Starting /dee2/code/volunteer_pipeline.sh SRR12670975 current disk space = 3052857552896 free memory = 1483848448 SRR12670975 SRAfilesize 694e20bdf0e3ff323345133198756335 SRR12670975.sra SRR12670975.sra file validated SRR12670975 is paired end SRR12670975 is conventional basespace SRR12670975 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670975_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3875 37.0 37.0 37.0 37.0 37.0 2 36.215 37.0 37.0 37.0 37.0 37.0 3 36.551 37.0 37.0 37.0 37.0 37.0 4 36.5405 37.0 37.0 37.0 37.0 37.0 5 36.5015 37.0 37.0 37.0 37.0 37.0 6 36.5865 37.0 37.0 37.0 37.0 37.0 7 36.53 37.0 37.0 37.0 37.0 37.0 8 36.55 37.0 37.0 37.0 37.0 37.0 9 36.57 37.0 37.0 37.0 37.0 37.0 10-14 36.5978 37.0 37.0 37.0 37.0 37.0 15-19 36.5153 37.0 37.0 37.0 37.0 37.0 20-24 36.4708 37.0 37.0 37.0 37.0 37.0 25-29 36.3577 37.0 37.0 37.0 37.0 37.0 30-34 36.3006 37.0 37.0 37.0 37.0 37.0 35-39 36.278600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.19 37.0 37.0 37.0 37.0 37.0 45-49 36.1682 37.0 37.0 37.0 37.0 37.0 50-54 36.1238 37.0 37.0 37.0 37.0 37.0 55-59 36.1168 37.0 37.0 37.0 37.0 37.0 60-64 36.0536 37.0 37.0 37.0 37.0 37.0 65-69 36.012800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.017199999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.961299999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.982899999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.929700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9169 37.0 37.0 37.0 37.0 37.0 95-99 35.905 37.0 37.0 37.0 37.0 37.0 100-104 35.9171 37.0 37.0 37.0 37.0 37.0 105-109 35.854 37.0 37.0 37.0 37.0 37.0 110-114 35.8163 37.0 37.0 37.0 37.0 37.0 115-119 35.74720000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7082 37.0 37.0 37.0 37.0 37.0 125-129 35.777 37.0 37.0 37.0 37.0 37.0 130-134 35.5378 37.0 37.0 37.0 37.0 37.0 135-139 35.5529 37.0 37.0 37.0 37.0 37.0 140-144 35.5003 37.0 37.0 37.0 37.0 37.0 145-149 35.3532 37.0 37.0 37.0 37.0 37.0 150-151 35.085499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 2.0 20 2.0 21 2.0 22 8.0 23 11.0 24 13.0 25 11.0 26 16.0 27 13.0 28 23.0 29 20.0 30 42.0 31 47.0 32 71.0 33 83.0 34 135.0 35 277.0 36 2584.0 37 637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 67.95 8.425 5.1 18.525 2 17.025000000000002 8.1 42.65 32.225 3 15.9 16.75 32.65 34.699999999999996 4 20.775 23.625 27.775 27.825 5 21.85 31.574999999999996 27.1 19.475 6 18.675 33.2 26.025 22.1 7 15.775 27.1 41.699999999999996 15.425 8 12.975 25.424999999999997 38.25 23.35 9 17.45 23.075000000000003 36.15 23.325000000000003 10-14 20.235 29.205 29.160000000000004 21.4 15-19 20.13 27.85 28.794999999999998 23.225 20-24 20.61 27.705000000000002 28.64 23.044999999999998 25-29 20.325 28.000000000000004 28.685 22.99 30-34 19.31 29.26 27.98 23.45 35-39 19.18 28.53 27.950000000000003 24.34 40-44 20.025000000000002 29.13 27.644999999999996 23.200000000000003 45-49 20.080000000000002 28.299999999999997 28.52 23.1 50-54 19.98 28.560000000000002 28.044999999999998 23.415 55-59 19.84 29.32 27.339999999999996 23.5 60-64 20.51 28.749999999999996 27.735 23.005 65-69 19.97 28.675 28.34 23.015 70-74 20.32 28.33 28.194999999999997 23.155 75-79 19.63 29.185 27.700000000000003 23.485 80-84 19.74 29.18 27.62 23.46 85-89 20.585 28.64 27.375 23.400000000000002 90-94 20.330000000000002 28.294999999999998 27.79 23.585 95-99 20.59 28.725 27.36 23.325000000000003 100-104 20.36 29.325000000000003 26.87 23.445 105-109 20.465 28.49 27.405 23.64 110-114 20.94 27.74 28.050000000000004 23.27 115-119 20.8 28.64 26.87 23.69 120-124 20.77 28.92 26.86 23.45 125-129 20.82 28.325 27.66 23.195 130-134 20.53 28.205000000000002 27.155 24.11 135-139 21.065 28.525 26.57 23.84 140-144 21.135 28.76 26.565 23.54 145-149 20.815 28.875 26.685 23.625 150-151 20.75 28.525 27.0125 23.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 2.5 3 2.0 4 1.0 5 0.5 6 1.5 7 4.5 8 4.5 9 1.5 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 0.5 16 2.0 17 4.0 18 3.5 19 2.5 20 3.0 21 4.0 22 3.0 23 3.0 24 8.0 25 10.0 26 8.5 27 12.0 28 16.5 29 26.0 30 31.5 31 35.5 32 44.0 33 43.5 34 54.0 35 72.5 36 77.5 37 94.5 38 121.0 39 139.0 40 177.0 41 222.0 42 228.0 43 217.0 44 242.0 45 259.5 46 253.5 47 244.5 48 234.0 49 214.0 50 190.0 51 153.0 52 119.0 53 96.5 54 73.0 55 62.0 56 44.5 57 34.0 58 24.5 59 15.5 60 12.5 61 13.5 62 9.5 63 4.0 64 3.0 65 1.0 66 0.5 67 1.0 68 2.5 69 2.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.57499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.83729183729183 84.1 2 7.398307398307398 13.55 3 0.5733005733005733 1.575 4 0.1365001365001365 0.5 5 0.027300027300027303 0.125 6 0.027300027300027303 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.35 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.324999999999999 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGCAT 10 0.006830828 145.0 1 GCCTTTT 20 3.5877043E-4 108.75 1 GTCCTTT 20 3.5877043E-4 108.75 1 >>END_MODULE SRR12670975 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670975_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.717 37.0 37.0 37.0 37.0 37.0 2 36.0615 37.0 37.0 37.0 37.0 37.0 3 36.147 37.0 37.0 37.0 37.0 37.0 4 36.1485 37.0 37.0 37.0 37.0 37.0 5 36.1815 37.0 37.0 37.0 37.0 37.0 6 36.2455 37.0 37.0 37.0 37.0 37.0 7 36.238 37.0 37.0 37.0 37.0 37.0 8 36.2985 37.0 37.0 37.0 37.0 37.0 9 36.2595 37.0 37.0 37.0 37.0 37.0 10-14 36.182 37.0 37.0 37.0 37.0 37.0 15-19 36.160700000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.173500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1194 37.0 37.0 37.0 37.0 37.0 30-34 36.0406 37.0 37.0 37.0 37.0 37.0 35-39 36.053000000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.99400000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.005700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.9865 37.0 37.0 37.0 37.0 37.0 55-59 35.933 37.0 37.0 37.0 37.0 37.0 60-64 35.9494 37.0 37.0 37.0 37.0 37.0 65-69 35.9457 37.0 37.0 37.0 37.0 37.0 70-74 35.904 37.0 37.0 37.0 37.0 37.0 75-79 35.8238 37.0 37.0 37.0 37.0 37.0 80-84 35.8261 37.0 37.0 37.0 37.0 37.0 85-89 35.8176 37.0 37.0 37.0 37.0 37.0 90-94 35.8166 37.0 37.0 37.0 37.0 37.0 95-99 35.7731 37.0 37.0 37.0 37.0 37.0 100-104 35.738099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.74139999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7302 37.0 37.0 37.0 37.0 37.0 115-119 35.706500000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6134 37.0 37.0 37.0 37.0 37.0 125-129 35.5323 37.0 37.0 37.0 37.0 37.0 130-134 35.5139 37.0 37.0 37.0 37.0 37.0 135-139 35.501 37.0 37.0 37.0 37.0 37.0 140-144 35.429700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2182 37.0 37.0 37.0 32.2 37.0 150-151 34.86725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 6.0 15 8.0 16 7.0 17 7.0 18 1.0 19 3.0 20 3.0 21 9.0 22 10.0 23 10.0 24 7.0 25 9.0 26 6.0 27 18.0 28 12.0 29 17.0 30 28.0 31 45.0 32 58.0 33 69.0 34 138.0 35 348.0 36 2601.0 37 569.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 69.1 15.35 2.9749999999999996 12.575 2 24.025 19.35 36.449999999999996 20.175 3 22.7 23.1 36.775000000000006 17.424999999999997 4 27.6 31.674999999999997 22.6 18.125 5 26.55 37.425000000000004 20.525 15.5 6 23.200000000000003 38.25 21.025 17.525 7 23.075000000000003 24.3 34.375 18.25 8 18.275 25.674999999999997 31.7 24.349999999999998 9 23.3 23.799999999999997 29.45 23.45 10-14 24.925 28.825 26.27 19.98 15-19 24.05 27.884999999999998 27.744999999999997 20.32 20-24 24.375 28.74 26.735 20.150000000000002 25-29 23.96 28.249999999999996 27.450000000000003 20.34 30-34 23.799999999999997 28.199999999999996 27.644999999999996 20.355 35-39 22.994999999999997 28.67 27.650000000000002 20.685000000000002 40-44 23.935000000000002 28.215 27.49 20.36 45-49 23.26 27.860000000000003 28.345 20.535 50-54 23.275000000000002 28.595 27.55 20.580000000000002 55-59 22.945 28.139999999999997 27.99 20.925 60-64 24.035 28.595 27.215 20.155 65-69 23.505000000000003 27.77 28.04 20.685000000000002 70-74 23.11 29.455 27.1 20.335 75-79 23.22 28.634999999999998 27.474999999999998 20.669999999999998 80-84 22.79 29.325000000000003 27.034999999999997 20.849999999999998 85-89 24.19 28.249999999999996 26.779999999999998 20.78 90-94 23.345 28.999999999999996 26.645000000000003 21.01 95-99 23.169999999999998 28.88 27.32 20.630000000000003 100-104 24.205 28.95 26.66 20.185 105-109 24.104999999999997 28.465 27.365000000000002 20.064999999999998 110-114 24.055 28.63 27.805000000000003 19.509999999999998 115-119 24.01 29.104999999999997 27.065 19.82 120-124 23.97 28.305000000000003 27.415 20.31 125-129 23.56 28.665000000000003 27.534999999999997 20.24 130-134 24.62 28.065 27.295 20.02 135-139 25.040000000000003 28.754999999999995 26.979999999999997 19.225 140-144 24.785 28.52 27.02 19.675 145-149 25.155 28.83 26.179999999999996 19.835 150-151 25.3125 29.2 26.35 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.5 10 1.5 11 2.5 12 2.0 13 3.0 14 3.5 15 2.0 16 1.5 17 1.5 18 1.5 19 1.5 20 2.0 21 3.0 22 2.5 23 2.0 24 3.0 25 4.0 26 3.0 27 7.5 28 12.0 29 14.5 30 17.5 31 19.5 32 28.0 33 40.0 34 49.5 35 62.5 36 72.5 37 101.5 38 123.0 39 141.0 40 183.0 41 206.5 42 231.5 43 259.5 44 276.0 45 276.5 46 264.0 47 249.5 48 241.5 49 220.0 50 174.5 51 137.0 52 107.0 53 87.5 54 76.0 55 57.5 56 46.0 57 38.5 58 30.5 59 22.5 60 11.5 61 9.0 62 9.0 63 5.5 64 2.0 65 1.5 66 1.5 67 0.0 68 0.5 69 1.0 70 0.5 71 1.5 72 2.0 73 1.0 74 1.0 75 1.5 76 1.0 77 0.5 78 1.0 79 1.0 80 2.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 1.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.36551724137931 82.8 2 7.668965517241379 13.900000000000002 3 0.7448275862068966 2.025 4 0.16551724137931034 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027586206896551724 0.2 9 0.0 0.0 >10 0.027586206896551724 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1375000000000002 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.262499999999999 0.0 0.0 0.0 0.0 136-137 4.675000000000001 0.0 0.0 0.0 0.0 138-139 4.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAGCAC 10 0.006830828 145.0 3 >>END_MODULE Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531239 spots for SRR12670975.sra Written 531239 spots for SRR12670975.sra Read 531242 spots for SRR12670975.sra Written 531242 spots for SRR12670975.sra SRR ids: ['SRR12670975.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3m_so982 SRR12670975.sra spots: 10624783 blocks: [[1, 531239], [531240, 1062478], [1062479, 1593717], [1593718, 2124956], [2124957, 2656195], [2656196, 3187434], [3187435, 3718673], [3718674, 4249912], [4249913, 4781151], [4781152, 5312390], [5312391, 5843629], [5843630, 6374868], [6374869, 6906107], [6906108, 7437346], [7437347, 7968585], [7968586, 8499824], [8499825, 9031063], [9031064, 9562302], [9562303, 10093541], [10093542, 10624783]] SRR12670975 file size 3589065 SRR12670975 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670975 SRR12670975_1.fastq SRR12670975_2.fastq Input file: SRR12670975_1.fastq Paired file: SRR12670975_2.fastq trimmed: SRR12670975-trimmed-pair1.fastq, SRR12670975-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:51:16 2025 >> started Tue Feb 11 10:51:28 2025 >> done (11.529s) 10624783 read pairs processed; of these: 179 ( 0.00%) short read pairs filtered out after trimming by size control 5309 ( 0.05%) empty read pairs filtered out after trimming by size control 10619295 (99.95%) read pairs available; of these: 822296 ( 7.74%) trimmed read pairs available after processing 9796999 (92.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 21 0.00% 20 19 0.00% 21 19 0.00% 22 20 0.00% 23 33 0.00% 24 37 0.00% 25 19 0.00% 26 41 0.00% 27 29 0.00% 28 26 0.00% 29 17 0.00% 30 26 0.00% 31 39 0.00% 32 30 0.00% 33 37 0.00% 34 25 0.00% 35 40 0.00% 36 32 0.00% 37 35 0.00% 38 28 0.00% 39 36 0.00% 40 32 0.00% 41 34 0.00% 42 18 0.00% 43 40 0.00% 44 25 0.00% 45 40 0.00% 46 45 0.00% 47 42 0.00% 48 46 0.00% 49 58 0.00% 50 43 0.00% 51 66 0.00% 52 60 0.00% 53 78 0.00% 54 66 0.00% 55 85 0.00% 56 113 0.00% 57 115 0.00% 58 126 0.00% 59 127 0.00% 60 168 0.00% 61 207 0.00% 62 201 0.00% 63 231 0.00% 64 251 0.00% 65 290 0.00% 66 335 0.00% 67 343 0.00% 68 402 0.00% 69 486 0.00% 70 576 0.01% 71 601 0.01% 72 689 0.01% 73 717 0.01% 74 842 0.01% 75 944 0.01% 76 991 0.01% 77 1085 0.01% 78 1239 0.01% 79 1351 0.01% 80 1442 0.01% 81 1644 0.02% 82 1744 0.02% 83 1878 0.02% 84 2112 0.02% 85 2343 0.02% 86 2405 0.02% 87 2499 0.02% 88 2637 0.02% 89 2859 0.03% 90 3124 0.03% 91 3301 0.03% 92 3523 0.03% 93 3747 0.04% 94 4043 0.04% 95 4327 0.04% 96 4599 0.04% 97 4810 0.05% 98 4981 0.05% 99 5108 0.05% 100 5567 0.05% 101 5474 0.05% 102 6124 0.06% 103 6179 0.06% 104 6721 0.06% 105 6913 0.07% 106 7155 0.07% 107 7197 0.07% 108 7507 0.07% 109 7826 0.07% 110 7916 0.07% 111 8546 0.08% 112 8981 0.08% 113 9143 0.09% 114 9615 0.09% 115 9842 0.09% 116 10530 0.10% 117 11017 0.10% 118 11223 0.11% 119 11522 0.11% 120 11729 0.11% 121 12208 0.11% 122 12729 0.12% 123 13260 0.12% 124 14210 0.13% 125 14273 0.13% 126 14862 0.14% 127 15260 0.14% 128 15274 0.14% 129 15915 0.15% 130 16292 0.15% 131 16591 0.16% 132 17243 0.16% 133 17589 0.17% 134 18267 0.17% 135 18791 0.18% 136 18907 0.18% 137 19419 0.18% 138 19921 0.19% 139 20493 0.19% 140 20535 0.19% 141 21440 0.20% 142 21680 0.20% 143 22360 0.21% 144 23457 0.22% 145 23326 0.22% 146 23630 0.22% 147 24963 0.24% 148 24455 0.23% 149 25237 0.24% 150 26018 0.25% 151 9796999 92.26% 10619295 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=19.81 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.9 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.84 prefix-fanout=2.0 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=10.77 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=3.6 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12670975 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:52:13 Started mapping on | Feb 11 10:52:13 Finished on | Feb 11 10:53:35 Mapping speed, Million of reads per hour | 466.21 Number of input reads | 10619295 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 9496063 Uniquely mapped reads % | 89.42% Average mapped length | 296.05 Number of splices: Total | 9361447 Number of splices: Annotated (sjdb) | 9168725 Number of splices: GT/AG | 9162901 Number of splices: GC/AG | 160638 Number of splices: AT/AC | 6167 Number of splices: Non-canonical | 31741 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247111 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 65953 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.28% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 876121 876121 876121 N_multimapping 247111 247111 247111 N_noFeature 330697 9345797 380920 N_ambiguous 171176 719 70722 UnstrandedReadsAssigned:8994190 PositiveStrandReadsAssigned:149547 NegativeStrandReadsAssigned:9044421 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670975 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670975-trimmed-pair1.fastq SRR12670975-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,619,295 reads, 9,152,691 reads pseudoaligned [quant] estimated average fragment length: 270.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR12670975.ke.tsv 34699 SRR12670975.se.tsv 87100 total ==> SRR12670975.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.84 404 22.6082 Potri.005G024800.1.v4.1 1035 765.842 218 27.8581 Potri.004G059700.1.v4.1 961 692.055 0 0 Potri.007G009000.2.v4.1 1416 1146.84 0 0 Potri.003G141000.2.v4.1 2943 2673.84 479.481 17.5497 Potri.016G087400.1.v4.1 270 80.1148 378 461.758 Potri.015G069301.1.v4.1 564 312.185 0 0 Potri.010G195200.1.v4.1 1773 1503.84 77 5.01099 Potri.012G127500.1.v4.1 977 707.947 120 16.5888 ==> SRR12670975.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 116 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12670975 completed mapping pipeline successfully