Starting /dee2/code/volunteer_pipeline.sh SRR12670976 current disk space = 3052783067136 free memory = 1042446308 SRR12670976 SRAfilesize 5eea54d1c06fe4326f4597ec08483762 SRR12670976.sra SRR12670976.sra file validated SRR12670976 is paired end SRR12670976 is conventional basespace SRR12670976 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670976_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.393 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.5235 37.0 37.0 37.0 37.0 37.0 4 36.5945 37.0 37.0 37.0 37.0 37.0 5 36.599 37.0 37.0 37.0 37.0 37.0 6 36.587 37.0 37.0 37.0 37.0 37.0 7 36.4635 37.0 37.0 37.0 37.0 37.0 8 36.5975 37.0 37.0 37.0 37.0 37.0 9 36.6555 37.0 37.0 37.0 37.0 37.0 10-14 36.60359999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5531 37.0 37.0 37.0 37.0 37.0 20-24 36.4803 37.0 37.0 37.0 37.0 37.0 25-29 36.49470000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4187 37.0 37.0 37.0 37.0 37.0 35-39 36.4174 37.0 37.0 37.0 37.0 37.0 40-44 36.3944 37.0 37.0 37.0 37.0 37.0 45-49 36.3609 37.0 37.0 37.0 37.0 37.0 50-54 36.365899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3538 37.0 37.0 37.0 37.0 37.0 60-64 36.3202 37.0 37.0 37.0 37.0 37.0 65-69 36.301 37.0 37.0 37.0 37.0 37.0 70-74 36.27 37.0 37.0 37.0 37.0 37.0 75-79 36.2524 37.0 37.0 37.0 37.0 37.0 80-84 36.1998 37.0 37.0 37.0 37.0 37.0 85-89 36.166599999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.174 37.0 37.0 37.0 37.0 37.0 95-99 36.0929 37.0 37.0 37.0 37.0 37.0 100-104 36.143100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0447 37.0 37.0 37.0 37.0 37.0 110-114 36.0739 37.0 37.0 37.0 37.0 37.0 115-119 35.997400000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0094 37.0 37.0 37.0 37.0 37.0 125-129 35.922900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.81009999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.76819999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7147 37.0 37.0 37.0 37.0 37.0 145-149 35.5597 37.0 37.0 37.0 37.0 37.0 150-151 35.3825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 0.0 24 4.0 25 3.0 26 9.0 27 7.0 28 15.0 29 19.0 30 37.0 31 48.0 32 72.0 33 87.0 34 145.0 35 252.0 36 2681.0 37 617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.34817408704352 11.505752876438219 4.452226113056528 37.693846923461734 2 17.599999999999998 11.774999999999999 39.775 30.85 3 16.775000000000002 16.1 31.0 36.125 4 23.200000000000003 22.425 25.3 29.075 5 23.225 29.299999999999997 25.974999999999998 21.5 6 18.475 34.0 24.75 22.775000000000002 7 15.8 27.275 41.375 15.55 8 15.275 26.075 33.775 24.875 9 16.7 22.85 36.925000000000004 23.525 10-14 19.28 30.06 28.449999999999996 22.21 15-19 19.68 28.12 28.025 24.175 20-24 19.5 28.155 28.725 23.62 25-29 19.825 28.435 28.49 23.25 30-34 19.285 28.884999999999998 28.09 23.74 35-39 19.915 28.435 28.255000000000003 23.395 40-44 19.845 28.694999999999997 28.325 23.135 45-49 20.349999999999998 29.03 27.58 23.04 50-54 20.535 28.470000000000002 27.785 23.21 55-59 19.37 28.555000000000003 28.42 23.655 60-64 20.27 28.595 28.095 23.04 65-69 20.385 28.28 27.61 23.724999999999998 70-74 20.03 28.439999999999998 27.639999999999997 23.89 75-79 19.89 28.749999999999996 27.93 23.43 80-84 20.185 28.299999999999997 27.810000000000002 23.705000000000002 85-89 20.185 28.71 27.77 23.335 90-94 20.285 28.475 27.495000000000005 23.745 95-99 20.735 28.715000000000003 27.855 22.695 100-104 20.79 28.765 27.450000000000003 22.994999999999997 105-109 20.735 28.345 27.134999999999998 23.785 110-114 20.47 27.785 28.175 23.57 115-119 20.765 28.26 27.589999999999996 23.385 120-124 19.72 28.095 28.084999999999997 24.099999999999998 125-129 20.95 28.02 27.750000000000004 23.28 130-134 21.32 28.299999999999997 27.134999999999998 23.244999999999997 135-139 21.075 28.970000000000002 26.795 23.16 140-144 20.695 28.13 27.52 23.655 145-149 20.93 28.505000000000003 26.505000000000003 24.060000000000002 150-151 20.599999999999998 28.7375 26.5625 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.5 18 2.0 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 2.5 25 5.5 26 6.5 27 11.0 28 15.0 29 18.5 30 28.5 31 26.0 32 33.5 33 45.5 34 50.0 35 72.0 36 93.0 37 105.5 38 134.5 39 172.0 40 209.0 41 226.5 42 227.0 43 251.0 44 267.0 45 264.0 46 260.0 47 257.0 48 234.0 49 189.0 50 165.5 51 138.0 52 102.0 53 91.5 54 84.0 55 61.5 56 35.0 57 24.0 58 19.5 59 13.5 60 13.0 61 12.5 62 8.0 63 5.5 64 4.0 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85164835164835 82.675 2 8.434065934065934 15.35 3 0.6868131868131868 1.875 4 0.027472527472527472 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.675 0.0 0.0 0.0 0.0 134-135 5.112500000000001 0.0 0.0 0.0 0.0 136-137 5.512499999999999 0.0 0.0 0.0 0.0 138-139 5.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGTAAT 10 0.006830828 145.0 2 >>END_MODULE SRR12670976 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12670976_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.204 37.0 37.0 37.0 37.0 37.0 2 36.0805 37.0 37.0 37.0 37.0 37.0 3 36.287 37.0 37.0 37.0 37.0 37.0 4 36.249 37.0 37.0 37.0 37.0 37.0 5 36.375 37.0 37.0 37.0 37.0 37.0 6 36.271 37.0 37.0 37.0 37.0 37.0 7 36.2665 37.0 37.0 37.0 37.0 37.0 8 36.371 37.0 37.0 37.0 37.0 37.0 9 36.3515 37.0 37.0 37.0 37.0 37.0 10-14 36.3486 37.0 37.0 37.0 37.0 37.0 15-19 36.3724 37.0 37.0 37.0 37.0 37.0 20-24 36.3783 37.0 37.0 37.0 37.0 37.0 25-29 36.244099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.275800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2387 37.0 37.0 37.0 37.0 37.0 40-44 36.192 37.0 37.0 37.0 37.0 37.0 45-49 36.2121 37.0 37.0 37.0 37.0 37.0 50-54 36.1494 37.0 37.0 37.0 37.0 37.0 55-59 36.1611 37.0 37.0 37.0 37.0 37.0 60-64 36.094800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.154399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.1287 37.0 37.0 37.0 37.0 37.0 75-79 36.045300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.064299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.982299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.98009999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.0111 37.0 37.0 37.0 37.0 37.0 100-104 36.0101 37.0 37.0 37.0 37.0 37.0 105-109 35.898999999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.874199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8125 37.0 37.0 37.0 37.0 37.0 120-124 35.7635 37.0 37.0 37.0 37.0 37.0 125-129 35.677499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.6616 37.0 37.0 37.0 37.0 37.0 135-139 35.657000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.6413 37.0 37.0 37.0 37.0 37.0 145-149 35.3786 37.0 37.0 37.0 37.0 37.0 150-151 35.23675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 7.0 23 6.0 24 6.0 25 6.0 26 11.0 27 18.0 28 15.0 29 20.0 30 36.0 31 40.0 32 49.0 33 82.0 34 148.0 35 406.0 36 2579.0 37 559.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.475 25.174999999999997 8.450000000000001 23.9 2 26.85 24.9 33.125 15.125 3 20.3 26.0 35.875 17.825 4 22.875 33.25 24.7 19.175 5 25.525 38.125 20.7 15.65 6 20.775 40.1 20.875 18.25 7 21.075 23.325000000000003 37.45 18.15 8 18.475 27.125 29.725 24.675 9 22.25 22.75 31.674999999999997 23.325000000000003 10-14 22.42 29.555 27.445000000000004 20.580000000000002 15-19 23.335 28.884999999999998 27.355 20.424999999999997 20-24 22.555 29.095 27.77 20.580000000000002 25-29 22.62 28.055000000000003 28.389999999999997 20.935000000000002 30-34 22.43 27.965 28.645 20.96 35-39 22.0 29.220000000000002 27.92 20.86 40-44 23.080000000000002 27.83 28.615000000000002 20.474999999999998 45-49 22.455 27.98 28.205000000000002 21.36 50-54 22.715 28.875 27.54 20.87 55-59 22.93 28.12 27.845 21.105 60-64 22.564999999999998 27.705000000000002 28.235 21.495 65-69 22.96 27.97 28.299999999999997 20.77 70-74 23.150000000000002 27.85 27.93 21.07 75-79 22.655 28.360000000000003 27.825 21.16 80-84 22.355 28.205000000000002 28.07 21.37 85-89 23.525 28.1 27.700000000000003 20.674999999999997 90-94 22.985 28.185 28.255000000000003 20.575 95-99 22.95 28.299999999999997 27.85 20.9 100-104 23.32 28.02 27.950000000000003 20.71 105-109 23.53 28.144999999999996 27.474999999999998 20.849999999999998 110-114 23.685000000000002 28.299999999999997 27.415 20.599999999999998 115-119 23.13 29.054999999999996 27.255000000000003 20.560000000000002 120-124 23.880000000000003 28.294999999999998 27.71 20.115 125-129 23.73 27.655 27.99 20.625 130-134 23.830000000000002 28.79 27.245 20.135 135-139 24.09 28.4 27.71 19.8 140-144 24.37 28.155 27.24 20.235 145-149 24.505 28.975 26.640000000000004 19.88 150-151 25.9875 27.712500000000002 27.3375 18.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.5 16 1.5 17 2.0 18 1.5 19 3.0 20 3.0 21 0.5 22 2.0 23 3.0 24 4.5 25 5.5 26 9.0 27 12.0 28 11.0 29 14.0 30 18.5 31 21.5 32 28.0 33 42.5 34 54.0 35 69.5 36 95.5 37 119.5 38 140.0 39 161.5 40 202.0 41 244.0 42 248.0 43 256.5 44 284.0 45 292.0 46 269.0 47 237.5 48 217.5 49 187.5 50 156.0 51 124.0 52 106.0 53 85.0 54 57.5 55 45.5 56 40.5 57 32.5 58 23.0 59 18.0 60 9.5 61 6.0 62 3.5 63 3.5 64 3.5 65 2.0 66 1.5 67 0.5 68 0.5 69 1.0 70 1.5 71 2.5 72 1.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27811300054854 83.2 2 7.953922106417992 14.499999999999998 3 0.6582556226001097 1.7999999999999998 4 0.08228195282501372 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027427317608337907 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.7125 0.0 0.0 0.0 0.0 134-135 5.137499999999999 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 5.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679560 spots for SRR12670976.sra Written 679560 spots for SRR12670976.sra Read 679571 spots for SRR12670976.sra Written 679571 spots for SRR12670976.sra SRR ids: ['SRR12670976.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0sr711ml SRR12670976.sra spots: 13591211 blocks: [[1, 679560], [679561, 1359120], [1359121, 2038680], [2038681, 2718240], [2718241, 3397800], [3397801, 4077360], [4077361, 4756920], [4756921, 5436480], [5436481, 6116040], [6116041, 6795600], [6795601, 7475160], [7475161, 8154720], [8154721, 8834280], [8834281, 9513840], [9513841, 10193400], [10193401, 10872960], [10872961, 11552520], [11552521, 12232080], [12232081, 12911640], [12911641, 13591211]] SRR12670976 file size 4597187 SRR12670976 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12670976 SRR12670976_1.fastq SRR12670976_2.fastq Input file: SRR12670976_1.fastq Paired file: SRR12670976_2.fastq trimmed: SRR12670976-trimmed-pair1.fastq, SRR12670976-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:53:12 2025 >> started Tue Feb 11 10:53:27 2025 >> done (15.590s) 13591211 read pairs processed; of these: 165 ( 0.00%) short read pairs filtered out after trimming by size control 4723 ( 0.03%) empty read pairs filtered out after trimming by size control 13586323 (99.96%) read pairs available; of these: 1073450 ( 7.90%) trimmed read pairs available after processing 12512873 (92.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 9 0.00% 21 17 0.00% 22 16 0.00% 23 9 0.00% 24 10 0.00% 25 22 0.00% 26 12 0.00% 27 31 0.00% 28 23 0.00% 29 30 0.00% 30 22 0.00% 31 35 0.00% 32 27 0.00% 33 18 0.00% 34 23 0.00% 35 24 0.00% 36 31 0.00% 37 31 0.00% 38 43 0.00% 39 25 0.00% 40 42 0.00% 41 26 0.00% 42 29 0.00% 43 35 0.00% 44 43 0.00% 45 38 0.00% 46 37 0.00% 47 44 0.00% 48 56 0.00% 49 56 0.00% 50 72 0.00% 51 70 0.00% 52 77 0.00% 53 80 0.00% 54 104 0.00% 55 102 0.00% 56 114 0.00% 57 128 0.00% 58 149 0.00% 59 187 0.00% 60 212 0.00% 61 196 0.00% 62 224 0.00% 63 306 0.00% 64 266 0.00% 65 318 0.00% 66 387 0.00% 67 444 0.00% 68 507 0.00% 69 543 0.00% 70 687 0.01% 71 728 0.01% 72 888 0.01% 73 932 0.01% 74 1058 0.01% 75 1110 0.01% 76 1222 0.01% 77 1381 0.01% 78 1539 0.01% 79 1666 0.01% 80 1907 0.01% 81 2069 0.02% 82 2342 0.02% 83 2567 0.02% 84 2815 0.02% 85 3081 0.02% 86 3203 0.02% 87 3646 0.03% 88 3714 0.03% 89 4047 0.03% 90 4331 0.03% 91 4631 0.03% 92 4888 0.04% 93 5295 0.04% 94 5624 0.04% 95 5945 0.04% 96 6291 0.05% 97 6689 0.05% 98 7115 0.05% 99 7225 0.05% 100 7616 0.06% 101 7809 0.06% 102 8163 0.06% 103 8720 0.06% 104 9065 0.07% 105 9647 0.07% 106 10032 0.07% 107 10506 0.08% 108 10724 0.08% 109 11070 0.08% 110 11162 0.08% 111 12001 0.09% 112 12484 0.09% 113 12541 0.09% 114 13425 0.10% 115 13832 0.10% 116 13946 0.10% 117 14861 0.11% 118 15113 0.11% 119 15898 0.12% 120 16270 0.12% 121 16575 0.12% 122 16998 0.13% 123 17563 0.13% 124 18377 0.14% 125 18342 0.14% 126 19131 0.14% 127 19635 0.14% 128 19912 0.15% 129 20584 0.15% 130 21274 0.16% 131 21375 0.16% 132 21931 0.16% 133 22844 0.17% 134 22950 0.17% 135 23682 0.17% 136 24524 0.18% 137 24710 0.18% 138 25176 0.19% 139 26264 0.19% 140 26593 0.20% 141 26908 0.20% 142 27624 0.20% 143 27904 0.21% 144 29185 0.21% 145 29374 0.22% 146 29718 0.22% 147 30284 0.22% 148 31314 0.23% 149 31407 0.23% 150 32401 0.24% 151 12512873 92.10% 13586323 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=19 prefix-density=0.33 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=13.42 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.2 sequence=TGCTTGCTTCTAATCTTAA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=29 prefix-density=0.44 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=79.89 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=10.5 sequence=AAAAGAAAAGAAAA SRR12670976 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:54:12 Started mapping on | Feb 11 10:54:12 Finished on | Feb 11 10:55:53 Mapping speed, Million of reads per hour | 484.26 Number of input reads | 13586323 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12665426 Uniquely mapped reads % | 93.22% Average mapped length | 296.58 Number of splices: Total | 12544687 Number of splices: Annotated (sjdb) | 12274986 Number of splices: GT/AG | 12307409 Number of splices: GC/AG | 194146 Number of splices: AT/AC | 8032 Number of splices: Non-canonical | 35100 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316439 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 30150 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 604458 604458 604458 N_multimapping 316439 316439 316439 N_noFeature 528529 12496981 592911 N_ambiguous 186338 744 81864 UnstrandedReadsAssigned:11950559 PositiveStrandReadsAssigned:167701 NegativeStrandReadsAssigned:11990651 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12670976 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12670976-trimmed-pair1.fastq SRR12670976-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,586,323 reads, 11,986,322 reads pseudoaligned [quant] estimated average fragment length: 271.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR12670976.ke.tsv 34699 SRR12670976.se.tsv 87100 total ==> SRR12670976.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.24 485 22.1276 Potri.005G024800.1.v4.1 1035 764.239 238 24.8252 Potri.004G059700.1.v4.1 961 690.543 7 0.808075 Potri.007G009000.2.v4.1 1416 1145.24 0 0 Potri.003G141000.2.v4.1 2943 2672.24 869.724 25.9448 Potri.016G087400.1.v4.1 270 80.0519 550 547.691 Potri.015G069301.1.v4.1 564 310.68 0 0 Potri.010G195200.1.v4.1 1773 1502.24 167 8.8618 Potri.012G127500.1.v4.1 977 706.397 232 26.1809 ==> SRR12670976.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 343 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12670976 completed mapping pipeline successfully