630000000000003 60-64 23.11 28.21 27.544999999999998 21.135 65-69 22.915 27.169999999999998 28.754999999999995 21.16 70-74 23.355 27.41 28.355000000000004 20.880000000000003 75-79 23.095 27.825 27.33 21.75 80-84 23.1 28.74 26.82 21.34 85-89 23.39 28.535 27.245 20.830000000000002 90-94 23.515 27.755000000000003 27.834999999999997 20.895 95-99 23.724999999999998 27.975 27.950000000000003 20.349999999999998 100-104 23.735 28.494999999999997 27.555000000000003 20.215 105-109 23.544999999999998 27.805000000000003 27.82 20.830000000000002 110-114 23.724999999999998 27.515 28.28 20.48 115-119 23.119999999999997 29.005 26.87 21.005 120-124 24.169999999999998 28.185 27.3 20.345 125-129 23.955000000000002 28.265 27.43 20.349999999999998 130-134 23.275000000000002 28.18 28.255000000000003 20.29 135-139 23.565 28.449999999999996 27.57 20.415 140-144 23.225 28.194999999999997 28.07 20.51 145-149 23.974999999999998 28.22 27.415 20.39 150-151 24.2375 28.0625 27.187499999999996 20.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 3.0 25 3.5 26 6.5 27 9.5 28 11.0 29 13.0 30 15.5 31 25.0 32 37.5 33 43.0 34 51.0 35 66.5 36 77.5 37 110.0 38 143.0 39 177.0 40 213.0 41 230.5 42 253.0 43 256.0 44 273.5 45 291.0 46 275.0 47 239.5 48 197.0 49 183.0 50 157.5 51 133.0 52 122.5 53 91.0 54 67.5 55 52.5 56 39.0 57 28.5 58 22.5 59 22.0 60 16.5 61 9.5 62 7.0 63 4.5 64 1.5 65 1.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.29747011398388 81.2 2 8.507089241034196 15.299999999999999 3 1.028634973589102 2.775 4 0.11120378092855157 0.4 5 0.0 0.0 6 0.027800945232137893 0.15 7 0.027800945232137893 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1749999999999998 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6375 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAACA 10 0.006830828 145.0 5 >>END_MODULE Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433509 spots for SRR12670974.sra Written 433509 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra Read 433498 spots for SRR12670974.sra Written 433498 spots for SRR12670974.sra SRR ids: ['SRR12670974.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_72o4cxoh SRR12670974.sra spots: 8669971 blocks: [[1, 433498], [433499, 866996], [866997, 1300494], [1300495, 1733992], [1733993, 2167490], [2167491, 2600988], [2600989, 3034486], [3034487, 3467984], [3467985, 3901482], [3901483, 4334980], [4334981, 4768478], [4768479, 5201976], [5201977, 5635474], [5635475, 6068972], [6068973, 6502470], [6502471, 6935968], [6935969, 7369466], [7369467, 7802964], [7802965, 8236462], [8236463, 8669971]] SRR12670974 file size 2927332 SRR12670974 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670974 SRR12670974_1.fastq SRR12670974_2.fastq Input file: SRR12670974_1.fastq Paired file: SRR12670974_2.fastq trimmed: SRR12670974-trimmed-pair1.fastq, SRR12670974-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:32:31 2025 >> started Tue Feb 11 10:32:46 2025 >> done (14.726s) 8669971 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 951 ( 0.01%) empty read pairs filtered out after trimming by size control 8668992 (99.99%) read pairs available; of these: 304553 ( 3.51%) trimmed read pairs available after processing 8364439 (96.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 6 0.00% 30 4 0.00% 31 3 0.00% 32 8 0.00% 33 6 0.00% 34 5 0.00% 35 5 0.00% 36 4 0.00% 37 4 0.00% 38 10 0.00% 39 11 0.00% 40 6 0.00% 41 4 0.00% 42 8 0.00% 43 8 0.00% 44 10 0.00% 45 16 0.00% 46 5 0.00% 47 9 0.00% 48 13 0.00% 49 21 0.00% 50 22 0.00% 51 18 0.00% 52 28 0.00% 53 23 0.00% 54 25 0.00% 55 19 0.00% 56 25 0.00% 57 40 0.00% 58 42 0.00% 59 54 0.00% 60 41 0.00% 61 71 0.00% 62 52 0.00% 63 79 0.00% 64 74 0.00% 65 82 0.00% 66 112 0.00% 67 120 0.00% 68 122 0.00% 69 138 0.00% 70 152 0.00% 71 167 0.00% 72 224 0.00% 73 238 0.00% 74 260 0.00% 75 277 0.00% 76 316 0.00% 77 325 0.00% 78 383 0.00% 79 399 0.00% 80 394 0.00% 81 485 0.01% 82 556 0.01% 83 577 0.01% 84 673 0.01% 85 737 0.01% 86 816 0.01% 87 796 0.01% 88 890 0.01% 89 999 0.01% 90 1058 0.01% 91 1161 0.01% 92 1272 0.01% 93 1296 0.01% 94 1372 0.02% 95 1474 0.02% 96 1589 0.02% 97 1643 0.02% 98 1704 0.02% 99 1784 0.02% 100 1852 0.02% 101 1971 0.02% 102 2129 0.02% 103 2333 0.03% 104 2339 0.03% 105 2380 0.03% 106 2556 0.03% 107 2695 0.03% 108 2744 0.03% 109 3045 0.04% 110 2986 0.03% 111 3083 0.04% 112 3237 0.04% 113 3238 0.04% 114 3449 0.04% 115 3412 0.04% 116 3724 0.04% 117 3915 0.05% 118 4137 0.05% 119 4251 0.05% 120 4387 0.05% 121 4478 0.05% 122 4572 0.05% 123 4916 0.06% 124 4813 0.06% 125 5144 0.06% 126 5358 0.06% 127 5485 0.06% 128 5573 0.06% 129 5667 0.07% 130 6002 0.07% 131 6056 0.07% 132 6151 0.07% 133 6524 0.08% 134 6560 0.08% 135 6791 0.08% 136 7046 0.08% 137 7286 0.08% 138 7626 0.09% 139 7959 0.09% 140 8182 0.09% 141 8189 0.09% 142 8498 0.10% 143 8606 0.10% 144 8946 0.10% 145 9084 0.10% 146 9355 0.11% 147 9564 0.11% 148 10108 0.12% 149 10219 0.12% 150 10535 0.12% 151 8364439 96.49% 8668992 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=14.44 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.94 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=52.46 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.7 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12670974 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:33:44 Started mapping on | Feb 11 10:33:44 Finished on | Feb 11 10:34:49 Mapping speed, Million of reads per hour | 480.13 Number of input reads | 8668992 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 7972810 Uniquely mapped reads % | 91.97% Average mapped length | 291.66 Number of splices: Total | 8066565 Number of splices: Annotated (sjdb) | 7911542 Number of splices: GT/AG | 7908328 Number of splices: GC/AG | 131962 Number of splices: AT/AC | 4810 Number of splices: Non-canonical | 21465 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205483 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 49763 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.97% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490699 490699 490699 N_multimapping 205483 205483 205483 N_noFeature 283801 7854626 315285 N_ambiguous 153409 631 66291 UnstrandedReadsAssigned:7535600 PositiveStrandReadsAssigned:117553 NegativeStrandReadsAssigned:7591234 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12670974 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670974-trimmed-pair1.fastq SRR12670974-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,668,992 reads, 7,785,346 reads pseudoaligned [quant] estimated average fragment length: 289.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR12670974.ke.tsv 34699 SRR12670974.se.tsv 87100 total ==> SRR12670974.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.02 394 25.1511 Potri.005G024800.1.v4.1 1035 746.017 182 26.9266 Potri.004G059700.1.v4.1 961 672.165 2 0.328408 Potri.007G009000.2.v4.1 1416 1127.02 0 0 Potri.003G141000.2.v4.1 2943 2654.02 418.449 17.402 Potri.016G087400.1.v4.1 270 69.4107 416 661.495 Potri.015G069301.1.v4.1 564 290.253 0 0 Potri.010G195200.1.v4.1 1773 1484.02 66.9547 4.97969 Potri.012G127500.1.v4.1 977 688.095 59 9.46376 ==> SRR12670974.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12670974 completed mapping pipeline successfully